ID: 1124349970

View in Genome Browser
Species Human (GRCh38)
Location 15:28948066-28948088
Sequence TAACCACATCATCACCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124349970_1124349974 8 Left 1124349970 15:28948066-28948088 CCAGAGAGGTGATGATGTGGTTA 0: 1
1: 0
2: 0
3: 16
4: 141
Right 1124349974 15:28948097-28948119 TATAGAGTCTACTGTTTTCAGGG 0: 1
1: 0
2: 1
3: 7
4: 218
1124349970_1124349975 9 Left 1124349970 15:28948066-28948088 CCAGAGAGGTGATGATGTGGTTA 0: 1
1: 0
2: 0
3: 16
4: 141
Right 1124349975 15:28948098-28948120 ATAGAGTCTACTGTTTTCAGGGG 0: 1
1: 0
2: 4
3: 11
4: 171
1124349970_1124349976 10 Left 1124349970 15:28948066-28948088 CCAGAGAGGTGATGATGTGGTTA 0: 1
1: 0
2: 0
3: 16
4: 141
Right 1124349976 15:28948099-28948121 TAGAGTCTACTGTTTTCAGGGGG 0: 1
1: 0
2: 2
3: 13
4: 145
1124349970_1124349977 25 Left 1124349970 15:28948066-28948088 CCAGAGAGGTGATGATGTGGTTA 0: 1
1: 0
2: 0
3: 16
4: 141
Right 1124349977 15:28948114-28948136 TCAGGGGGCATTTGCATCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 130
1124349970_1124349973 7 Left 1124349970 15:28948066-28948088 CCAGAGAGGTGATGATGTGGTTA 0: 1
1: 0
2: 0
3: 16
4: 141
Right 1124349973 15:28948096-28948118 GTATAGAGTCTACTGTTTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124349970 Original CRISPR TAACCACATCATCACCTCTC TGG (reversed) Intronic