ID: 1124351697

View in Genome Browser
Species Human (GRCh38)
Location 15:28960601-28960623
Sequence AGGTTCCCCTTTAGGAACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124351697 Original CRISPR AGGTTCCCCTTTAGGAACTG AGG Intronic
900010676 1:104258-104280 AGGCTCCCCAACAGGAACTGAGG + Intergenic
900026779 1:280822-280844 AGGCTCCCCAACAGGAACTGAGG + Intergenic
900036574 1:414737-414759 AGGCTCCCCAACAGGAACTGAGG + Intergenic
900058203 1:650485-650507 AGGCTCCCCAACAGGAACTGAGG + Intergenic
903545471 1:24121043-24121065 AGCTGGCCCTTTAGGTACTGTGG + Exonic
904199903 1:28812712-28812734 AGGTGCCCCTGCAGGAAATGCGG - Intronic
904849029 1:33443246-33443268 AGGCTCTGCTTTAGGAACTGGGG + Intergenic
907245390 1:53105390-53105412 AGTTTCCTCTTCAGGAAGTGGGG + Intronic
911011557 1:93286607-93286629 AGTTTCTCCTTAAAGAACTGAGG - Intergenic
914689375 1:150011854-150011876 CGCCTCCCCTTTAGAAACTGAGG - Intergenic
915692159 1:157700406-157700428 CTGGTCACCTTTAGGAACTGAGG + Intronic
915723574 1:158001856-158001878 AGACTCCCCTGTAAGAACTGGGG + Intronic
919388294 1:196949524-196949546 AACTTCCCCTGTAGGAACTTGGG - Exonic
919390799 1:196982954-196982976 AACTTCCCCTGTAGGAACTTGGG - Exonic
920373736 1:205495283-205495305 AGGTTCAACTTTAGGAAATGAGG - Intergenic
920508101 1:206531320-206531342 AGGGTCGCATTCAGGAACTGTGG + Intronic
924340306 1:243023015-243023037 AGGCTCCCCAACAGGAACTGAGG + Intergenic
924421754 1:243916619-243916641 ACTTTCCCCTCAAGGAACTGAGG - Intergenic
1065708047 10:28489284-28489306 AGGTTCCCCTTCAGGAATGAAGG + Intergenic
1066736193 10:38482597-38482619 AGGCTCCCCAACAGGAACTGAGG - Intergenic
1069821561 10:71231688-71231710 AGGTTCTGGTTTAGGGACTGTGG + Intronic
1071473427 10:86004087-86004109 AGTTTCCCCATTGGGAAATGAGG - Intronic
1071556159 10:86603624-86603646 AGAATCCCATTTAGGCACTGAGG + Intergenic
1072153158 10:92699529-92699551 ACGCTCCGCTCTAGGAACTGAGG - Intergenic
1073433961 10:103504911-103504933 AGCTTCCCATCTAGGAACTGAGG - Intronic
1077246194 11:1540120-1540142 AGCCTCCCCTTGAGGAGCTGTGG + Intergenic
1078144790 11:8715340-8715362 AGGTTCCCCATTAGTAAGTGTGG - Intronic
1079016437 11:16872864-16872886 AGGCACTCCTTTAGGTACTGGGG + Intronic
1080648856 11:34207025-34207047 AGTTTCTGCTTTAGGGACTGGGG - Intronic
1081464733 11:43306014-43306036 AGGAAACCATTTAGGAACTGTGG + Intergenic
1085821768 11:79801503-79801525 AGGTTCTCTTCTAGGCACTGAGG - Intergenic
1087442735 11:98207405-98207427 AGCTTCCACTGTAGGCACTGGGG + Intergenic
1087924647 11:103905258-103905280 AAGTTCCCTTTTAAGAACTAAGG - Intergenic
1089700757 11:120242434-120242456 AGGATCCTCTTTTGGAAATGTGG + Intronic
1089845488 11:121454798-121454820 AGGTGCCCCTCTTGGAACTCTGG + Intronic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1091903506 12:4164692-4164714 GGGTGCCGCTTTGGGAACTGGGG - Intergenic
1094302614 12:28982537-28982559 ATGTTCCCCTCTAGGGAATGAGG + Intergenic
1095592924 12:43925026-43925048 AAATTCCACTTGAGGAACTGAGG - Intronic
1099160831 12:79239846-79239868 AGAGTCATCTTTAGGAACTGAGG - Intronic
1104669629 12:130671518-130671540 AGGTACCCATCTAGGCACTGGGG - Intronic
1106205141 13:27585933-27585955 ATGTTCCCATTTAGTAACAGCGG + Intronic
