ID: 1124358231

View in Genome Browser
Species Human (GRCh38)
Location 15:29014843-29014865
Sequence GCCTGGTGCCATGTACCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 0, 2: 10, 3: 80, 4: 392}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124358231 Original CRISPR GCCTGGTGCCATGTACCTGT AGG (reversed) Intronic
901283057 1:8054647-8054669 GCTTGGTACACTGTACCTGTGGG + Intergenic
901316508 1:8313639-8313661 GCGTGGTGGCGTGCACCTGTAGG - Intergenic
901479904 1:9518098-9518120 GCATGGTGCCATGCACCTGTAGG + Intergenic
901644304 1:10708521-10708543 GCCTGGTGCCTTCTTCCTATCGG + Intronic
901693861 1:10991968-10991990 GCATGGTGGCATGTAACTGTAGG + Intergenic
901906136 1:12413343-12413365 GCGTGGTGGTATGTACCTGTAGG + Intronic
902424048 1:16305247-16305269 GCGTGGTGGCATGCACCTGTGGG + Intronic
902775144 1:18669943-18669965 GCGTGGTGGCACGTGCCTGTAGG + Intronic
903121258 1:21218294-21218316 GCCCTGTGCCATGGACCTGCCGG + Intronic
903372131 1:22843145-22843167 GGATGGTGCCATGTACTTGCAGG - Intronic
904335386 1:29793975-29793997 GCATGGGGCCAGGTACCTGCCGG + Intergenic
905114039 1:35621855-35621877 GTATGGTGGCATGTGCCTGTAGG + Intronic
905185032 1:36190139-36190161 GCATGGTGGCATATGCCTGTAGG - Intergenic
905759186 1:40539357-40539379 GTGTGGTGGCATGTGCCTGTAGG + Intronic
906491440 1:46271775-46271797 GCCTGGGGCCATGTAGCAGCGGG + Intronic
907064008 1:51461380-51461402 GCATGGTGGCATCCACCTGTAGG + Intronic
907122074 1:52016794-52016816 GCATGGTGGCTGGTACCTGTGGG + Intergenic
907260959 1:53218353-53218375 GCCTGGTGCCAGGAAGCTGTGGG + Intronic
908705423 1:66948758-66948780 GCATGGTGGCATGCACCTGTAGG + Intronic
909687273 1:78364341-78364363 GCGTGGTGGCACGCACCTGTAGG - Intronic
909896735 1:81080658-81080680 GTGTGGTGGCATGTGCCTGTAGG - Intergenic
910584670 1:88866226-88866248 GCGTGGTGGCATGTGCCTGTAGG + Intronic
910952698 1:92667752-92667774 GCGTGGTGGCATGTGCCTGTAGG - Intronic
911373268 1:97019919-97019941 GCATTTTTCCATGTACCTGTTGG - Intergenic
911406590 1:97448083-97448105 GCATGGTGGCATGCACCTGTAGG + Intronic
914761298 1:150600757-150600779 GCATGGTGGCACGTGCCTGTAGG + Intergenic
915449098 1:155992413-155992435 GCATGGTGGCAGGCACCTGTAGG - Intronic
916208133 1:162335267-162335289 GCCTGGAGCCATGCAGCTGAGGG + Intronic
917823288 1:178789043-178789065 GCGTGGTGGCATGCACCTGGAGG - Intronic
919204768 1:194407646-194407668 GCGTGGTGGCATGTACAGGTGGG + Intergenic
919810118 1:201404040-201404062 GCCTGGTGGAATGTCCCTGGAGG - Intronic
919912380 1:202119423-202119445 GCATGGTGGCATGTGCCTGTGGG + Intergenic
920052911 1:203174339-203174361 GCCTGGTTCCCTCTACCTGCTGG + Intronic
920778460 1:208964560-208964582 GCGTGGTGGCACGTGCCTGTTGG - Intergenic
921034988 1:211368408-211368430 GACTGGTGCCTGGTACCAGTAGG - Intronic
921457799 1:215393340-215393362 GCCTTTTTTCATGTACCTGTTGG - Intergenic
922426691 1:225503412-225503434 GCATGGTTGCATGTGCCTGTGGG - Intronic
922880293 1:228975510-228975532 GCTTGGAGCCATGTACATGTCGG - Intergenic
922953078 1:229575567-229575589 GCATGGTGGCATGCACCTATAGG - Intergenic
923478790 1:234363219-234363241 GCATGGTGGCGTGTGCCTGTAGG + Intergenic
923669578 1:236029036-236029058 GTGTGGTGGCATGTGCCTGTAGG + Intronic
924138156 1:240992874-240992896 GCATGGTGGCGTGCACCTGTAGG + Intronic
1062888470 10:1037599-1037621 GCCTGCTACCATGAAGCTGTTGG - Intergenic
1063895040 10:10671026-10671048 GCACGGTGGCATGTACCTGCAGG + Intergenic
1064316190 10:14259854-14259876 AGCTGGAGCCATGTAGCTGTGGG - Intronic
1065958663 10:30715577-30715599 GCATGGTGGCATGCACCTGCAGG + Intergenic
1066114396 10:32226797-32226819 GCATGGTGCCAAGTGCCTGCAGG - Intergenic
1066301588 10:34101993-34102015 GCCAGGTGCCATGTATATGCTGG - Intergenic
1066419284 10:35249069-35249091 GAGTGGTGGCATGCACCTGTTGG - Intronic
1066536489 10:36397723-36397745 GCATGGTGGCACGTGCCTGTAGG - Intergenic
1067053206 10:43037077-43037099 GCCTGAAGCCATGTACCTCCTGG + Intergenic
1069262812 10:66420260-66420282 GCATTTTTCCATGTACCTGTTGG - Intronic
1069382310 10:67853423-67853445 GCCTGGTGGCATGCATCTGTAGG + Intergenic
1069439622 10:68416325-68416347 GCATGGTGGAATGCACCTGTGGG + Intronic
1069691938 10:70359413-70359435 GTGTGGTGGCATGCACCTGTGGG + Intronic
1069948409 10:72002824-72002846 GGCTGGTGCCTGGTAGCTGTTGG - Intronic
1070629492 10:78074858-78074880 GCGTGGTGGCATGCACCTGTAGG - Intergenic
