ID: 1124356153

View in Genome Browser
Species Human (GRCh38)
Location 15:28996350-28996372
Sequence ATCTTGCCAGGGATGGAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124356146_1124356153 27 Left 1124356146 15:28996300-28996322 CCAGGAAGCTGAGCAGAAGAAAT 0: 1
1: 0
2: 4
3: 45
4: 363
Right 1124356153 15:28996350-28996372 ATCTTGCCAGGGATGGAGCGTGG 0: 1
1: 0
2: 0
3: 11
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124356153 Original CRISPR ATCTTGCCAGGGATGGAGCG TGG Intronic
900498382 1:2987326-2987348 ATCTGCCCATGGATGGAGGGAGG - Intergenic
901129899 1:6955678-6955700 ATCTTACCAGGCACGGAGCTAGG - Intronic
901835157 1:11919337-11919359 ATCTTAGCAGGGAAGGAGCTAGG + Intergenic
902852414 1:19170501-19170523 ATCTTGCAAGAGATAGAGCTGGG - Intronic
904742383 1:32688215-32688237 AGCTTGAGAGTGATGGAGCGAGG - Intronic
905173897 1:36124848-36124870 ATCCTGCCGGGGAGGGAACGGGG + Intronic
905656928 1:39691471-39691493 AACCTGCCCGGGATGGGGCGGGG - Exonic
905802599 1:40854778-40854800 GTGTGGCCAGGGATGGAGCAGGG + Intergenic
906747353 1:48231365-48231387 ATCCTGCCGGGGAGGGAGAGAGG + Intronic
909170969 1:72294928-72294950 ATCTTTCCAGGGATGGGGTGGGG + Intergenic
909911047 1:81258289-81258311 ATGTTGCCCAGGCTGGAGCGTGG - Intergenic
911304981 1:96222691-96222713 ATGTAGCCAGGGATGGAGGTAGG - Intergenic
915368822 1:155330966-155330988 AACTTGGGAGGGATGGAGTGGGG - Exonic
915621511 1:157088591-157088613 ATTTTGCCATGAATGGAGCTTGG - Intergenic
917755490 1:178094085-178094107 CTCTGGCTGGGGATGGAGCGGGG - Intergenic
919548154 1:198949453-198949475 ACCTTGCCAGGGACGGTGAGGGG - Intergenic
920098079 1:203499547-203499569 ATCTTGAGAGGGATGGAGCAAGG + Intronic
920200930 1:204259342-204259364 ATTTTGTCAGGGTTGGTGCGTGG + Exonic
921192676 1:212724551-212724573 ATCTTGCCCAGGCTGGAGTGCGG + Intergenic
922328897 1:224556549-224556571 ATCTTTCCATGGATGGGGCAGGG + Intronic
923534198 1:234836230-234836252 ATCTTGCCAGGAATACAGCTGGG - Intergenic
1064144939 10:12819839-12819861 AGCGTGGCAGGGATGGAGTGGGG + Intronic
1065789437 10:29246771-29246793 ATGTTGCCCAGGCTGGAGCGTGG + Intergenic
1067684694 10:48459282-48459304 ATCTTGCCATTGATAGAGCCTGG + Intronic
1069593716 10:69657092-69657114 ATCTTTCCAGGGATGGCCCTCGG + Intergenic
1072651464 10:97299100-97299122 ATCTTGTTAGGGATGGGGTGAGG + Intergenic
1073223080 10:101892420-101892442 ATATTGCCCAGGCTGGAGCGTGG - Intronic
1073405433 10:103293171-103293193 AAGTTGCCAGGGCTGGAGAGAGG + Intergenic
1074703887 10:116114885-116114907 ATCTTCACAGGGATGCAGTGAGG - Intronic
1075813520 10:125246431-125246453 CTCTTGCAAGGGGAGGAGCGGGG - Intergenic
1076355643 10:129850870-129850892 AACTTGCCAGTGATGGTGCAGGG - Intronic
1076431433 10:130405896-130405918 ATGTTGCCAGGGATAAAGAGGGG + Intergenic
1077364262 11:2155202-2155224 CCCTTGCCAGGGATGGAGACCGG - Intronic
