ID: 1124362071

View in Genome Browser
Species Human (GRCh38)
Location 15:29044972-29044994
Sequence CTGTGTCCACACATGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3464
Summary {0: 1, 1: 49, 2: 396, 3: 1005, 4: 2013}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124362071 Original CRISPR CTGTGTCCACACATGGTGAA AGG Intronic
Too many off-targets to display for this crispr