ID: 1124349974 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:28948097-28948119 |
Sequence | TATAGAGTCTACTGTTTTCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 227 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 7, 4: 218} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1124349967_1124349974 | 19 | Left | 1124349967 | 15:28948055-28948077 | CCTTGCACCATCCAGAGAGGTGA | 0: 1 1: 0 2: 0 3: 18 4: 172 |
||
Right | 1124349974 | 15:28948097-28948119 | TATAGAGTCTACTGTTTTCAGGG | 0: 1 1: 0 2: 1 3: 7 4: 218 |
||||
1124349970_1124349974 | 8 | Left | 1124349970 | 15:28948066-28948088 | CCAGAGAGGTGATGATGTGGTTA | 0: 1 1: 0 2: 0 3: 16 4: 141 |
||
Right | 1124349974 | 15:28948097-28948119 | TATAGAGTCTACTGTTTTCAGGG | 0: 1 1: 0 2: 1 3: 7 4: 218 |
||||
1124349968_1124349974 | 12 | Left | 1124349968 | 15:28948062-28948084 | CCATCCAGAGAGGTGATGATGTG | 0: 1 1: 0 2: 1 3: 15 4: 168 |
||
Right | 1124349974 | 15:28948097-28948119 | TATAGAGTCTACTGTTTTCAGGG | 0: 1 1: 0 2: 1 3: 7 4: 218 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1124349974 | Original CRISPR | TATAGAGTCTACTGTTTTCA GGG | Intronic | ||