ID: 1124362222

View in Genome Browser
Species Human (GRCh38)
Location 15:29046067-29046089
Sequence GCTATGTGGGACCTTCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124362218_1124362222 -1 Left 1124362218 15:29046045-29046067 CCCGGAAAGGTGGGATTTGGCAG 0: 1
1: 0
2: 1
3: 26
4: 207
Right 1124362222 15:29046067-29046089 GCTATGTGGGACCTTCCTTCAGG 0: 1
1: 0
2: 0
3: 8
4: 102
1124362219_1124362222 -2 Left 1124362219 15:29046046-29046068 CCGGAAAGGTGGGATTTGGCAGC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1124362222 15:29046067-29046089 GCTATGTGGGACCTTCCTTCAGG 0: 1
1: 0
2: 0
3: 8
4: 102
1124362212_1124362222 23 Left 1124362212 15:29046021-29046043 CCAGACGTTTTGAGAGTCTGGCA 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1124362222 15:29046067-29046089 GCTATGTGGGACCTTCCTTCAGG 0: 1
1: 0
2: 0
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124362222 Original CRISPR GCTATGTGGGACCTTCCTTC AGG Intronic
907908302 1:58805075-58805097 GCTCTGTGTGACCTGTCTTCTGG + Intergenic
908711672 1:67022614-67022636 GTGATGTGGGTCCTCCCTTCAGG - Intronic
911165039 1:94717223-94717245 GCGATGTGAGACCTGCCATCAGG + Intergenic
912038212 1:105349527-105349549 CCAATGTGGGACCTTATTTCTGG - Intergenic
914321699 1:146569326-146569348 GCTGTGTGAGATTTTCCTTCAGG + Intergenic
915941785 1:160123094-160123116 ACCAGGTGGGACTTTCCTTCTGG + Intronic
920375921 1:205507937-205507959 GCTGTGGGGGCCCTACCTTCTGG + Intronic
920809259 1:209266900-209266922 GCTATGGGGCTCCTTCCTTGTGG + Intergenic
1063410687 10:5834318-5834340 GCTCAGTGTGACCTTCCTTATGG + Intronic
1069610505 10:69769477-69769499 CCTCTCTTGGACCTTCCTTCTGG - Intergenic
1069751620 10:70748793-70748815 GCTCTGTGGGCCCTTCCACCTGG + Intronic
1069811376 10:71162428-71162450 GCTATCAGAGACCTTCATTCTGG + Intergenic
1077091076 11:778527-778549 GCTTGGTGGGACCTTCATACTGG - Intronic
1079083331 11:17428768-17428790 GCTTTGTGGGACTATACTTCAGG - Intronic
1086992363 11:93318060-93318082 GCTATGTTGGCCTTTCCTTACGG - Intergenic
1087354369 11:97075312-97075334 GCTATCTTGGCCCCTCCTTCAGG + Intergenic
1091215772 11:133900582-133900604 TCTTAGTGGAACCTTCCTTCTGG - Intergenic
1092812589 12:12285669-12285691 CCTTTGTCTGACCTTCCTTCTGG - Intergenic
1096764104 12:53868949-53868971 GCTATGCGAGAACTTGCTTCTGG - Intergenic
1101965526 12:109279577-109279599 ACAATGAGGGACCTGCCTTCTGG + Exonic
1102437990 12:112940141-112940163 GTAAAGTGGTACCTTCCTTCTGG + Intronic
1102682177 12:114698310-114698332 GCTATGTCGCCCCTTCTTTCAGG - Intergenic
1104925374 12:132311312-132311334 GCACTGGGGGACCTGCCTTCAGG + Intronic
1105812406 13:24007077-24007099 GCTGAGTGTGACCTTCCTGCTGG + Intronic
1107614116 13:42146920-42146942 GCTACATGGGACCCACCTTCTGG + Intronic
1113377790 13:109781660-109781682 GCTGCGTGGGTCCGTCCTTCTGG - Intronic
1113571591 13:111361971-111361993 CCCATGTGGGACCTCCCTCCAGG + Intergenic
1115270077 14:31541654-31541676 GCTATGTGATACCTTTCTTCTGG + Intronic
