ID: 1124349975

View in Genome Browser
Species Human (GRCh38)
Location 15:28948098-28948120
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 4, 3: 11, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124349967_1124349975 20 Left 1124349967 15:28948055-28948077 CCTTGCACCATCCAGAGAGGTGA 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1124349975 15:28948098-28948120 ATAGAGTCTACTGTTTTCAGGGG 0: 1
1: 0
2: 4
3: 11
4: 171
1124349968_1124349975 13 Left 1124349968 15:28948062-28948084 CCATCCAGAGAGGTGATGATGTG 0: 1
1: 0
2: 1
3: 15
4: 168
Right 1124349975 15:28948098-28948120 ATAGAGTCTACTGTTTTCAGGGG 0: 1
1: 0
2: 4
3: 11
4: 171
1124349970_1124349975 9 Left 1124349970 15:28948066-28948088 CCAGAGAGGTGATGATGTGGTTA 0: 1
1: 0
2: 0
3: 16
4: 141
Right 1124349975 15:28948098-28948120 ATAGAGTCTACTGTTTTCAGGGG 0: 1
1: 0
2: 4
3: 11
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type