ID: 1124364574

View in Genome Browser
Species Human (GRCh38)
Location 15:29062884-29062906
Sequence TCCCCACAGCCCCACGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 263}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124364574_1124364589 30 Left 1124364574 15:29062884-29062906 CCCATCTCGTGGGGCTGTGGGGA 0: 1
1: 0
2: 3
3: 34
4: 263
Right 1124364589 15:29062937-29062959 GGTGGGGAGGGGAGTTGATCTGG 0: 11
1: 1
2: 10
3: 42
4: 486
1124364574_1124364586 17 Left 1124364574 15:29062884-29062906 CCCATCTCGTGGGGCTGTGGGGA 0: 1
1: 0
2: 3
3: 34
4: 263
Right 1124364586 15:29062924-29062946 CAGTGTCTGTATGGGTGGGGAGG 0: 11
1: 7
2: 5
3: 38
4: 578
1124364574_1124364587 18 Left 1124364574 15:29062884-29062906 CCCATCTCGTGGGGCTGTGGGGA 0: 1
1: 0
2: 3
3: 34
4: 263
Right 1124364587 15:29062925-29062947 AGTGTCTGTATGGGTGGGGAGGG 0: 11
1: 2
2: 12
3: 46
4: 597
1124364574_1124364582 9 Left 1124364574 15:29062884-29062906 CCCATCTCGTGGGGCTGTGGGGA 0: 1
1: 0
2: 3
3: 34
4: 263
Right 1124364582 15:29062916-29062938 ATCTGGGTCAGTGTCTGTATGGG 0: 4
1: 1
2: 1
3: 18
4: 146
1124364574_1124364580 -7 Left 1124364574 15:29062884-29062906 CCCATCTCGTGGGGCTGTGGGGA 0: 1
1: 0
2: 3
3: 34
4: 263
Right 1124364580 15:29062900-29062922 GTGGGGAGGGGAGTTGATCTGGG 0: 5
1: 1
2: 5
3: 36
4: 378
1124364574_1124364588 19 Left 1124364574 15:29062884-29062906 CCCATCTCGTGGGGCTGTGGGGA 0: 1
1: 0
2: 3
3: 34
4: 263
Right 1124364588 15:29062926-29062948 GTGTCTGTATGGGTGGGGAGGGG 0: 11
1: 0
2: 18
3: 132
4: 1423
1124364574_1124364585 14 Left 1124364574 15:29062884-29062906 CCCATCTCGTGGGGCTGTGGGGA 0: 1
1: 0
2: 3
3: 34
4: 263
Right 1124364585 15:29062921-29062943 GGTCAGTGTCTGTATGGGTGGGG 0: 11
1: 2
2: 0
3: 24
4: 305
1124364574_1124364583 12 Left 1124364574 15:29062884-29062906 CCCATCTCGTGGGGCTGTGGGGA 0: 1
1: 0
2: 3
3: 34
4: 263
Right 1124364583 15:29062919-29062941 TGGGTCAGTGTCTGTATGGGTGG 0: 2
1: 2
2: 14
3: 30
4: 482
1124364574_1124364581 8 Left 1124364574 15:29062884-29062906 CCCATCTCGTGGGGCTGTGGGGA 0: 1
1: 0
2: 3
3: 34
4: 263
Right 1124364581 15:29062915-29062937 GATCTGGGTCAGTGTCTGTATGG 0: 5
1: 1
2: 1
3: 8
4: 153
1124364574_1124364579 -8 Left 1124364574 15:29062884-29062906 CCCATCTCGTGGGGCTGTGGGGA 0: 1
1: 0
2: 3
3: 34
4: 263
Right 1124364579 15:29062899-29062921 TGTGGGGAGGGGAGTTGATCTGG 0: 1
1: 11
2: 0
3: 43
4: 349
1124364574_1124364584 13 Left 1124364574 15:29062884-29062906 CCCATCTCGTGGGGCTGTGGGGA 0: 1
1: 0
2: 3
3: 34
4: 263
Right 1124364584 15:29062920-29062942 GGGTCAGTGTCTGTATGGGTGGG 0: 4
1: 9
2: 0
3: 23
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124364574 Original CRISPR TCCCCACAGCCCCACGAGAT GGG (reversed) Intronic
900516708 1:3085615-3085637 ACACCACAGCCCCACGAGGATGG - Intronic
900577243 1:3389418-3389440 CCCCCTCAGCCCCACGCCATAGG - Intronic
900936743 1:5770870-5770892 TCCTCACCTCCCCAGGAGATCGG + Intergenic
901658907 1:10786606-10786628 TCACATCAGCCCCACGAGGTAGG + Intronic
901929563 1:12588344-12588366 TCCTCACAACCCCTCGAGGTGGG + Intronic
902604091 1:17559215-17559237 TCCCAACAGCCATATGAGATAGG - Intronic
903230356 1:21918587-21918609 TCCCAACAGCCCCACAAGATCGG + Intronic
903565789 1:24264690-24264712 GGACCACAGCCCCACGGGATAGG - Intergenic
903576225 1:24341296-24341318 ACCCCACAGCCACACAAGATAGG + Intronic