1124362222 15:29046067-29046089 GCTATGTGGGACCTTCCTTCAGG + Intronic
1124545673 15:30624733-30624755 GCTGAGTGGGACCATCATTCAGG - Intronic
1124779193 15:32614119-32614141 GCTGAGTGGGACCATCATTCAGG - Intergenic
1127647737 15:60974814-60974836 GCTGTGAGGGCCCCTCCTTCAGG - Intronic
1128284574 15:66425805-66425827 GCAAGGTGTGCCCTTCCTTCCGG - Intronic
1130746900 15:86664025-86664047 TCTATGCTGGACCTTCCTTTGGG - Intronic
1133847717 16:9471848-9471870 GCTATGTGGATCCTTCCATAAGG - Intergenic
1140873954 16:79133010-79133032 GCTCTGTGAGATTTTCCTTCTGG + Intronic
1142239667 16:88939531-88939553 GCTATTTGGGACCGTCCTGCTGG - Intronic
1143856388 17:9854112-9854134 GGTCTATGGGTCCTTCCTTCTGG - Intronic
1149563207 17:57624177-57624199 CCTATGTGTCACCTTCCCTCAGG - Intronic
1150573857 17:66412622-66412644 GCTATGTGCCACCTGCTTTCTGG + Intronic
1159102099 18:63969058-63969080 GCTCTGTGAGAGCTTCCTGCAGG + Intronic
1161272272 19:3396591-3396613 GCTATGTGAGAACTTCCAACAGG + Intronic
1164294625 19:23898926-23898948 CCTACTTGGGACCTTCCTACAGG + Intergenic
1165429140 19:35762267-35762289 GCTGTATGGGGTCTTCCTTCTGG - Exonic
1165812260 19:38618651-38618673 GCTTTGTGGGACCCTCCTCCTGG + Intronic
926160067 2:10481611-10481633 GCTCAGTGGCATCTTCCTTCTGG - Intergenic
927185927 2:20482458-20482480 GCTCTGGTGGCCCTTCCTTCTGG + Intergenic
931976476 2:67649392-67649414 CCTATCTGCGATCTTCCTTCTGG - Intergenic
932425284 2:71630285-71630307 GCTATGTGGGGCTATTCTTCTGG + Intronic
932582613 2:73001476-73001498 CCTGTGTGGGCCCTTCCTTCAGG + Intronic
933346572 2:81093511-81093533 CCTATGTCGTACCTTCCTACAGG + Intergenic
933726096 2:85428199-85428221 GCTAATTGTGACCTTCCTTAAGG - Intronic
937014822 2:118595856-118595878 GCTATGTGGGTGCTGCCTTTAGG + Intergenic
937314350 2:120921533-120921555 GCTATGAGGTCCCTTCCTACTGG - Intronic
938580465 2:132641355-132641377 GCTATGTGGGAGGTTCCTTGGGG + Intronic
946171374 2:217898014-217898036 GCTATCTGGGGCCTTCCCTGTGG - Intronic
947525449 2:230874416-230874438 CCTGTGTGGGACCTTCCCACAGG + Intronic
1179292551 21:40031275-40031297 GGAATCTGGGAGCTTCCTTCTGG - Intronic
1183747880 22:39702688-39702710 GCCTCTTGGGACCTTCCTTCTGG - Intergenic
952623619 3:35376839-35376861 GATTTGTGGGTGCTTCCTTCTGG - Intergenic
953006770 3:38986243-38986265 GCTCTGTCGGCACTTCCTTCTGG - Intergenic
953414486 3:42707870-42707892 GCTATGAGTGACCCTCCTTGGGG + Intronic
953439165 3:42903428-42903450 GCCATAAGAGACCTTCCTTCTGG + Intronic
955773773 3:62412525-62412547 GATATTTGGGACCTTCCTAAGGG - Intronic
961619741 3:128214381-128214403 GTGCTGTGGGACTTTCCTTCAGG + Intronic
962461844 3:135621416-135621438 CCTATGTGGGATCTACCTCCTGG - Intergenic
967997886 3:195180323-195180345 CCTTTGTGGCTCCTTCCTTCTGG - Intronic
968908142 4:3463844-3463866 GGTATGTGGGGCTTTGCTTCTGG - Intronic
971091733 4:23353412-23353434 GCTATGTTGTACCTCCCTTTTGG - Intergenic