1077463901 11:2724419-2724441 AGCTTGCCAGGGAGGGTTCGAGG - Intronic
1079452995 11:20613582-20613604 ATCTAGGCAGGGATGGAGAAAGG - Intronic
1080093050 11:28372300-28372322 TTCTTCCCAGGGATGCAACGAGG - Intergenic
1082004489 11:47412150-47412172 AGCTTGCCTGGGAGGGAGGGAGG + Intronic
1084870819 11:72097601-72097623 CTCTGGCCAGGGATGGGGTGGGG - Exonic
1085716494 11:78878166-78878188 ATGTTGCAAGGCATGGAGAGGGG - Intronic
1087904720 11:103682319-103682341 AGCCTGCCAGGGATGGAGGAGGG - Intergenic
1088374386 11:109124035-109124057 AGCTTGGCAGGGAGGGAGCCAGG - Intergenic
1089609268 11:119660433-119660455 AGCTTGCAGGGGATGGGGCGGGG + Intronic
1090244414 11:125205557-125205579 CTCTTGCTAGGGGTGGAGCTAGG + Intronic
1090778978 11:129990053-129990075 AACTGGCCAGGCATGGGGCGTGG + Intronic
1091221416 11:133931840-133931862 ACCCAGCCTGGGATGGAGCGCGG - Intronic
1091755327 12:3047612-3047634 ATTTTTCCACGGATGGAGCGGGG - Intergenic
1094093622 12:26678235-26678257 ATATTGTCAGGGATGGAGGAGGG - Intronic
1094187373 12:27659363-27659385 ATCCTGCCAGGCATGGTGGGAGG + Intronic
1096261767 12:50097186-50097208 ATCTTGTCAGGGATACAGAGTGG + Intronic
1099715051 12:86281355-86281377 ATATTGAGAGGGATGGAGAGAGG - Intronic
1100256462 12:92887609-92887631 CTATTGCCTGGGCTGGAGCGTGG - Intronic
1101115533 12:101528022-101528044 ATCTTGCCACGGGTGGAGACAGG - Intergenic
1103588623 12:121974474-121974496 AGCTTGCCAGGGGTAGAGCCGGG + Intronic
1104101656 12:125618270-125618292 AACTTGCCATGCATGGAGTGGGG + Intronic
1104188530 12:126455839-126455861 ATCTTTCCAGGGTTGGTGAGGGG + Intergenic
1104822721 12:131687500-131687522 CCCCTGCCAGGGATGGAGGGTGG - Intergenic
1105070534 12:133231835-133231857 AGCCTGCTAGGAATGGAGCGGGG - Intronic
1106601161 13:31188232-31188254 ATCATGCCAGAGATGGATCCAGG + Intergenic
1113990457 14:16023993-16024015 ACCTTGGAAGGGATGGAGGGAGG - Intergenic
1119403140 14:74378054-74378076 ATCTTGCAAGGGACGGTGTGGGG + Intergenic
1120977080 14:90258127-90258149 AGCTTGTCAGAGATGGAGCCAGG - Intronic
1121220961 14:92285090-92285112 CTCTTGACAGGGTTGGAGGGGGG + Intergenic
1121825816 14:97008590-97008612 ATCCGGCCAGTGATGGAGCCAGG + Intergenic
1123111408 14:105868756-105868778 ATCTTCCCTGGCATGGAGCTTGG + Intergenic
1124356153 15:28996350-28996372 ATCTTGCCAGGGATGGAGCGTGG + Intronic
1127682592 15:61312052-61312074 ATCATGACAGGGAAGGAGCAAGG + Intergenic
1128539739 15:68518304-68518326 ATTTTACCAGGGATGGTGCCTGG - Intergenic
1129790243 15:78336335-78336357 ATATTACCAGGGATGCAGGGAGG - Intergenic
1130014008 15:80173655-80173677 GTGTTGCCAGTGATGGAGTGGGG - Intronic
1130730627 15:86488422-86488444 ATCTAGCCATGGATTGAGCCAGG + Intronic
1131371010 15:91881900-91881922 ACCTGGCCAGGGATGGAGCAGGG - Intronic
1133056111 16:3146153-3146175 TTCCTGCCAGTGATGGAGAGAGG - Intronic
