ID: 1124349976

View in Genome Browser
Species Human (GRCh38)
Location 15:28948099-28948121
Sequence TAGAGTCTACTGTTTTCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124349970_1124349976 10 Left 1124349970 15:28948066-28948088 CCAGAGAGGTGATGATGTGGTTA 0: 1
1: 0
2: 0
3: 16
4: 141
Right 1124349976 15:28948099-28948121 TAGAGTCTACTGTTTTCAGGGGG 0: 1
1: 0
2: 2
3: 13
4: 145
1124349968_1124349976 14 Left 1124349968 15:28948062-28948084 CCATCCAGAGAGGTGATGATGTG 0: 1
1: 0
2: 1
3: 15
4: 168
Right 1124349976 15:28948099-28948121 TAGAGTCTACTGTTTTCAGGGGG 0: 1
1: 0
2: 2
3: 13
4: 145
1124349967_1124349976 21 Left 1124349967 15:28948055-28948077 CCTTGCACCATCCAGAGAGGTGA 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1124349976 15:28948099-28948121 TAGAGTCTACTGTTTTCAGGGGG 0: 1
1: 0
2: 2
3: 13
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124349976 Original CRISPR TAGAGTCTACTGTTTTCAGG GGG Intronic