ID: 1124349968

View in Genome Browser
Species Human (GRCh38)
Location 15:28948062-28948084
Sequence CACATCATCACCTCTCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 168}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124349968_1124349976 14 Left 1124349968 15:28948062-28948084 CCATCCAGAGAGGTGATGATGTG 0: 1
1: 0
2: 1
3: 15
4: 168
Right 1124349976 15:28948099-28948121 TAGAGTCTACTGTTTTCAGGGGG 0: 1
1: 0
2: 2
3: 13
4: 145
1124349968_1124349977 29 Left 1124349968 15:28948062-28948084 CCATCCAGAGAGGTGATGATGTG 0: 1
1: 0
2: 1
3: 15
4: 168
Right 1124349977 15:28948114-28948136 TCAGGGGGCATTTGCATCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 130
1124349968_1124349973 11 Left 1124349968 15:28948062-28948084 CCATCCAGAGAGGTGATGATGTG 0: 1
1: 0
2: 1
3: 15
4: 168
Right 1124349973 15:28948096-28948118 GTATAGAGTCTACTGTTTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 115
1124349968_1124349974 12 Left 1124349968 15:28948062-28948084 CCATCCAGAGAGGTGATGATGTG 0: 1
1: 0
2: 1
3: 15
4: 168
Right 1124349974 15:28948097-28948119 TATAGAGTCTACTGTTTTCAGGG 0: 1
1: 0
2: 1
3: 7
4: 218
1124349968_1124349975 13 Left 1124349968 15:28948062-28948084 CCATCCAGAGAGGTGATGATGTG 0: 1
1: 0
2: 1
3: 15
4: 168
Right 1124349975 15:28948098-28948120 ATAGAGTCTACTGTTTTCAGGGG 0: 1
1: 0
2: 4
3: 11
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124349968 Original CRISPR CACATCATCACCTCTCTGGA TGG (reversed) Intronic