ID: 1124356857

View in Genome Browser
Species Human (GRCh38)
Location 15:29002059-29002081
Sequence GCTGTGTGTACTGCCCGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 91}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124356848_1124356857 30 Left 1124356848 15:29002006-29002028 CCCAGCGGATGTTCTTGAATATA 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1124356857 15:29002059-29002081 GCTGTGTGTACTGCCCGTCTTGG 0: 1
1: 0
2: 0
3: 7
4: 91
1124356855_1124356857 1 Left 1124356855 15:29002035-29002057 CCCGGTCACATTAGGTTGGGAAG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1124356857 15:29002059-29002081 GCTGTGTGTACTGCCCGTCTTGG 0: 1
1: 0
2: 0
3: 7
4: 91
1124356856_1124356857 0 Left 1124356856 15:29002036-29002058 CCGGTCACATTAGGTTGGGAAGT 0: 1
1: 0
2: 1
3: 6
4: 112
Right 1124356857 15:29002059-29002081 GCTGTGTGTACTGCCCGTCTTGG 0: 1
1: 0
2: 0
3: 7
4: 91
1124356849_1124356857 29 Left 1124356849 15:29002007-29002029 CCAGCGGATGTTCTTGAATATAA 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1124356857 15:29002059-29002081 GCTGTGTGTACTGCCCGTCTTGG 0: 1
1: 0
2: 0
3: 7
4: 91
1124356854_1124356857 2 Left 1124356854 15:29002034-29002056 CCCCGGTCACATTAGGTTGGGAA 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1124356857 15:29002059-29002081 GCTGTGTGTACTGCCCGTCTTGG 0: 1
1: 0
2: 0
3: 7
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124356857 Original CRISPR GCTGTGTGTACTGCCCGTCT TGG Intronic
903558473 1:24210467-24210489 GCTGTGTGTACATCTCCTCTGGG - Intergenic
905124962 1:35709739-35709761 GCTGTGTGCCCTGCCCGTGTTGG + Intergenic
908473815 1:64470126-64470148 GCTCTGTGCACTTCCCGGCTGGG - Intergenic
910713126 1:90202488-90202510 GCTGTGGATTCTGCCAGTCTTGG - Intergenic
920750265 1:208667821-208667843 GCTGTGGGCTCTGCTCGTCTTGG - Intergenic
1070130645 10:73653299-73653321 GCCGTGTGAGCTCCCCGTCTTGG - Exonic
1071427491 10:85573594-85573616 GCTGTGTGTTCTTCCAGTGTTGG - Intergenic
1073315702 10:102579262-102579284 GCTGTGTGCCCTGCCCATGTGGG + Intronic
1076350764 10:129813707-129813729 GCTGTGTGTTCTGCAGGTCTTGG + Intergenic
1077078134 11:710374-710396 GCTGTGGGTCCTGCCCGTCGGGG + Intronic
1081760851 11:45575586-45575608 GCTGGCTGTGCTGCCCGGCTCGG - Intergenic
1083273518 11:61584154-61584176 GCCTTGTGAACTGCCCGCCTCGG - Intergenic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1088916026 11:114228592-114228614 GCACTGTGCACTGCCCCTCTAGG - Intronic
1089788115 11:120922562-120922584 GATGTGCGTACTGCCTGGCTTGG + Intronic
1090661061 11:128881817-128881839 GCTGTGTTTACTGCCCCCATAGG - Intergenic
1093679913 12:21990414-21990436 ACTTTGTGTTCTGCCCGCCTCGG - Intergenic
1096522001 12:52189706-52189728 GCTGTGGGTACTGGCCGTTTGGG - Intronic
1101467022 12:104958761-104958783 GCGGTGGTTCCTGCCCGTCTCGG - Intergenic