1070752089 10:78969929-78969951 GCCTGCTGCCCTGTACCTCAGGG - Intergenic
1071504315 10:86223444-86223466 GCTGGGGGCCATGTGCCTGTGGG - Intronic
1071851159 10:89571895-89571917 GCATGGTGGTATGCACCTGTAGG + Intergenic
1072454437 10:95563479-95563501 GCATGGTGGCGTGCACCTGTGGG + Intergenic
1072575967 10:96700680-96700702 TCCTGGTGCCTTGTGCCTGTGGG - Intronic
1073305283 10:102498601-102498623 GCTTGGTGGCATGCACCTGTAGG - Intronic
1073370218 10:102981527-102981549 GTGTGGTGGCATGCACCTGTGGG - Intronic
1073601511 10:104850444-104850466 GCATGGCGGCATGTGCCTGTAGG + Intronic
1073608337 10:104918479-104918501 GCTTGGTGCCATGTCCTTGATGG + Intronic
1074804117 10:117030025-117030047 GCGTGATGGCATGCACCTGTAGG - Intronic
1075109507 10:119566741-119566763 GCATGGTGGCATGCCCCTGTGGG - Intergenic
1076046773 10:127300509-127300531 GCCTGATGCCATCTTCCTGAAGG - Intronic
1076064065 10:127434789-127434811 GCATGGTGGCATGTGCCTGTAGG - Intronic
1077229302 11:1451441-1451463 GCCTGGTGTCAGGTACCAGGAGG - Intronic
1077270781 11:1678671-1678693 GCCTGCTGCAATGGAGCTGTAGG - Intergenic
1079695865 11:23481979-23482001 GCATGGTGGCATGCACCTGTAGG + Intergenic
1080399504 11:31921036-31921058 GCATGGTGGCATATGCCTGTAGG - Intronic
1081755798 11:45543426-45543448 GCCTGCTTCCTTGCACCTGTTGG - Intergenic
1082766604 11:57173574-57173596 GCATGGTGGCATGCACCTGTGGG - Intergenic
1084913161 11:72407783-72407805 GCGTGGTGGCAGGCACCTGTAGG - Intronic
1085059627 11:73433048-73433070 GCGTGGTGGCACGCACCTGTAGG - Intronic
1085423725 11:76384801-76384823 CCCTGGTGCCAAGTGCTTGTGGG - Intronic
1085586885 11:77717037-77717059 GCATGGTGGCTTGTGCCTGTAGG + Intronic
1086903573 11:92394331-92394353 GGGTGGTGGCATGCACCTGTAGG + Intronic
1088750873 11:112841305-112841327 GCCTGATGCCACCTACCTTTTGG - Intergenic
1089474707 11:118749577-118749599 GCGTGGTGCCACATGCCTGTGGG - Exonic
1090014326 11:123072409-123072431 GCATGGTGCCAGGCACCTGTAGG - Exonic
1090099855 11:123782812-123782834 GCCTGGTCTCCTGTACCTGAGGG - Intergenic
1090956175 11:131514725-131514747 GCGTGGTAGCATGGACCTGTAGG - Intronic
1091313751 11:134596238-134596260 GCATGGTGGCATGTGACTGTAGG - Intergenic
1091570061 12:1677318-1677340 GCATGGTGGCATGTACCCGTAGG - Intergenic
1092138220 12:6164412-6164434 GCATGGTGGCATGCGCCTGTAGG + Intergenic
1092504771 12:9086266-9086288 GCATGGTGGCATACACCTGTGGG + Intronic
1093399838 12:18732288-18732310 GCCTGGTGGTGTGTGCCTGTGGG - Intronic
1094335452 12:29345805-29345827 GCATGGTGGTATGCACCTGTGGG + Intronic
1096354149 12:50925898-50925920 GCATGGTGGCAGGTGCCTGTAGG + Intronic
1096378380 12:51133786-51133808 GCATGGTGGCAGGTGCCTGTAGG + Intronic
1096707208 12:53429838-53429860 CTCTGGTGCCATGTACCTCTGGG - Exonic
1097648440 12:62264121-62264143 GCGTGGTGGCATGTGCCTGCAGG - Intronic
1097939027 12:65283568-65283590 GCATGGTGGCAGGTGCCTGTAGG - Intronic
1098256158 12:68617900-68617922 GCATGGTGGCATGCGCCTGTAGG - Intronic
1098407780 12:70144241-70144263 GCATGGTGGCATGCACCTATAGG - Intergenic
1099187843 12:79535143-79535165 CCGTGGTGGCATGTGCCTGTAGG + Intergenic
1101784250 12:107868784-107868806 GCATTTTTCCATGTACCTGTCGG + Intergenic
1104693332 12:130843194-130843216 GCATGGTGGCATGTGCCTGTAGG + Intergenic
1105773301 13:23633249-23633271 CCATGCTGGCATGTACCTGTGGG - Intronic
1105916295 13:24919900-24919922 GCATGGTGACACATACCTGTAGG - Intronic
1106449592 13:29868076-29868098 GCGTGGTGGCATGCACCTGCAGG + Intergenic
1106547206 13:30741242-30741264 GCGTGGTGGCAGGCACCTGTAGG - Intronic
1108073457 13:46653690-46653712 GCGTGGTGGCGTGCACCTGTAGG + Intronic
1108102441 13:46970917-46970939 GTGTGGTGGCATGCACCTGTAGG + Intergenic
1108355770 13:49627724-49627746 GCGTGGTGGCACCTACCTGTAGG - Intergenic
1108420078 13:50239913-50239935 GCGTGGTGGCACGTGCCTGTAGG - Intronic
1109104099 13:58227560-58227582 GCCAGATGCCATGTATTTGTTGG + Intergenic
1109988994 13:70028836-70028858 GCTTGGTGGCACATACCTGTAGG + Intronic
1112453773 13:99538651-99538673 GCATGGTGGCATGTGCCTGTAGG + Intronic
1113143553 13:107182411-107182433 GCGTGGTGGCATTCACCTGTAGG - Intronic
1113832332 13:113305996-113306018 ACCTGGTGCCCTGTCCCTTTCGG - Intronic
1116386485 14:44337012-44337034 GCATTTTTCCATGTACCTGTTGG - Intergenic
1116443242 14:44978850-44978872 GCATGGTGGCATATACCTATAGG + Intronic