1106372073 13:29144634-29144656 AGGGTAGCCTCTAGGAACTGAGG - Intronic
1106836853 13:33643969-33643991 AGGTTCTCCTTTAAAAATTGAGG + Intergenic
1111818401 13:93183688-93183710 AGGTTCACTATTATGAACTGGGG - Intergenic
1115043847 14:28965132-28965154 AAGTTGCTCTTTTGGAACTGAGG - Intergenic
1116837755 14:49787650-49787672 AGGTTCCCATATATGAATTGTGG + Intronic
1118475173 14:66109699-66109721 ATGTTCCCCCTTGGGACCTGGGG - Intergenic
1121423553 14:93832462-93832484 AGGTACTTCTTTAGGTACTGGGG + Intergenic
1122889763 14:104726876-104726898 AGGTGACCCTTTGGGGACTGGGG - Intronic
1124351697 15:28960601-28960623 AGGTTCCCCTTTAGGAACTGAGG + Intronic
1125095425 15:35844764-35844786 AGTTTCCCTTTAAGGAACTGGGG + Intergenic
1126809642 15:52388558-52388580 AGGGTCTCCTTTAGGGATTGAGG - Intronic
1127916169 15:63457576-63457598 AGGTTCCCATGGAGGGACTGGGG - Intergenic
1128254507 15:66186810-66186832 AGTTTCCCCTTTTGTAAATGAGG - Intronic
1128308430 15:66615268-66615290 AGCCTCCCCTAGAGGAACTGGGG - Intronic
1128648232 15:69392550-69392572 AGGTACCACGTTAGGAGCTGAGG + Intronic
1133862310 16:9607574-9607596 ATGCTCCCATTTTGGAACTGAGG - Intergenic
1135801868 16:25504795-25504817 AGGTTTCAGTTTAGGAGCTGGGG - Intergenic
1136419802 16:30124632-30124654 AGATTCCCCTCTAGTGACTGAGG + Intergenic
1137713314 16:50582358-50582380 AGGGTCCACTTTAGGATATGTGG - Intronic
1138229242 16:55325288-55325310 ACGTTCTCATTTAGGGACTGGGG - Intronic
1142453670 16:90202658-90202680 AGGCTCCCCAACAGGAACTGAGG - Intergenic
1142620894 17:1165244-1165266 AGGCTCCCCTCCAGGGACTGAGG - Intronic
1146707185 17:35009617-35009639 AGGTTTCCCTTTAGGAAAAAAGG - Exonic
1150725801 17:67650399-67650421 AGGATGCCTTTTAGGAACTGGGG - Intronic
1151034515 17:70782891-70782913 GGGCTGCCCTTTAGGAGCTGTGG - Intergenic
1152366878 17:79861522-79861544 AGGCTCGCCTTGAGGATCTGGGG - Intergenic
1153640323 18:7151018-7151040 AGGTTACCTCCTAGGAACTGAGG + Intergenic
1155176946 18:23308913-23308935 CAGATCCCCTTTAGGTACTGAGG - Intronic
1156257837 18:35415066-35415088 ATGTTCCCACTTATGAACTGTGG - Intergenic
1156831208 18:41493581-41493603 AGCTTCCCCTTTAGCAAAAGAGG + Intergenic
1159475872 18:68920424-68920446 AGGTCCACTTTTAGGTACTGTGG + Intronic
1160018858 18:75165068-75165090 AGGGTACCCTGTAGGAGCTGGGG + Intergenic
1160602555 18:80024964-80024986 AAATTCCCCTTTAGAAACTCTGG + Intronic
1160774982 19:851208-851230 GGGTTCCTGTTTGGGAACTGAGG - Intronic
1162146630 19:8616397-8616419 AGGTGCCCATTTTGCAACTGAGG + Intergenic
1162406752 19:10479461-10479483 AGGATCCCCCTCAGGAAGTGAGG - Intergenic
1162907857 19:13834027-13834049 ATGTCCCCCCTTAAGAACTGGGG + Intergenic
1165119826 19:33551933-33551955 AGTTTCCCCATTGGTAACTGGGG + Intergenic
1166125821 19:40714892-40714914 AGGTAGCCCCTGAGGAACTGTGG - Intronic
1167019306 19:46861793-46861815 AGCTGTCCCTTTAGGACCTGCGG + Intergenic
1167239323 19:48333908-48333930 AGGTTCACCCGTGGGAACTGGGG + Intronic
1167441202 19:49510169-49510191 AGGTTCCCCTTCCTGAATTGAGG + Intronic
926991900 2:18689192-18689214 AGTTTCCCCTTCAGTAAATGTGG - Intergenic
927397579 2:22671577-22671599 ATTTTCCCCAATAGGAACTGGGG - Intergenic