903607582 1:24586088-24586110 TTCTCACAACCCCACGAGACAGG + Intronic
903679556 1:25088047-25088069 TCCTCACAGCCCCATGAGGCAGG - Intergenic
904400095 1:30250559-30250581 TCCCAACAGCCCCATGAGGCAGG - Intergenic
904527180 1:31142534-31142556 TCCCCACAGTTCCTCTAGATAGG - Intergenic
905676156 1:39826755-39826777 TCCCCACAGCCTCACCAGCTGGG - Intergenic
907822615 1:57985933-57985955 TCCTAACAGCCCTATGAGATAGG + Intronic
910699062 1:90052717-90052739 TCACAACAGCCCCACGAAGTGGG + Intergenic
912721888 1:112027280-112027302 TCACCACAGCCCTAGGAAATAGG - Intergenic
913986826 1:143573116-143573138 TCCCAACAGCCCCAGCAGCTTGG + Intergenic
915260180 1:154671435-154671457 TCTCCACCTCCCCACTAGATGGG - Intergenic
920340200 1:205270868-205270890 TCCCCACAATCCCATGAGATAGG - Intronic
920374669 1:205501440-205501462 TCACAACAGCCCCATGAGAGAGG + Intergenic
924452709 1:244192686-244192708 TCCCCACAGTCGCACATGATGGG + Intergenic
924627766 1:245710039-245710061 GCTCCACACCCCCAGGAGATAGG + Intergenic
1063007565 10:1988106-1988128 TCTCAACAGCCCCATGAGGTAGG + Intergenic
1064193714 10:13228838-13228860 TCCCCACAGCCCCAAGCCAATGG + Intronic
1065094769 10:22269653-22269675 TCCTCACTGCCCTACAAGATGGG + Intergenic
1065779567 10:29154502-29154524 TCACAACAGCCTCATGAGATAGG + Intergenic
1066059293 10:31707933-31707955 CCCCCACAGCCCCAAGACAAGGG + Intergenic
1069667351 10:70171522-70171544 TCAGGACAGTCCCACGAGATTGG + Intergenic
1069843390 10:71354224-71354246 TCATCACAGCCCTACGAGGTGGG + Intronic
1070393291 10:75989670-75989692 TCACCACAACCCCATGAGGTAGG + Intronic
1072211471 10:93250410-93250432 TCCCAACAGCCCCATGAGGGAGG + Intergenic
1073452126 10:103616290-103616312 TCCCCAGAGCCCAAGGATATAGG + Intronic
1073454462 10:103628277-103628299 TCCCCACCGCCCCACATGACAGG + Intronic
1075954750 10:126513315-126513337 TTCCCATAGCCCCACAAGACAGG - Intronic
1077422759 11:2460690-2460712 GCCCCACTGCCCCACAAGAGCGG - Intronic
1077439513 11:2561516-2561538 TCCCCACAGTCCTAGGAGGTGGG + Intronic
1077808037 11:5609210-5609232 TCCTCACAGACACACGAAATGGG + Intronic
1077888420 11:6402577-6402599 TCCCCCCAGCCCCCAGACATGGG + Exonic
1078549695 11:12271567-12271589 TCCCAACAGCCCTAAGAGAACGG - Intergenic
1081844034 11:46225412-46225434 TTCTCACAGTCCCATGAGATAGG - Intergenic
1081845437 11:46237806-46237828 TCCCGACAGCTCCACGCGGTTGG - Intergenic
1083605283 11:63974992-63975014 TCCCCACAGCCCCAGGATCTCGG + Intronic
1083666573 11:64278519-64278541 TCGCCACAGCCCTGCGAGGTGGG + Intronic
1084952754 11:72675704-72675726 TCCCCACAGCTCAGAGAGATGGG - Intergenic
1085732524 11:79011703-79011725 TCCCCACTGCCCCACCTGCTGGG + Intronic
1086072383 11:82813421-82813443 TCCCAACAGCCCCAGGAGGTAGG - Intergenic
1088127646 11:106448206-106448228 TCCTCACAACCCTACGAGACAGG + Intergenic
1088684080 11:112270572-112270594 TCCCAACAGCCTTATGAGATGGG - Intergenic
1089002845 11:115066778-115066800 ACCCCACATCCCCACTTGATAGG - Intergenic
1089531405 11:119132198-119132220 TCACAACAGCCCCATGAGGTAGG + Intronic
1089632412 11:119791949-119791971 TCCACACAGCCACAGGAGATGGG - Intergenic
1089800695 11:121024428-121024450 TCCCCACAGCTGCTCGAGACAGG - Intronic
1090425801 11:126606391-126606413 TCCTCACAGCTCCATGAGTTAGG - Intronic
1090427365 11:126617698-126617720 TCCCCACAACCCAGCAAGATAGG + Intronic
1090868703 11:130724336-130724358 TTCCCACAGCCTCAAGAGACGGG + Intergenic