1116821428 14:49631484-49631506 GCGTGGTGGCAGGTGCCTGTAGG + Intronic
1116924688 14:50622253-50622275 GCACGGTGGCATGTGCCTGTAGG + Intronic
1117144444 14:52822886-52822908 GCATGGTGACAGGTGCCTGTAGG + Intergenic
1118015602 14:61657300-61657322 GGGTGGTGGCATTTACCTGTAGG - Intronic
1118292011 14:64535609-64535631 GCCTGCTGCCATGTAACTGGTGG + Intergenic
1119374532 14:74178946-74178968 GCATGATGGCATGCACCTGTAGG + Intronic
1119634197 14:76260889-76260911 GCCTGGTGGCATGCACCTGTAGG + Intergenic
1120782440 14:88497638-88497660 GCGTGGTAGCAGGTACCTGTAGG + Intronic
1121610362 14:95274519-95274541 GCCAGGTGCCAGGAACCTGATGG - Intronic
1121780030 14:96616371-96616393 ACCTGGTGCTGTCTACCTGTAGG + Intergenic
1122596507 14:102896932-102896954 TGGTGGTGGCATGTACCTGTAGG + Intronic
1122919521 14:104874295-104874317 GCCAGGAGCCACGTAGCTGTGGG + Intronic
1202841410 14_GL000009v2_random:124754-124776 GCTTGGTTCTATGTCCCTGTGGG - Intergenic
1202910798 14_GL000194v1_random:114985-115007 GCTTGGTTCTATGTCCCTGTGGG - Intergenic
1123807842 15:23893609-23893631 GCATGGTGGCATGCACCTGTAGG - Intergenic
1124358231 15:29014843-29014865 GCCTGGTGCCATGTACCTGTAGG - Intronic
1124701402 15:31916109-31916131 GCATGTTGTCATGTGCCTGTAGG + Intergenic
1125558487 15:40606896-40606918 GCATGGTGGCATGTTCCTGTAGG - Intronic
1125568603 15:40696432-40696454 GCATGGTGGCGTGCACCTGTAGG + Intronic
1125955748 15:43790001-43790023 GCGTGGTGGCACGCACCTGTAGG + Intronic
1126584181 15:50266775-50266797 GCATGGTGGCACATACCTGTAGG - Intergenic
1127660838 15:61098477-61098499 GCATGATGGCATGTGCCTGTAGG - Intronic
1128424538 15:67527062-67527084 GCCTTGTGCCATTTACCTGGAGG + Exonic
1129050072 15:72773978-72774000 GCATGGTGGCATGTGCCTGTGGG - Intronic
1129338442 15:74868679-74868701 GTGTGGTGGCATGCACCTGTGGG - Intronic
1129644031 15:77413960-77413982 GTGTGGTGGCATGTGCCTGTGGG - Intronic
1129976656 15:79828071-79828093 GAGTGGTGGCATGTGCCTGTAGG + Intergenic
1132525848 16:414274-414296 GTGTGGTGGCATGCACCTGTAGG - Intergenic
1132679951 16:1135691-1135713 GCATGGTGGCCTGCACCTGTGGG - Intergenic
1132820755 16:1868714-1868736 GCTTGGTGGCAGGCACCTGTAGG + Intronic
1133280414 16:4661943-4661965 GCCGTGTGCCAGGTGCCTGTGGG + Intronic
1133971202 16:10569455-10569477 GTATGGTGGCATGCACCTGTAGG - Intronic
1134323456 16:13185338-13185360 GCATGGTGTCATGTCCCTGTAGG - Intronic
1135073709 16:19375083-19375105 GCATGGTAGCATGCACCTGTAGG - Intergenic
1135661958 16:24304697-24304719 GCATGGTGGCGTGTACCTGTAGG - Intronic
1137623832 16:49895092-49895114 GCATGGTGGCATGTGCCTATAGG + Intergenic
1138059282 16:53872749-53872771 GCCTGGTGGCATTTGCCTCTTGG + Intronic
1138725597 16:59135315-59135337 GCATGGTGGCATGCACCTGTAGG + Intergenic
1139525452 16:67513019-67513041 GAGTGGTGACATGCACCTGTTGG + Intergenic
1139913352 16:70412503-70412525 GCGTGGTGGCATGTTTCTGTAGG + Intronic
1140306483 16:73807593-73807615 GCATGGTGGAATGTGCCTGTAGG - Intergenic
1140408280 16:74725357-74725379 GGCAGGTGGCATGTACCTGGAGG + Intronic
1142543556 17:681273-681295 GTGTGGTGGCATGCACCTGTAGG - Intronic
1142774813 17:2128683-2128705 GCGTGGTGGCGTGCACCTGTAGG + Intronic
1143224971 17:5293543-5293565 GCATGGTGGCATGTGCCTATAGG - Intronic
1143813599 17:9492957-9492979 GCCTGGTGGCAGACACCTGTAGG + Intronic
1146121518 17:30200035-30200057 GCATCGTACCATGCACCTGTAGG - Intronic
1146230815 17:31107401-31107423 GCATGGTGGCATGCACCTGTGGG - Intronic
1146719167 17:35111240-35111262 GCCTGGTGGCATGTGCCTGTAGG + Intronic
1146851336 17:36224426-36224448 GCGTGGTGGCAGGTGCCTGTAGG - Intronic
1146867249 17:36348299-36348321 GCGTGGTGGCAGGTGCCTGTAGG - Intronic
1147070124 17:37948910-37948932 GCGTGGTGGCAGGTGCCTGTAGG - Intergenic
1147081645 17:38028436-38028458 GCGTGGTGGCAGGTGCCTGTAGG - Intronic
1147097596 17:38152406-38152428 GCGTGGTGGCAGGTGCCTGTAGG - Intergenic
1147145586 17:38482651-38482673 GCCTGGTGACATCAACCTGCAGG + Exonic
1148512728 17:48186605-48186627 GCATGGTGGCATGTGCCTGTAGG - Intronic
1148789110 17:50163264-50163286 GCATGGTGGCACGTGCCTGTAGG + Intergenic
1149077347 17:52611747-52611769 GGCTTTTGCCATCTACCTGTAGG + Intergenic
1149763200 17:59251870-59251892 GCATGGTGGTATGCACCTGTGGG + Intronic
1150578236 17:66449148-66449170 GTGTGGTGGCATGTGCCTGTAGG + Intronic
1150881019 17:69028303-69028325 GCATGGTGGCAGGTGCCTGTAGG - Intronic
