ID: 1124357445

View in Genome Browser
Species Human (GRCh38)
Location 15:29006488-29006510
Sequence CTGTATTAGCAGCATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5846
Summary {0: 5, 1: 410, 2: 665, 3: 2345, 4: 2421}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124357445_1124357448 7 Left 1124357445 15:29006488-29006510 CCATTCTCATGCTGCTAATACAG 0: 5
1: 410
2: 665
3: 2345
4: 2421
Right 1124357448 15:29006518-29006540 CGAGACTGGGTAATTTACAAAGG 0: 25
1: 892
2: 4721
3: 4876
4: 2876
1124357445_1124357447 -6 Left 1124357445 15:29006488-29006510 CCATTCTCATGCTGCTAATACAG 0: 5
1: 410
2: 665
3: 2345
4: 2421
Right 1124357447 15:29006505-29006527 ATACAGACATACTCGAGACTGGG 0: 1
1: 136
2: 1802
3: 7641
4: 9760
1124357445_1124357450 22 Left 1124357445 15:29006488-29006510 CCATTCTCATGCTGCTAATACAG 0: 5
1: 410
2: 665
3: 2345
4: 2421
Right 1124357450 15:29006533-29006555 TACAAAGGAAAGAGGTTTAATGG 0: 114
1: 1644
2: 2232
3: 1635
4: 1417
1124357445_1124357446 -7 Left 1124357445 15:29006488-29006510 CCATTCTCATGCTGCTAATACAG 0: 5
1: 410
2: 665
3: 2345
4: 2421
Right 1124357446 15:29006504-29006526 AATACAGACATACTCGAGACTGG 0: 1
1: 56
2: 781
3: 4105
4: 7900
1124357445_1124357449 14 Left 1124357445 15:29006488-29006510 CCATTCTCATGCTGCTAATACAG 0: 5
1: 410
2: 665
3: 2345
4: 2421
Right 1124357449 15:29006525-29006547 GGGTAATTTACAAAGGAAAGAGG 0: 204
1: 4206
2: 10355
3: 10235
4: 6742

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124357445 Original CRISPR CTGTATTAGCAGCATGAGAA TGG (reversed) Intronic
Too many off-targets to display for this crispr