1134661303 16:15986594-15986616 GTTTTGCCAGGGATGGCGGGGGG - Intronic
1137451391 16:48577855-48577877 ACCTTGCAAGGGATGGTGTGGGG + Intronic
1138224175 16:55278324-55278346 ATCTTGGCTGGGATGGGGTGAGG - Intergenic
1138731300 16:59198009-59198031 ATTTTTCCACGGATGGGGCGGGG + Intergenic
1143530110 17:7497809-7497831 ATGTTGGCAGCAATGGAGCGGGG - Exonic
1145397237 17:22505826-22505848 ACCTAGCCAGGGAGGGAGCAGGG + Intergenic
1145909604 17:28534859-28534881 TTCTTGCCAGGAATGGGGCCTGG - Exonic
1146195034 17:30804494-30804516 TGCTTGCCAGGGATGGAGTTGGG - Intronic
1147176544 17:38659374-38659396 ATCTTGCCAGGGATGTGGGAAGG - Intergenic
1147526774 17:41232481-41232503 ATGGTGTCAGGGATGGAGGGTGG - Exonic
1147529826 17:41265357-41265379 ATGTTGTCAGGGGTGGAGGGTGG - Exonic
1148351006 17:46942326-46942348 AGATTGGCAGGGATGGAGCCAGG - Intronic
1151573724 17:74940720-74940742 ATTTTTCCATGGATGGAGGGTGG - Intronic
1153423915 18:4941854-4941876 AACTTGGCAGAGATGGAGCCAGG - Intergenic
1154345701 18:13542037-13542059 CTGTTGCCAGGGCTGGAGTGCGG - Intronic
1155498477 18:26464982-26465004 ATCTTGTCGGGGATGGAGGTTGG + Intronic
1156374119 18:36497592-36497614 ATATTGACAGGGATGAAGAGAGG + Intronic
1157160739 18:45312073-45312095 AGCTTGTAAGGGATGGAGCAAGG - Intronic
1163440548 19:17320532-17320554 ATGGTGCCAAGGATGGAGCGGGG + Exonic
1163633293 19:18427653-18427675 ATCTGGGCAGGGAGGGAGTGGGG - Intronic
1164714267 19:30379998-30380020 AGCTGGCCAGTGATGGAGCAGGG + Intronic
1165578599 19:36842966-36842988 CTGTTGCCAGGGCTGGAGTGTGG - Intronic
1165941945 19:39418983-39419005 ACCTTGGCAGGGATGGAGGCAGG - Exonic
1166177590 19:41085989-41086011 ATCTGGCCAGGGAGGGGGTGGGG - Intergenic
1166864535 19:45827916-45827938 ATCCTGCCAGAGATGGAGGGAGG + Exonic
1167357116 19:49010896-49010918 ATGATGCCAGGGATGGAGGAAGG - Intronic
1167468683 19:49663602-49663624 AACTTGCCAGGGAAAGAGGGTGG - Intronic
1168634928 19:57988769-57988791 ATATTTCCAGGGATGGAGTGAGG + Intronic
925749309 2:7073170-7073192 ACCTTCCCAGGGATGGAGACAGG - Intergenic
925808837 2:7678467-7678489 ATCTTGCTAGGGAGTGAACGTGG + Intergenic
931833143 2:66072970-66072992 ATCTCGCTGGGGATGGAGAGTGG - Intergenic
932063813 2:68532103-68532125 AACTGGGCAGGGATGGAGGGTGG - Intronic
932871755 2:75407732-75407754 ATCTTGCCTGTCATGGAGAGAGG + Intergenic
933380645 2:81539427-81539449 ATTTTCCCAGGGATGGTGGGTGG + Intergenic
936093075 2:109513115-109513137 ATTGTGCCAGGGAAGGAGCTGGG - Intergenic
936661434 2:114548030-114548052 AGCCTTCCAGGGATGGAGTGGGG + Intronic
937004782 2:118501408-118501430 GTCATGCCTGGGATGGAGCCAGG + Intergenic
938079180 2:128360193-128360215 GTCTGGCCAGGGTTGGAGAGAGG - Intergenic
940033482 2:149289092-149289114 TTCTTGCCAGGGGTGGGGTGGGG + Intergenic
942171999 2:173298162-173298184 ACCTTGCAAGGGATGGTGTGGGG - Intergenic