1151609083 17:75159617-75159639 GTGTGGTGGCATGTGCCTGTAGG - Intronic
1152415887 17:80161610-80161632 GCATGGTGGCATGTGCTTGTGGG - Intergenic
1152422654 17:80202460-80202482 GCTGGGTGCCATTTCCCTGTGGG - Intronic
1152483968 17:80577414-80577436 GTGTGGTGGCATGCACCTGTAGG - Intronic
1152725649 17:81944269-81944291 GCATGGTGGCACGCACCTGTAGG + Intronic
1153029764 18:702599-702621 GCATGGTGGCTTGTGCCTGTGGG + Intronic
1153034256 18:744526-744548 GCGTGGTGGCATGCACCTGTAGG - Intronic
1153719595 18:7888315-7888337 GCCCTGTTCCATGTACGTGTTGG - Exonic
1154248657 18:12723528-12723550 GCATGGTGGCATGTGCCTGTAGG - Intronic
1155864019 18:30942061-30942083 GCCTGGTGCCAGGTTCCACTTGG + Intergenic
1156213190 18:34969493-34969515 GTATGGTGGCATGCACCTGTAGG - Intergenic
1156284191 18:35674842-35674864 GCGTGGTGGCAGGCACCTGTAGG + Intronic
1156328586 18:36097872-36097894 GCATGGTGGCATGTGCCTGTGGG - Intergenic
1157222873 18:45839851-45839873 GCCTAGTGCTATGGACCTGGGGG - Intronic
1157401732 18:47394261-47394283 GCCTGGTGCTATGCATATGTTGG - Intergenic
1159446717 18:68549905-68549927 GCGTGGTGGCAGGCACCTGTAGG - Intergenic
1159506983 18:69351432-69351454 GTGTGCTGGCATGTACCTGTGGG + Intergenic
1159736102 18:72099770-72099792 GCATGGTGGCATGTGTCTGTAGG + Intergenic
1159747446 18:72255302-72255324 GCATGGTGGCATGTACCTTATGG + Intergenic
1159998994 18:74998057-74998079 GCCTGGTGCCAGCTGCCAGTGGG + Intronic
1161569264 19:5021454-5021476 GTGTGGTGGCATGTACCTGTGGG + Intronic
1162358233 19:10200692-10200714 GCCTGGTGGTGTGTGCCTGTGGG - Intronic
1162516700 19:11152587-11152609 GTTTGGAGCTATGTACCTGTGGG - Intronic
1162611954 19:11762737-11762759 CCATGGTGGCATGTCCCTGTAGG + Intergenic
1163447762 19:17357523-17357545 GCATGGTGGAGTGTACCTGTAGG + Intronic
1163555720 19:17991592-17991614 GCATGGTGGCACGTGCCTGTAGG + Intronic
1163751844 19:19082783-19082805 GCTTGGTGGCACATACCTGTAGG - Intronic
1164458133 19:28426218-28426240 GCATAGTGGCATGCACCTGTAGG + Intergenic
1164905755 19:31966645-31966667 GAGTGGGGCCATGTACCTGCCGG - Intergenic
1164998098 19:32738179-32738201 GCCTGGTGGCAGCTTCCTGTTGG + Intronic
1165620019 19:37237999-37238021 GCGTGGTGACGTGTGCCTGTGGG - Intronic
1166141933 19:40809890-40809912 GCCGCGTGCCAGGCACCTGTTGG + Intronic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1167140298 19:47645957-47645979 GCGTGGTGGCATGCGCCTGTAGG + Intronic
1167260367 19:48454581-48454603 GCATGGAGGCACGTACCTGTTGG - Exonic
1168025857 19:53643185-53643207 GCATGGTGGCATGTACCTGTTGG - Intergenic
1168221189 19:54961685-54961707 GCATGGTGGCAGGTGCCTGTAGG + Intronic
1168300299 19:55401227-55401249 GCATGGTGCCATGTGGCTCTGGG - Exonic
925342069 2:3144836-3144858 GCCTGGCTCCATGTTCCTGCAGG - Intergenic
925948662 2:8890656-8890678 GTGTGGTAGCATGTACCTGTAGG - Intronic
926240633 2:11082120-11082142 GCGTGGTGGCATGTGCCTGTAGG - Intergenic
926714809 2:15915773-15915795 GCATGGTAACATGTGCCTGTAGG + Intergenic
927274278 2:21248723-21248745 GCATGGTGGCATGCACCTGTAGG - Intergenic
927585951 2:24305455-24305477 GCGTGGTGGCGTGTGCCTGTAGG + Intronic
928050358 2:27987674-27987696 GCATGGTGACATGTTCCTGTAGG + Intronic
928513954 2:32027765-32027787 GCGTGGTGGCAGGTGCCTGTAGG - Intronic
928652353 2:33416645-33416667 TCATGGTGGCGTGTACCTGTAGG - Intergenic
928688403 2:33773869-33773891 GCATGGTAGCATGTCCCTGTAGG - Intergenic
928988426 2:37204414-37204436 GCGTGGTGGCATGCACTTGTAGG - Exonic
929747422 2:44673286-44673308 GTATGGTGGCATGTACCTGTGGG + Intronic
930131976 2:47861455-47861477 GCATGGTGGTATGCACCTGTGGG - Intronic
930807461 2:55505422-55505444 GCCTGGTGGCATGTGCCTGTAGG - Intergenic
931423720 2:62151768-62151790 GCCTGGTGGCACGTGCCTGCGGG - Intergenic
932884172 2:75533002-75533024 GTATGGTGGCATGCACCTGTGGG + Intronic
933251435 2:80033432-80033454 GCTTGGTGGCATGCACCTGTAGG + Intronic
933755137 2:85632584-85632606 GCATGGTGGCACGCACCTGTAGG - Intronic
933756922 2:85647025-85647047 GCCTGGTGGCAGGTGCCTGTAGG - Intronic
934948940 2:98563210-98563232 GCCTGGTCTCCTGAACCTGTTGG - Intronic
935171818 2:100616081-100616103 GCATGGGGCCATGTCCCTGGTGG + Intergenic
935982116 2:108637989-108638011 GCACGGTGGCATGCACCTGTAGG - Intronic
936108071 2:109642608-109642630 GCATGGTGACGTGCACCTGTAGG + Intergenic