929621486 2:43359266-43359288 AGGTGCCCTCTTAGGAAATGGGG - Intronic
931177558 2:59869175-59869197 AGGCTCCCCTCTGGGATCTGTGG + Intergenic
933384936 2:81597930-81597952 ATGTTCCCCATCAAGAACTGTGG - Intergenic
933663537 2:84946409-84946431 TGGTTCCCCTTTCTGATCTGTGG + Intergenic
936600789 2:113892208-113892230 AGGTTGCCCTTTAGGAAAGGAGG - Intronic
937438867 2:121900439-121900461 AGGATCTCCATTAGGAACTGGGG + Intergenic
938750121 2:134320478-134320500 GGCTTCCCCTTTATGGACTGGGG + Intronic
939535497 2:143422775-143422797 AGGCCCCCTTTTAGGAACTGGGG - Intronic
946955215 2:224922160-224922182 AGTTTCCACTTTAAAAACTGTGG + Intronic
947308897 2:228778716-228778738 AGGAACTCCTCTAGGAACTGTGG + Intergenic
947597033 2:231419464-231419486 AGGTTCCCCCTGAGTAACTCAGG + Intergenic
949085116 2:242147316-242147338 AGGCTCCCCAACAGGAACTGAGG - Intergenic
1169636697 20:7700187-7700209 AGGTTCCCCATGTAGAACTGTGG - Intergenic
1173168180 20:40700791-40700813 AGGTTTCCCTTGAGGACCTTGGG + Intergenic
1174107134 20:48170780-48170802 AGGTTCCCATTTGGATACTGTGG - Intergenic
1178584790 21:33862798-33862820 AGTTTCCCCAATAGGAAATGGGG + Intronic
1178675835 21:34631138-34631160 AGGTGCCCCTGTAGGCATTGGGG + Intergenic
1181432032 22:22887712-22887734 AGGCTGCCCTTTGGGAAGTGGGG + Intronic
1181610468 22:24008079-24008101 GGGTTCACCTTCAGGAACTCAGG + Intergenic
1184620180 22:45671446-45671468 AGGTTCACCTTGAGGAAGAGGGG - Intergenic
950014344 3:9745220-9745242 AGGTTTCCCTGTTGGAAGTGGGG + Intronic
950200336 3:11037774-11037796 AGTTTCCCCAGTAGGACCTGAGG - Exonic
951028103 3:17850684-17850706 AGGTTCCTCTTTTGCAAATGAGG - Intronic
951630466 3:24714590-24714612 AGGAGACCCTTTGGGAACTGTGG - Intergenic
952319290 3:32260832-32260854 AGTTTCCCTCTTAGGAACTAGGG - Intronic
955633478 3:61000245-61000267 AGGTCCTCCTTTAGGAGCTAAGG - Intronic
962649438 3:137473713-137473735 AAGTTCCTCTCTAGGAACTTTGG + Intergenic
966309116 3:178574221-178574243 AGGTTCCCATGGAGGAAATGAGG + Intronic
966486469 3:180476521-180476543 AGGTGCCCCTCTAGGAGCAGGGG + Intergenic
966691492 3:182746255-182746277 ATGTTCTCCTTTAGGAAGGGAGG - Intergenic
967537969 3:190628911-190628933 AGGTTCCTCTTTTGGAAAAGAGG - Intronic
967626591 3:191693149-191693171 AGGTACCTCTTAGGGAACTGGGG + Intergenic
969610697 4:8226301-8226323 TGTTAACCCTTTAGGAACTGCGG + Intronic
972770958 4:42196730-42196752 AGATTCCCCTTTTAGGACTGAGG + Intergenic
972868919 4:43271667-43271689 AGTCTCCACTTCAGGAACTGAGG - Intergenic
973804549 4:54513331-54513353 AGTTAGCCCTTAAGGAACTGAGG + Intergenic
977359286 4:95982352-95982374 AGGTTCCCCTTCAGAAATTGAGG - Intergenic
978897214 4:113903461-113903483 TGGTTCCCTTTTGGGAAGTGGGG - Exonic
979018285 4:115462957-115462979 AGCTTCCCCTTTCTGAATTGTGG + Intergenic
979262548 4:118665555-118665577 AGGCTCCCCAACAGGAACTGAGG - Intergenic
982160079 4:152559891-152559913 TGTTTCCCCTTTAAGCACTGAGG - Intergenic
984972243 4:185202106-185202128 AGGTTCTCCTTTGGGTACTGGGG - Intronic
986516753 5:8572667-8572689 ATGTTCCCCTTTAGGAGAAGAGG + Intergenic
991493742 5:67208338-67208360 GGGGTCCCCTTTAGTCACTGCGG + Intergenic
993300800 5:86207198-86207220 AGGTCCACGGTTAGGAACTGAGG - Intergenic