1105007453 12:132730074-132730096 GCTGTGTGGACCTCCCGGCTCGG + Exonic
1113672294 13:112183358-112183380 GGTGTGGGTACTGCCGGTGTGGG - Intergenic
1114107205 14:19438311-19438333 GCTGCCTGTACTGCTCGTCATGG + Intergenic
1116443782 14:44985243-44985265 ACTTTGTGAACCGCCCGTCTCGG + Intronic
1121244192 14:92450635-92450657 GCTGTGTGTGGGGACCGTCTCGG - Intronic
1123105583 14:105839715-105839737 GCTGTGTGTACAGCCCCTCGTGG + Intergenic
1123151907 14:106190059-106190081 CCTGTTTGTTCTGCCCCTCTAGG + Intergenic
1202905857 14_GL000194v1_random:72184-72206 GCTGTGTGGACTGCCTGACTTGG - Intergenic
1123400293 15:19977878-19977900 CCTGTTTGTTCTGCCCCTCTAGG + Intergenic
1124356857 15:29002059-29002081 GCTGTGTGTACTGCCCGTCTTGG + Intronic
1126590952 15:50339067-50339089 CCTGAGTGATCTGCCCGTCTTGG - Intronic
1127921604 15:63498905-63498927 ACTTTGTGATCTGCCCGTCTCGG + Intergenic
1127942514 15:63713963-63713985 GATGTGGGTACTGCTGGTCTGGG - Intronic
1128377518 15:67088147-67088169 GCTGTGTGTAATTCTGGTCTGGG + Intronic
1132117475 15:99147982-99148004 GCTGTGTGTATTGGCCTGCTTGG + Intronic
1133346758 16:5076238-5076260 GCTGCGTGTACTTCCGGCCTTGG + Intronic
1138051795 16:53786317-53786339 GCTGTGTGTGCTGCCCATGGTGG + Intronic
1139245576 16:65439155-65439177 TCTGTATGTACTGCACTTCTGGG + Intergenic
1139631033 16:68232026-68232048 GCTGCGGGGACTGCCCTTCTCGG - Exonic
1141668250 16:85477387-85477409 CCTGTGTGTGCTGCCCACCTAGG + Intergenic
1142294248 16:89209932-89209954 GCTGTGTGTTCTGCCAATATTGG + Intergenic
1143824479 17:9593322-9593344 GATGTGTGTGCTGCTGGTCTGGG - Intronic
1143877506 17:10003266-10003288 GCTTTCTTTACTGCCCCTCTGGG - Intronic
1145910494 17:28539345-28539367 GCTGTGTGCACTGCTGGTCCTGG + Intronic
1146894053 17:36528273-36528295 ACTTTGTGTCCTGCCCGCCTTGG - Intronic
1151617560 17:75224276-75224298 ACTTTGTGATCTGCCCGTCTTGG + Intronic
1153799484 18:8656940-8656962 GTTCTGTGTAGTGCCTGTCTGGG - Intergenic
1154227366 18:12518241-12518263 GCTCAGTGGTCTGCCCGTCTTGG + Intronic
1160846325 19:1167753-1167775 GCGCTGTGTACTGCAGGTCTGGG - Intronic
1162736752 19:12751223-12751245 ACAGTGTGTACTGCTCCTCTGGG + Intergenic
1163759035 19:19123826-19123848 ACTTTGTGATCTGCCCGTCTTGG - Intronic
1163977171 19:20863218-20863240 GCTCTGTGTCCTGCCGGTATTGG - Intronic
1167465973 19:49651352-49651374 GCTGTGTGGGCTGCGCGTCCGGG - Exonic
932282517 2:70506348-70506370 GCTGAATGTACTGCCCTTGTAGG - Intronic
934500743 2:94858328-94858350 GCTGTGCGGACTGCCTGACTTGG + Intergenic
937350786 2:121159596-121159618 GCTCTGTGGACTGCCCAGCTGGG - Intergenic
948567102 2:238894233-238894255 GCTGAGTGAACTGCCCTTCAGGG + Intronic
948587413 2:239028023-239028045 GCTGTGTGTAGGGCGCGCCTTGG - Intergenic
1171891963 20:30725033-30725055 GCTGTGCGGACTGCCTGACTTGG + Intergenic
1175363041 20:58429759-58429781 GCTCTGTGTAGTACCCCTCTTGG - Intronic