936248798 2:110851748-110851770 GCCTGAGGCCATGTTCCTGAAGG + Intronic
936501021 2:113066415-113066437 GCATGGTGGCATGCACCTGTAGG - Intergenic
936560986 2:113539723-113539745 GCGTGGTGGCATGTACCTGTAGG + Intergenic
937333865 2:121048581-121048603 GCATGGTGCTATGCGCCTGTGGG + Intergenic
937696899 2:124818382-124818404 GCATGGTGACATGTGACTGTAGG + Intronic
938014201 2:127853815-127853837 GCCTTGTGGTATGTAACTGTGGG - Intronic
940139325 2:150475861-150475883 GGCTGGTGCCTTGAACCTTTAGG - Intronic
942005125 2:171690791-171690813 GCATAGTGACATGTGCCTGTAGG - Intronic
944124006 2:196273204-196273226 GCATGGTGGCACGCACCTGTAGG - Intronic
945794893 2:214350327-214350349 GCCCGGAGACATGTCCCTGTGGG - Intronic
946652463 2:221908311-221908333 GCTTGGTGCTAAGTACCTCTTGG + Intergenic
946709934 2:222495273-222495295 GTGTGGTGGCATGTGCCTGTGGG + Intronic
946846724 2:223865709-223865731 GCATGGTGGCATGTGCCTATAGG + Intronic
947001377 2:225460852-225460874 GCATGGTGGCAGGCACCTGTAGG + Intronic
947153580 2:227138177-227138199 GTGTAGTGGCATGTACCTGTAGG + Intronic
947221615 2:227798706-227798728 GCGTGGTGGCATGTGCCTGTTGG - Intergenic
1169192683 20:3668113-3668135 GCGTGGTGGTGTGTACCTGTAGG - Exonic
1170467422 20:16635583-16635605 GCATGGTGGCATGTGCCTGTAGG - Intergenic
1171098302 20:22354695-22354717 GACTGGATCCATGTACCAGTAGG + Intergenic
1172135919 20:32686628-32686650 GCGTGGTGGCAGGCACCTGTAGG - Intergenic
1172255250 20:33512036-33512058 GCGTGGTGGCATGCGCCTGTAGG + Intronic
1172470786 20:35193312-35193334 GCGTGGTGGCATGCGCCTGTAGG - Intergenic
1174151999 20:48492549-48492571 GCCGGGTGCTGTGTGCCTGTGGG - Intergenic
1174347602 20:49942118-49942140 GTGTGGTGGTATGTACCTGTAGG + Intronic
1174486059 20:50861990-50862012 GCATGGTGGCATGTGCCTGTGGG - Intronic
1174555871 20:51394945-51394967 GCATGGTGCCATGCACGAGTGGG - Intronic
1174602855 20:51738941-51738963 GCGTGGTGGCAGGTGCCTGTAGG + Intronic
1174609554 20:51787958-51787980 GCGTGGTGGCATGCGCCTGTAGG - Intronic
1175585323 20:60134538-60134560 GCATGGTGGCATATGCCTGTAGG - Intergenic
1176597309 21:8759117-8759139 GCTTGGTTCTATGTCCCTGTGGG + Intergenic
1176630151 21:9129682-9129704 GCTTGGTTCTATGTCCCTGTAGG - Intergenic
1177536962 21:22440565-22440587 GTGTGGTGCCATGTACCTATAGG + Intergenic
1178578014 21:33812635-33812657 GCATGGTGGCATGCACCTGTAGG - Intronic
1178824262 21:36002322-36002344 GCATGGTGGCATGCACCTGTGGG + Intronic
1179711144 21:43263922-43263944 ACCAGATGCCGTGTACCTGTGGG - Intergenic
1180421139 22:12815717-12815739 GCTTGGTTCTATGTCCCTGTGGG - Intergenic
1180665322 22:17506263-17506285 GCGTGGTGGCATGTGCCTGCAGG - Intronic
1180795358 22:18601451-18601473 GCATGGTGGCATGCACCTGCAGG + Intergenic
1181226382 22:21393861-21393883 GCATGGTGGCATGCACCTGCAGG - Intergenic
1181252268 22:21540977-21540999 GCATGGTGGCATGCACCTGCAGG + Intergenic
1181293948 22:21819885-21819907 GCTTGGTGGCTTGTGCCTGTAGG - Intronic
1182209102 22:28659405-28659427 ACGTGGTGGCATGAACCTGTAGG - Intronic
1182445214 22:30386054-30386076 GCCTGGTCCGATTTACCTCTCGG + Exonic
1182593832 22:31402646-31402668 GCATGGTGGCATATGCCTGTAGG - Intronic
1182786551 22:32912580-32912602 GGGTGGTGGCATGCACCTGTAGG + Intronic
1183166354 22:36149943-36149965 GCGTGGTGGTATGTACCTGTAGG - Intronic
1184025910 22:41856263-41856285 GCATGGTGGCACGCACCTGTAGG - Intronic
1184772021 22:46602879-46602901 GCGTGGTGGCATGTGCCTGTAGG - Intronic
1184807573 22:46805423-46805445 GCCTGGAGGCAGGTAGCTGTTGG + Intronic
950964134 3:17134401-17134423 GCCTGGTGCCATGGACCCTCAGG + Intergenic
951349308 3:21586065-21586087 GCATGGTGGCACGCACCTGTAGG + Intronic
951804011 3:26625189-26625211 TCCTGCTGCCTTGTACCAGTTGG + Intronic
952259382 3:31724977-31724999 TCCTGGTGCCGTGTGGCTGTGGG - Intronic
953860760 3:46542355-46542377 GTGTGGTGGCATGCACCTGTTGG + Intronic
953957799 3:47244986-47245008 GCCTTGGGCCATATACATGTGGG - Intronic
954349298 3:50029592-50029614 GCGTGGTGGCGTGTACCTGTAGG + Intronic
955938717 3:64127897-64127919 GCCTGCTGCCCTCTTCCTGTAGG - Intronic
956236595 3:67079183-67079205 GCGTGGTGGCATACACCTGTGGG - Intergenic
956420049 3:69078610-69078632 GTATGGTGGCATGTACCTGTAGG - Intronic
957550463 3:81697436-81697458 GCATGGTGGCAGGTGCCTGTAGG - Intronic
959061806 3:101623056-101623078 GCATGGTGGCATGCACCTGTAGG - Intergenic