994148241 5:96418939-96418961 AGCTTCTCATTTAGTAACTGAGG - Intronic
995266176 5:110163970-110163992 AGTTTCCCCTTCAAAAACTGGGG - Intergenic
1000261047 5:159588972-159588994 TGGCTCCCCTTTAGGAATCGGGG + Intergenic
1001910617 5:175514315-175514337 AGGTTTCCCTATAGGGACTGGGG + Intronic
1002276098 5:178105164-178105186 GCGTTCCCCTTTGGGCACTGAGG + Intergenic
1002737247 5:181404125-181404147 AGGCTCCCCAACAGGAACTGAGG - Intergenic
1004419981 6:15460599-15460621 AGCTTCTCCATTGGGAACTGAGG + Intronic
1004472872 6:15944702-15944724 AGGTACCCCGTTAGGCTCTGGGG + Intergenic
1006091039 6:31629210-31629232 GGGTTCCACCTTTGGAACTGGGG - Exonic
1007785430 6:44276781-44276803 AGGTGTCCCTTTAGGAACTCAGG - Exonic
1008854122 6:56060936-56060958 AGGTTGCCCCTTAGGACCTGCGG + Exonic
1014212648 6:118722511-118722533 AGCTTCTCCTTCAGGAACTTTGG - Intergenic
1019242342 6:170679691-170679713 AGGCTCCCCAACAGGAACTGAGG - Intergenic
1020107020 7:5426908-5426930 AGGCTCCCCTTTACGAATGGGGG - Intergenic
1022812554 7:33884334-33884356 AAGATTCCATTTAGGAACTGAGG + Intergenic
1025992006 7:66503838-66503860 CGGGACCCCTTTAGGCACTGAGG - Intergenic
1027436383 7:78169055-78169077 AGGTACCCGTCTAGGAAATGTGG + Intronic
1028029818 7:85896358-85896380 AGATACCTTTTTAGGAACTGAGG + Intergenic
1028052163 7:86202071-86202093 AGCTTCCACTGTAGGCACTGGGG + Intergenic
1028336003 7:89656079-89656101 GGGTTGATCTTTAGGAACTGAGG + Intergenic
1028771720 7:94632257-94632279 TGGTTCCACTTCAGGACCTGTGG - Intronic
1028932558 7:96429279-96429301 AGGTACCCAAATAGGAACTGAGG + Intergenic
1034578691 7:152024652-152024674 AGGTTTCCCCTTAAGGACTGAGG - Intergenic
1035505775 8:128459-128481 AGGCTCCCCAACAGGAACTGAGG + Intergenic
1036970220 8:13347156-13347178 ATGTTCCCCTTTGGAAAATGGGG + Intronic
1040420967 8:47240255-47240277 AGGTTCCGGGTTAGGATCTGTGG + Intergenic
1042825052 8:72971771-72971793 AGGTCCTCCTTTGGTAACTGGGG - Intergenic
1044469680 8:92551879-92551901 AGGTCCCAATTTAGGATCTGAGG + Intergenic
1046211009 8:111076135-111076157 AGGATCCCCATTAGAAAATGAGG - Intergenic
1047932492 8:129744151-129744173 AGGTTTCTCTTTCTGAACTGTGG + Intergenic
1049343821 8:142128015-142128037 GGGCTCCCCTTGAGGGACTGAGG - Intergenic
1049772807 8:144391574-144391596 AGGGTCCCCTTCAGGTCCTGGGG - Exonic
1059185966 9:112271129-112271151 AGGTTCCTTTTTAAGTACTGAGG + Intronic
1060475445 9:123983290-123983312 AGGTTCTGTTTTAGGCACTGGGG - Intergenic
1060523568 9:124308119-124308141 AGTTTCCTCTTTGGAAACTGAGG - Intronic
1061735853 9:132658128-132658150 AGGTCCCACGTTAGGTACTGTGG + Intronic
1203602533 Un_KI270748v1:28913-28935 AGGCTCCCCAACAGGAACTGAGG - Intergenic
1186668180 X:11740651-11740673 AGGTTCCCCTTTATGGAGAGAGG + Intergenic
1186674504 X:11802030-11802052 AGAATCCACTTTAGAAACTGTGG - Intergenic
1192125955 X:68500771-68500793 AGGCACTCCTTTAGGCACTGGGG + Intronic
1193640179 X:84002865-84002887 AGTTTCCCCTTTAGAACCTCTGG + Intergenic
1193997463 X:88384222-88384244 GGCTTCCCCTTTAAGTACTGGGG - Intergenic
1194866364 X:99073519-99073541 ATTTTCCCCTTTAGAAACTTTGG - Intergenic
1198224438 X:134632336-134632358 AGGTTCCCCATGAGGCAGTGTGG - Intronic
1199557743 X:149127306-149127328 AGGTTTCTCTTTAGAAACTCTGG + Intergenic