976445394 4:85125376-85125398 GCTATGTGGGTCCTTTTTTTTGG + Intergenic
977667122 4:99654315-99654337 GATACGTGGGACCCTGCTTCGGG - Exonic
979990400 4:127368106-127368128 GCTATGAGGCAGCTTCCTGCTGG - Intergenic
985412153 4:189696086-189696108 GCACTGTGGGAGCTTCTTTCTGG - Intergenic
985479011 5:95651-95673 GCCCTGTGGGACTCTCCTTCCGG + Intergenic
985988251 5:3535365-3535387 TCTCAGTGGGACCTTCCTCCCGG + Intergenic
992512759 5:77455756-77455778 GCTATGTGAGACTTTACTTCTGG + Intronic
995606563 5:113862677-113862699 CCTAAGTGGGAACTTCCCTCTGG + Intergenic
996337458 5:122400340-122400362 AGTAAGTGGGACCTTCCTCCAGG - Intronic
996913318 5:128680215-128680237 GGTATGTGGTACCTACCTTTGGG + Intronic
997205353 5:132045171-132045193 ACTATGTGGGACCTCCCAACTGG - Intergenic
998203548 5:140143900-140143922 GCTATGTGGGCACTTCCATAGGG - Intergenic
1011241232 6:85273272-85273294 GCTATGTGGGGACCTCCTTCAGG + Intergenic
1011727615 6:90226229-90226251 GCTATGAAGGACTTTTCTTCAGG + Intronic
1012631041 6:101468141-101468163 GCTCTGTGGGTCCTTCCCACTGG - Intronic
1012631211 6:101470052-101470074 GCTCTGTGGGGCCTTCCTATTGG + Intronic
1016121259 6:140344381-140344403 ACTCTGTGGGACCTTGCTTAGGG - Intergenic
1016669153 6:146681184-146681206 GCCATGAGGGATCTGCCTTCAGG - Intronic
1018717462 6:166544561-166544583 GCTACATGGGAGGTTCCTTCTGG - Intronic
1022826796 7:34022853-34022875 GCTATGACGGATCATCCTTCTGG + Intronic
1025848305 7:65219806-65219828 GCTCAGTGGGACCATTCTTCTGG + Intergenic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1043389729 8:79780883-79780905 GATATGTGGGACCATACTTTAGG + Intergenic
1044561056 8:93612693-93612715 GCCATGAGGGCCCTGCCTTCAGG - Intergenic
1049320223 8:141992272-141992294 GCTAGGTCGGACCAGCCTTCAGG + Intergenic
1049494042 8:142921439-142921461 CCTGTGTGGGACCTTGCTCCAGG - Intergenic
1051459088 9:17293484-17293506 ACTGGGTGGGACCTTCCTGCAGG - Intronic
1055587116 9:77766851-77766873 GCTATGTGGGACCTCTCTGGGGG + Intronic
1057811902 9:98263952-98263974 CCTTTGTGGGACCTGCCCTCCGG + Intergenic
1061373120 9:130209036-130209058 GCTGTTTGGGACCCTCCTCCAGG + Intronic
1061678200 9:132230018-132230040 CCTATGAGGGAACTTCCTTATGG - Intronic
1203670441 Un_KI270755v1:6895-6917 GCACTGTGGGAGCTTCTTTCTGG + Intergenic
1186510323 X:10125532-10125554 GGTAAGTGGGACCCTCCATCAGG - Intronic
1187047984 X:15666764-15666786 GCTAGGTGAGCTCTTCCTTCTGG - Intergenic
1187053711 X:15719512-15719534 GCTAGGTGAGCTCTTCCTTCTGG - Intronic
1191167693 X:57407360-57407382 GTTATGTGGGAACTTCCTGGGGG - Intronic
1192152459 X:68720618-68720640 GCTCTGTGCTACCTTCTTTCTGG + Intronic
1192292842 X:69815614-69815636 ACTAGGTGGGACCTCCCTGCGGG + Intronic
1195294986 X:103467423-103467445 ACTAAGTGTGACCTTCATTCAGG + Intergenic
1200875944 Y:8154977-8154999 GCTATTTTGGACCTTCCTTGTGG - Intergenic
1202189203 Y:22223646-22223668 GCTATTTTGGACCTTCTTTATGG - Intergenic
1202575138 Y:26315943-26315965 TCCATGTGTGACCTTCTTTCTGG - Intergenic