960635183 3:119777918-119777940 GCATGGTGACATGTGCCTGTAGG + Intergenic
962113724 3:132478629-132478651 ACGTGGTGGCATGTACCTGGTGG + Intronic
962578598 3:136777008-136777030 GTGTGGTGGCATGTACCTGTAGG + Intergenic
963256014 3:143145580-143145602 GCATGGTGGCATGTGCCTGGAGG + Intergenic
963890484 3:150631072-150631094 GCATGGTAGCATGCACCTGTAGG + Intergenic
965579250 3:170249651-170249673 GCATGGTGGCATGAGCCTGTGGG + Intronic
965846504 3:172968427-172968449 GCCTATTGGCATGTACATGTTGG + Intronic
966721905 3:183072005-183072027 GCATGGTGGCACGTGCCTGTGGG - Intronic
967009278 3:185416758-185416780 GCATGGTGGCATGTGCCTGTAGG - Intronic
967300587 3:188008646-188008668 GTGTGGTGGCATGTGCCTGTAGG - Intergenic
968555145 4:1243151-1243173 GGCTGGTGCCATGCTGCTGTGGG - Intronic
968838826 4:2985430-2985452 GCATGGTGGCACATACCTGTAGG + Intronic
970910500 4:21269542-21269564 GCATGGTGGCATGCACCTGTAGG - Intronic
972489565 4:39574377-39574399 GCATGGTGGCATGCACCTGTAGG - Intronic
972655049 4:41056053-41056075 GCATGGTGGCAGGTGCCTGTGGG + Intronic
973360601 4:49161336-49161358 GCTTGGTTCTATGTCCCTGTGGG + Intergenic
973923670 4:55715215-55715237 GCATGGTGGTGTGTACCTGTGGG + Intergenic
975653491 4:76618163-76618185 GCGTGGTGGCATGTGCCTATAGG + Intronic
975969854 4:80020245-80020267 GCATGGTGGCATGTGCCTATAGG + Intronic
976139564 4:81976905-81976927 GCCTGGTGCTAGGTCTCTGTAGG + Intronic
977724857 4:100284306-100284328 GCCATGTGCCATGTAACAGTTGG + Intergenic
977891183 4:102313726-102313748 ACATGGTGGCATGCACCTGTAGG - Intronic
978290519 4:107133378-107133400 GCATTTTCCCATGTACCTGTTGG - Intronic
979535547 4:121816092-121816114 GCGTGGTGGCATGTGCTTGTAGG - Intronic
979564326 4:122137076-122137098 GCATGGTCGCATGCACCTGTAGG + Intergenic
982697610 4:158621167-158621189 GCATGGTAGCATGCACCTGTAGG + Intronic
983177840 4:164612139-164612161 GCATGGTGGCACATACCTGTAGG - Intergenic
983497230 4:168457075-168457097 GCATGGTGGCATATGCCTGTGGG + Intronic
984187541 4:176564421-176564443 GCATGGTGGCATGCACCTGTAGG - Intergenic
985104590 4:186488095-186488117 GCCTTGTACCATGTCCCCGTGGG - Intronic
985483580 5:135525-135547 GCATGGTGGCAGGTACCTGTAGG + Intergenic
985508306 5:297691-297713 GCCTGGTGTCATTTTCTTGTGGG - Intronic
985739735 5:1607979-1608001 GCCTGGTGTCATTTTCTTGTGGG + Intergenic
986769542 5:10959531-10959553 GCATGTTTTCATGTACCTGTTGG - Intergenic
988429496 5:31102672-31102694 GCATGGTGGCATACACCTGTAGG + Intergenic
988641195 5:33042008-33042030 GCCTAGAGCCATGTAGCTCTGGG + Intergenic
988643979 5:33073465-33073487 GTGTGGTGGCATGTACCTTTAGG - Intergenic
988803260 5:34716549-34716571 GCATGGTGGCACGCACCTGTAGG - Intronic
990253243 5:53938685-53938707 GTGTGGTGCCATGTGCCTCTAGG + Intronic
990372133 5:55130981-55131003 GCATGGTGATATGTGCCTGTGGG + Intronic
990439890 5:55833804-55833826 GCGTGGTGGCAGGTGCCTGTAGG + Intergenic
990580990 5:57167510-57167532 GTGTGGTGGCATGTGCCTGTAGG + Intergenic
991928420 5:71727926-71727948 GACTGGTTCCAGATACCTGTTGG - Intergenic
992115921 5:73538542-73538564 GCATGGTGGCATGTGCCTGTAGG + Intergenic
992569870 5:78044188-78044210 CCTTGGTGCCATGTGCATGTCGG - Intronic
993925838 5:93865218-93865240 GCATGGTGGCAGGCACCTGTAGG - Intronic
994098507 5:95869317-95869339 GCATGGTGGCATGCACCTGTAGG + Intergenic
995560300 5:113374041-113374063 GCGTGGTGGCATGCGCCTGTGGG - Intronic
996812420 5:127532245-127532267 GCATGGTGGCGTGCACCTGTAGG - Intronic
997305980 5:132836695-132836717 GCATGGTGGCATGTGCCTGCAGG - Intergenic
997961934 5:138329041-138329063 GCATGGTGGCACGTGCCTGTAGG - Intronic
998148701 5:139745122-139745144 GCCTTGTGACATGCCCCTGTGGG - Intergenic
998362350 5:141599999-141600021 GCATGGTGCTATATGCCTGTAGG - Intronic
999456292 5:151719158-151719180 GCGTGGTGACATGTGCCTGTAGG - Intergenic
999473295 5:151875309-151875331 GCATGGTGGCATGCACCTGTAGG - Intronic
1001142841 5:169159635-169159657 GCGTGGTGGCAGGCACCTGTAGG + Intronic
1001146050 5:169185707-169185729 GACTGGAGCCCTGTACCTCTAGG - Intronic
1001838709 5:174854704-174854726 GCATGGTGACAGGCACCTGTAGG - Intergenic
1002484723 5:179526867-179526889 GCATGGTGGCACATACCTGTTGG - Intergenic
1002519511 5:179783457-179783479 GCCTGGGGCCACTTACATGTGGG + Intronic
1003257487 6:4487211-4487233 TCCTGGTGCCACACACCTGTGGG + Intergenic
1003529551 6:6926577-6926599 GCCTTCTTCCACGTACCTGTTGG - Intergenic