942459874 2:176161317-176161339 ACCTTGCCAGGCTTGGAGGGTGG + Intronic
944593561 2:201240316-201240338 CTCCTGTCAGGGATGGAACGAGG + Intronic
946158286 2:217821076-217821098 TTCTGGCTAGGGATGCAGCGAGG - Intronic
1170545768 20:17434647-17434669 ATTTTGCCAGGGCTGGTGCATGG - Intronic
1171905080 20:30893805-30893827 ACCTTGGAAGGGATGGAGGGAGG - Intergenic
1172122106 20:32604493-32604515 TTCTTGCCAGGGCAGGAGAGGGG - Intronic
1172455305 20:35067194-35067216 ATCATTACAGGGCTGGAGCGGGG + Intronic
1174084067 20:47992762-47992784 TTTTGGCCAGGGATGGAGTGAGG - Intergenic
1174296357 20:49548027-49548049 AAGTTGCCAGGGATAGAGTGAGG + Intronic
1174391557 20:50221143-50221165 AGCCTGTCAGGGATGGAGCGGGG - Intergenic
1177832101 21:26150334-26150356 GTCTCTCCAGGGATGGAGAGGGG + Intronic
1178702485 21:34845311-34845333 TCCTTGCCAGGGATGGAGACAGG + Intronic
1180316814 22:11283533-11283555 ACCTTGGAAGGGATGGAGGGAGG + Intergenic
1180338507 22:11599985-11600007 ACCTTGGAAGGGATGGAGGGAGG - Intergenic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
951848729 3:27114325-27114347 ATCTCTCCAGGGATGGTGGGAGG + Intronic
954547823 3:51454077-51454099 CTCTTGTCAGGGCTGGAGTGCGG + Intronic
954892628 3:53944927-53944949 ATCTAGCCTGGGATGGAGAAGGG + Intergenic
960262834 3:115588022-115588044 ACCTTGCTGGGGATGGAGGGGGG + Intergenic
962407280 3:135110959-135110981 ATCTTCCCAGGGAAGCAGGGTGG + Intronic
963012304 3:140782082-140782104 GTCTTGCCAGAGAAGGAGAGAGG - Intergenic
967034245 3:185636250-185636272 CTCTTGCCTGTGCTGGAGCGTGG + Intergenic
968442036 4:629054-629076 ATGTTGGGAGGGATGGAGGGGGG - Intronic
970887590 4:21004447-21004469 ATCTTGACAGCGATGGTGCAGGG - Intronic
972316165 4:37927873-37927895 ATGTTGCCCAGGATGGAGTGCGG - Intronic
973141879 4:46779809-46779831 TGGTTGCCAGGGATGGAGTGGGG + Intronic
974033060 4:56793502-56793524 TTCATGCCAGAGATGGAGCTAGG - Intergenic
979305102 4:119133546-119133568 GTCTTGCCCGGGCTGGAGTGCGG + Intergenic
982858860 4:160422109-160422131 TGCTTACCAGGGATGGAGAGTGG + Intergenic
982994079 4:162318033-162318055 ACCCTGCCAGGGGTGGAGCAAGG - Intergenic
983680704 4:170350334-170350356 ATATTCCCAGGGGTGGGGCGAGG + Intergenic
984385269 4:179047845-179047867 ATTTTTCCAGGGATGGTGGGTGG + Intergenic
984404237 4:179306693-179306715 ATCTAGCCAGGGGTGGAGTTGGG - Intergenic
986306191 5:6518810-6518832 ATAGTGCCAGGGAAGCAGCGGGG - Intergenic
987260250 5:16195643-16195665 TTGTTGCCTGGGATGGAGTGCGG + Intergenic
988390047 5:30616172-30616194 ATTTTTCCACGGATGGAGGGGGG - Intergenic
988576471 5:32430034-32430056 ATGTTGCCTGGGATGTAGCCTGG + Intronic
991324505 5:65415870-65415892 ACCTTGCAAGGGATGGTGTGGGG - Intronic
994501317 5:100581687-100581709 GTCATGCCAGGGAGGGAGTGGGG + Intronic
995732906 5:115264979-115265001 ACCTTGCAAGGGATGGTGTGGGG + Intergenic
996597534 5:125222693-125222715 ACCTTGCCAGGGATGGGAGGTGG - Intergenic