1175932822 20:62501196-62501218 TCTGTGTGTACTGCTAGTGTGGG + Intergenic
1176056024 20:63149696-63149718 GCTGTGTGCACTGCAGGCCTGGG - Intergenic
1176625216 21:9086941-9086963 GCTGTGCGGACTGCCTGACTTGG - Intergenic
1177883724 21:26723653-26723675 GCTGTGTCTACTGCACCTATTGG - Intergenic
1179963008 21:44781439-44781461 GCTGTGTGTGCAGCCCACCTTGG - Intronic
1184080251 22:42214258-42214280 GCTGGTTGTACTGCCCCACTTGG + Exonic
950293742 3:11809649-11809671 GCTGAGTGAACTGTCCTTCTGGG + Exonic
951609586 3:24477530-24477552 GATGTGTATACTGCTGGTCTGGG + Intronic
953810503 3:46108590-46108612 GCTGTAACTACTGCCCGTCATGG + Intergenic
955708020 3:61748634-61748656 GCTTAGTGTACTGCACTTCTTGG + Intronic
960489543 3:118297579-118297601 TCTGTGTGTAGTGACTGTCTTGG - Intergenic
972533042 4:39977524-39977546 GCTTTGTGTGCAGCCCGACTAGG - Exonic
974821918 4:67077862-67077884 GCTGGGTGTACTTCTGGTCTAGG + Intergenic
979542640 4:121903452-121903474 GCTGTGTCTACAGCCTGGCTTGG - Intronic
990626630 5:57620363-57620385 CCTCTGTGAACTGCCCGTCTTGG - Intergenic
993610408 5:90046594-90046616 GCTAGGTGATCTGCCCGTCTTGG - Intergenic
994408337 5:99374491-99374513 GCTTTGTGTACTGCACTGCTGGG + Intergenic
1014149940 6:118043041-118043063 GCTGTGTGTACTGTGCGGTTAGG + Intronic
1021076018 7:16305632-16305654 ACTTTGTGATCTGCCCGTCTTGG - Intronic
1022659707 7:32355361-32355383 GGAGTGTGCACTGCCCCTCTTGG - Intergenic
1024272166 7:47650812-47650834 GCTCTGTGTACAGCTCGGCTTGG - Intergenic
1026486510 7:70826185-70826207 GCTGTGTGTTCTGTGCGTTTGGG - Intergenic
1036604913 8:10296157-10296179 GTTGTGTGTACTACTGGTCTGGG - Intronic
1037778223 8:21849505-21849527 GCTGTGTGGGCTGCCTCTCTCGG + Intergenic
1046684467 8:117209478-117209500 CCTGTGTGTACTGACCTTCGGGG + Intergenic
1049895925 9:112106-112128 CCTGTGTGTACTTCTCCTCTGGG - Intergenic
1053656438 9:40222221-40222243 GCTGTGCGGACTGCCTGACTTGG - Intergenic
1053906787 9:42851439-42851461 GCTGTGCGGACTGCCTGACTTGG - Intergenic
1054356849 9:64070662-64070684 GCTGTGCGGACTGCCTGACTTGG - Intergenic
1054528179 9:66154064-66154086 GCTGTGCGGACTGCCTGACTTGG + Intergenic
1054676168 9:67858195-67858217 GCTGTGCGGACTGCCTGACTTGG - Intergenic
1059442296 9:114315258-114315280 ACTGTGGGTACTGCCAGTTTAGG - Intergenic
1060962852 9:127693428-127693450 GGTGTGTGTCCTGCTTGTCTTGG + Intronic
1061561669 9:131408131-131408153 GCTGTGTTCTCTGCCTGTCTGGG + Intronic
1203748390 Un_GL000218v1:57401-57423 GCTGTGCGGACTGCCTGACTTGG - Intergenic
1203561337 Un_KI270744v1:60620-60642 GCTGTGCGGACTGCCTGACTTGG + Intergenic
1185710440 X:2299366-2299388 GCTGTGTCTGATGCCCCTCTCGG + Intronic
1199543780 X:148986020-148986042 TCTGTATGTGCTGCCCGTCAGGG + Intronic
1201161737 Y:11172371-11172393 GCTGTGCGGACTGCCTGACTTGG - Intergenic
1202046633 Y:20742272-20742294 ACTTTGTGATCTGCCCGTCTTGG - Intergenic