1003532268 6:6947602-6947624 GCATGGTGGCATGCACTTGTGGG - Intergenic
1004223992 6:13769833-13769855 GCCTGGGGCCACGAAGCTGTTGG + Intergenic
1004345229 6:14843213-14843235 GCATGGTGGCATGTACCTTGTGG + Intergenic
1005067272 6:21830677-21830699 GCATGGTGGTATGCACCTGTGGG - Intergenic
1005793009 6:29326673-29326695 GCCTGGTGCTGAGTTCCTGTGGG - Intergenic
1006346798 6:33488844-33488866 GCGTGGTGGCACGCACCTGTAGG + Intergenic
1006607661 6:35270273-35270295 GCATGGTGGCACGTGCCTGTAGG - Intronic
1006742141 6:36316625-36316647 ACCTAGTGCCATGTCCATGTAGG - Exonic
1007237250 6:40399574-40399596 GCTTGGTGGCGTGCACCTGTAGG - Intronic
1007568359 6:42870782-42870804 GCATGGTGGCATATGCCTGTAGG + Intergenic
1007647957 6:43397294-43397316 GCATGGTGGCAGGTGCCTGTAGG + Intergenic
1007833238 6:44654805-44654827 CCCTGGTGGCATGCACCTGTGGG + Intergenic
1008947686 6:57116824-57116846 GCATGGTTGCATGTACCTATAGG + Intronic
1008948893 6:57132579-57132601 GCATGGTGGCATGTGCCTATAGG + Intronic
1013165044 6:107582246-107582268 TCTTGGTGCCATGTGCATGTTGG - Intronic
1013717861 6:112985187-112985209 GCCTGGTTCCATGTTGATGTGGG - Intergenic
1013845557 6:114446122-114446144 GCCTGTTGCCATGTCACTGAGGG - Intergenic
1014447141 6:121541647-121541669 GCATGGTGACATGTGCTTGTAGG + Intergenic
1014741978 6:125156325-125156347 GTGTGGTGGCATGTGCCTGTAGG + Intronic
1014920265 6:127206226-127206248 GCATGGTGGCAGGCACCTGTAGG + Intergenic
1015764829 6:136705439-136705461 TTGTGGTGGCATGTACCTGTAGG - Intronic
1015972722 6:138759018-138759040 GCATGGTGGGGTGTACCTGTAGG + Intronic
1016615512 6:146043154-146043176 GCATGGTGGCGTGCACCTGTAGG + Intronic
1017404176 6:154099144-154099166 GCGCGGTGGCATGCACCTGTAGG + Intronic
1017673767 6:156793472-156793494 GCATGGTGGCATGTGCCTGTAGG - Intronic
1018007904 6:159640563-159640585 GCCAGGTGCCAGGTGCCTTTTGG + Intergenic
1018281663 6:162192589-162192611 GCGTGGTAGCATGTGCCTGTAGG - Intronic
1019832794 7:3349736-3349758 GCGTGGTGGCAGGTGCCTGTAGG - Intronic
1019915954 7:4132586-4132608 GCATGATGGCATGCACCTGTTGG + Intronic
1020036966 7:4969770-4969792 GAGTGGTGGCATGTGCCTGTAGG + Intergenic
1020163318 7:5788909-5788931 GAGTGGTGGCATGTGCCTGTAGG - Intergenic
1020171629 7:5849559-5849581 GCGTGGTGGCACGTGCCTGTAGG + Intergenic
1020802922 7:12754571-12754593 ACCTGGTTCCATATACCTGGAGG + Intergenic
1021454057 7:20810471-20810493 GCATGGTGGAATGTGCCTGTAGG - Intergenic
1021972532 7:25980030-25980052 GCCTGGAGGCAGGGACCTGTGGG + Intergenic
1023290237 7:38660507-38660529 TCATGGTGGCATGTGCCTGTGGG - Intergenic
1023384153 7:39638580-39638602 GCCTGGTGGCATGTGCCTTCTGG - Intronic
1023438040 7:40158609-40158631 GCGTGGTGGCATGTGCCTGTAGG + Intronic
1024502775 7:50130669-50130691 GCCTGCTACCCTGTACATGTGGG - Intronic
1026223403 7:68419927-68419949 GCCTGGTGTCAGGTAATTGTTGG - Intergenic
1029108137 7:98194992-98195014 CCATGGTGGCATGAACCTGTGGG - Intronic
1029176806 7:98670357-98670379 GCGTGGTGCCGTGCCCCTGTGGG + Intergenic
1029564533 7:101327135-101327157 GCATGGTGGCATGTACCTGTGGG - Intergenic
1030011520 7:105173241-105173263 GCATGGTGGCATGTACTTCTTGG - Intronic
1031442161 7:121807954-121807976 GCCTGGTGCCATGTTTCTCTTGG + Intergenic
1032773484 7:135085105-135085127 GCATTGTTCCATATACCTGTTGG + Intronic
1032829162 7:135605161-135605183 GCGTGGTGGCATGCACCTGTAGG - Intronic
1034238973 7:149595195-149595217 CCCTGCTGCCACTTACCTGTGGG - Intergenic
1034484311 7:151348712-151348734 GCATGGTGGCGTGTGCCTGTAGG - Intronic
1035031317 7:155862998-155863020 GCCTGGTGTCATGCACATGTCGG - Intergenic
1036141259 8:6211021-6211043 GCATGTTTTCATGTACCTGTTGG + Intergenic
1036191332 8:6673262-6673284 GCATGTTTTCATGTACCTGTTGG - Intergenic
1036769195 8:11567024-11567046 GCCTGGCTCCAAGTACCTGGGGG + Intergenic
1037506322 8:19533253-19533275 GTGTGGTGGTATGTACCTGTAGG - Intronic
1037624817 8:20597517-20597539 GCCTGGTGGCACATGCCTGTAGG - Intergenic
1038264353 8:26026198-26026220 GCCTGGGGCCAGGTTTCTGTGGG + Intronic
1038455277 8:27668725-27668747 GCATGGTGGCATGCGCCTGTTGG + Intronic
1040532323 8:48276009-48276031 GCCTGGTGCCCTGTGCATCTGGG + Intergenic
1040543822 8:48381605-48381627 GCTTGGTGGCATGTGCCTGTAGG - Intergenic
1040729608 8:50427562-50427584 GCATGGTGGTATGCACCTGTAGG - Intronic
1042126099 8:65538433-65538455 GCATGGTGGCATGAGCCTGTAGG + Intergenic