997453669 5:134002927-134002949 CTGTTGCCAGGTCTGGAGCGCGG - Intronic
998442759 5:142175869-142175891 ATGCTGCCAGGGATGGAGAAAGG - Intergenic
999338084 5:150741515-150741537 CTATTGCCTAGGATGGAGCGTGG + Intronic
1001686159 5:173596503-173596525 ATCTTGTGAGGGAAGGAGCCTGG + Intergenic
1007288159 6:40763011-40763033 ATCTTTCCTGGGATGGGGCCTGG - Intergenic
1007982769 6:46176047-46176069 TTCTTGGCAGGGAAGGGGCGGGG + Intergenic
1011480352 6:87787612-87787634 TTCCTTCCAGGGATGGAGAGAGG - Intergenic
1015772499 6:136783599-136783621 ATCTTGCCCCAGGTGGAGCGGGG + Intronic
1015973861 6:138769625-138769647 ATCTTTCCATGGATGGGGCGGGG + Intronic
1016663007 6:146602884-146602906 ATTTTTCCATGGATGGAGAGGGG - Intronic
1016783227 6:147983281-147983303 ATCTTACTAGAGATGGAGTGTGG + Intergenic
1016923303 6:149317324-149317346 GTCTTGCTAGGGCTGGAGGGAGG - Intronic
1018127622 6:160696699-160696721 CTCCAGCCAGGGAAGGAGCGTGG + Intergenic
1018206528 6:161441844-161441866 AGCAGGCCAGGGATGGAGGGAGG - Intronic
1023203701 7:37725332-37725354 GTGAAGCCAGGGATGGAGCGGGG + Intronic
1032430668 7:131858757-131858779 AGCTTGCCAGGGAGGGAGTATGG - Intergenic
1032488385 7:132305535-132305557 ACCGTGCCAGGGATGGAGATAGG - Intronic
1034200417 7:149280327-149280349 ATCCTGCCAGGCATGGGGCCTGG + Intronic
1034244972 7:149637057-149637079 GTCTTGCCAGGGAAGGTGCCCGG - Intergenic
1034430733 7:151040066-151040088 ATCTGGCCAAGGAGGGAGCCAGG + Intronic
1040847365 8:51857953-51857975 CTCTTGCCTAGGCTGGAGCGTGG - Intronic
1040872072 8:52109965-52109987 TTGTTGCCCGGGATGGAGTGTGG - Intergenic
1048616013 8:136076479-136076501 CTCTTGCAAGGGGTGGAGTGTGG - Intergenic
1049160524 8:141094999-141095021 TTCTTGCCCGGGCTGGAGTGCGG + Intergenic
1049438475 8:142598512-142598534 ATCCTGTCAGGGCTGGAGTGGGG + Intergenic
1050536243 9:6633319-6633341 AATTTCCCAGGGATGGAGTGTGG - Intronic
1054762013 9:69012583-69012605 ATCCTGCCTGGGAAGGAGAGAGG - Exonic
1054854634 9:69885291-69885313 ATATTGCCAGGAATGGAGGTGGG + Intronic
1061096163 9:128457624-128457646 ATCTGGGGAGGGAAGGAGCGAGG - Intronic
1062009939 9:134261503-134261525 ATTTTGCCAGGGATGGAAAGAGG - Intergenic
1203365120 Un_KI270442v1:249468-249490 ACCTTGGAAGGGATGGAGGGAGG + Intergenic
1203376310 Un_KI270442v1:380903-380925 ATCCTGCCCGGGTTGGAGCCGGG - Intergenic
1185648778 X:1633674-1633696 CTCTTGCCCGGGCTGGAGTGTGG + Intronic
1190286846 X:48967068-48967090 ATCTTGCCAGCAATGGTGCTGGG + Exonic
1194721140 X:97341305-97341327 ATGTTGCCAAGGCTGGAGTGTGG - Intronic
1197826125 X:130592110-130592132 CTATTGCTAGGGATGGAGTGGGG - Intergenic
1198176962 X:134166075-134166097 CCCAGGCCAGGGATGGAGCGTGG - Intergenic
1199494025 X:148433103-148433125 ATCTGGCCAGAGATGGAGAGTGG - Intergenic
1200137036 X:153880173-153880195 AGCTTGCCAGGGAGGGACCTGGG + Intronic