1042182625 8:66106883-66106905 GCATGGTGCCATGTACAATTTGG + Intergenic
1042277822 8:67024451-67024473 GCATGGTGGCATGAGCCTGTAGG - Intronic
1042327918 8:67547631-67547653 GCATGGTGGCATTCACCTGTGGG - Intronic
1042603758 8:70525782-70525804 GCATGGTGGCATGTGCCTGTAGG - Intergenic
1042848114 8:73188333-73188355 GCATGGTGGCATGTGCCTATAGG + Intergenic
1043840136 8:85093211-85093233 GCATGGTGGCATGCACCTGTAGG + Intergenic
1044761411 8:95521326-95521348 GCATGGTGGCATGTGCCTGTAGG - Intergenic
1044832682 8:96265632-96265654 GCGTGGTGGCATGCACCTGGAGG + Intronic
1044887814 8:96798266-96798288 GTGTGGTGGCATGCACCTGTGGG - Intronic
1045358168 8:101407651-101407673 CTCTTGTGCCAGGTACCTGTGGG + Intergenic
1045565147 8:103307028-103307050 GCTTGCTTCCATGTACCAGTGGG + Intronic
1045960565 8:107963383-107963405 GCATGGTGGTATGTGCCTGTTGG + Intronic
1046147321 8:110177936-110177958 GCTTGGAGGCATGTGCCTGTTGG - Intergenic
1046625807 8:116575855-116575877 GCATGGTGTCATGTGCCTGTAGG - Intergenic
1046764259 8:118052857-118052879 TCCTGGAGCCATGTACCTTGGGG - Intronic
1047051155 8:121115014-121115036 GTGTGGTGGCATGCACCTGTAGG - Intergenic
1047539890 8:125754512-125754534 CCATGGTGGCATGTGCCTGTGGG + Intergenic
1047898658 8:129396180-129396202 GCCTGTAGCCATGTAACTGCTGG - Intergenic
1048784519 8:138036286-138036308 GCCTGGTTCTATGTACATGCTGG - Intergenic
1048821922 8:138387989-138388011 GCCTCTTTTCATGTACCTGTTGG - Intronic
1049035492 8:140072391-140072413 GTGTGGTGGCATGTGCCTGTAGG + Intronic
1049107063 8:140620728-140620750 GCATGGTGGCATGCATCTGTGGG + Intronic
1049728730 8:144164541-144164563 GCATAGTGGCATGCACCTGTAGG - Intronic
1049891694 9:75603-75625 GCGTGGTGGCATGTACCTGTAGG - Intergenic
1050231250 9:3527273-3527295 GCCTGGGGGCATGTGCCTGCTGG - Intergenic
1053733121 9:41076694-41076716 GCGTGGTGGCATGTACCTGTAGG - Intergenic
1054458725 9:65450468-65450490 GGCTGGAGCCAGGTACCTGAGGG + Intergenic
1054695302 9:68354869-68354891 GCGTGGTGGCATGTACCTGTAGG + Intronic
1055739331 9:79368681-79368703 GCATGGTGGCATGCACCTCTAGG + Intergenic
1055985612 9:82055082-82055104 GCGTGGTGGCAGGCACCTGTAGG + Intergenic
1057253289 9:93521441-93521463 ACATGGTGGCATGTGCCTGTGGG + Intronic
1057666513 9:97050058-97050080 GCATAGTGGCATGTGCCTGTAGG + Intergenic
1059095003 9:111403219-111403241 GCATGGTGGCTTGTGCCTGTAGG + Intronic
1059122314 9:111652377-111652399 GCGTGGTGGCATGCTCCTGTAGG + Intronic
1059228742 9:112697443-112697465 GCTTGGTGGCATGTGCCTGTAGG + Intronic
1061378313 9:130239210-130239232 GCGTGGTGGCAGGTGCCTGTGGG + Intergenic
1062031270 9:134363141-134363163 GCCATGTGCCCTGTGCCTGTTGG + Intronic
1203752985 Un_GL000218v1:97367-97389 GCTTGGTTCTATGTCCCTGTGGG - Intergenic
1203555992 Un_KI270743v1:208240-208262 GCTTGGTTCTATGTCCCTGTGGG - Intergenic
1186443721 X:9607936-9607958 GCATGGTGATATGCACCTGTGGG - Intronic
1186891913 X:13967458-13967480 TCCTGGTGCCATGTCTCTCTGGG - Intergenic
1187314141 X:18176538-18176560 GTATGGTGGCATGCACCTGTGGG + Intronic
1188210872 X:27421685-27421707 GCTTGGTGGCTTGTGCCTGTAGG + Intergenic
1188298243 X:28476610-28476632 GCATGGTGGCATGCACCTGTAGG - Intergenic
1189684160 X:43546380-43546402 GCGTGGTGGCATGTGTCTGTAGG - Intergenic
1190254338 X:48751332-48751354 GCATGGTGGCATACACCTGTGGG + Intergenic
1194110181 X:89824268-89824290 GCCTGGTGCCCTATTACTGTGGG - Intergenic
1197940720 X:131786009-131786031 GCGTGGTGGCATGCACCTGTGGG + Intergenic
1198074730 X:133183495-133183517 GTGTGGTGGTATGTACCTGTAGG + Intergenic
1198187522 X:134268003-134268025 GCATGGTGGCGTGTGCCTGTGGG - Intergenic
1199301382 X:146218223-146218245 GCGTGATGGCATGCACCTGTAGG - Intergenic
1199835023 X:151581449-151581471 GCATGGTGGCATGCACCTGTAGG + Intronic
1200462838 Y:3479009-3479031 GCCTGGTGCCCTATTACTGTGGG - Intergenic
1201166626 Y:11214937-11214959 GCTTGGTTCTATGTCCCTGTGGG - Intergenic
1202232259 Y:22669531-22669553 GCCTGGTGCGAGCTACCTATAGG - Intergenic
1202245088 Y:22811808-22811830 GCCTGGTGGCTGGTGCCTGTAGG - Intergenic
1202310897 Y:23526627-23526649 GCCTGGTGCGAGCTACCTATAGG + Intergenic
1202398078 Y:24445554-24445576 GCCTGGTGGCTGGTGCCTGTAGG - Intergenic
1202472703 Y:25224532-25224554 GCCTGGTGGCTGGTGCCTGTAGG + Intergenic
1202559905 Y:26143967-26143989 GCCTGGTGCGAGCTACCTATAGG - Intergenic