1091652683 12:2321399-2321421 TCCCATCAGCCCTACGAGATGGG - Intronic
1091971887 12:4794281-4794303 GCCCCACATCCCCACAAGACAGG - Intronic
1094357136 12:29589932-29589954 TGCCCACAGCCCCAGAAGCTAGG + Intronic
1094488072 12:30940708-30940730 TCCTCACAACCCCATGAGGTAGG - Intronic
1095777482 12:46025420-46025442 TCCCCTCTCCCCCACAAGATGGG - Intergenic
1095824983 12:46521422-46521444 TCCCCACAGCCCTGACAGATGGG + Intergenic
1097325496 12:58271768-58271790 TCCCCATAGCCCCACAGAATAGG - Intergenic
1098519880 12:71422994-71423016 TCCTCACAACCCCATGAGTTAGG - Intronic
1100275900 12:93071638-93071660 TCACAAGAGCCCCACGAGATGGG + Intergenic
1101160454 12:101968904-101968926 TCACCACAACCCTATGAGATTGG + Intronic
1102218143 12:111176499-111176521 TGCCCACAGCCCCATGACATGGG - Intronic
1102421211 12:112804333-112804355 TGCTCACAGCCCCACCTGATGGG - Intronic
1102877146 12:116457530-116457552 TCACAACAGCCCCGTGAGATAGG - Intergenic
1103267107 12:119639782-119639804 CCCTCACAGCCCTATGAGATAGG - Intronic
1103775463 12:123364143-123364165 TCCCCACCGCCCCAAGAGCGGGG + Intronic
1103827327 12:123750221-123750243 TCACAACAGCCCCAGGAGGTAGG + Intronic
1104412217 12:128568528-128568550 TCTCCACATCCCTACGAGGTGGG + Intronic
1105947352 13:25201511-25201533 ACCCCACAGCCCCACGCATTTGG + Intergenic
1106373252 13:29158295-29158317 TCGCCACAATTCCACGAGATAGG + Intronic
1106550498 13:30766705-30766727 TCCTCACAACCCCATGAGTTTGG - Intergenic
1107012773 13:35684523-35684545 TGCCCACAGCCCTACCAGAGTGG - Intergenic
1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG + Intronic
1117316539 14:54576621-54576643 TTCCCACTGCCCCATCAGATAGG - Intronic
1118284085 14:64455241-64455263 CCCCCACAGCCCTAGGAGGTAGG + Intronic
1121561844 14:94881789-94881811 CTCCCACAGCCCCATGAGAGGGG + Intergenic
1121743059 14:96267378-96267400 TCCCCACAGCTGCACGGGAAGGG + Intronic
1122134163 14:99623158-99623180 TCCCCACAGCCCTGCCAGCTCGG + Intergenic
1122280907 14:100621992-100622014 CCCCCACAGCCCCACATGATTGG + Intergenic
1124254730 15:28131367-28131389 ACCCCACAGCCCCACGAGAGAGG + Intronic
1124364574 15:29062884-29062906 TCCCCACAGCCCCACGAGATGGG - Intronic
1124661218 15:31552557-31552579 TCACAACAGCCCCACAAGGTGGG + Intronic
1127059271 15:55165474-55165496 TCCCAACAGCCCTACCAGAGAGG + Intergenic
1127608614 15:60615432-60615454 GCCCCAAAGTCTCACGAGATGGG + Intronic
1129002317 15:72344967-72344989 TCACCACAGCCCCATGAGACAGG - Intronic
1129714112 15:77837034-77837056 TCCCCAAAGCCCCTCCAGCTTGG - Intergenic
1130049601 15:80472722-80472744 TCACCACAACCACACGAGCTGGG - Intronic
1130444214 15:83983762-83983784 TCACATCAGCCCCATGAGATTGG + Intronic
1130923211 15:88366213-88366235 TCCCCACAGCCCCGTGAGGGAGG + Intergenic
1131853692 15:96569585-96569607 TCCCCACAGCCCTCCGTGAGGGG + Intergenic
1132505255 16:304936-304958 TCCCCACGGACCCAGGAGACAGG + Intronic
1132680086 16:1136581-1136603 TCCCCACACCCCCAGCAGAAGGG - Intergenic
1134065554 16:11225857-11225879 TCCCCACATCCCCGCAAGGTGGG - Intergenic
1134826326 16:17287373-17287395 TGGCCACAGCCCCAGGAGGTGGG - Intronic
1135434957 16:22420668-22420690 ACTCCCCAGCCCCACGAGCTTGG + Intronic
1136093107 16:27934796-27934818 TCCCAACAGCCCCAGGAAATAGG - Intronic
1138416633 16:56875330-56875352 TCCCCACCGCCCTGCAAGATGGG - Intronic
1138511185 16:57509344-57509366 TCCCAACAGCCACACGCGGTAGG - Intergenic
1140977525 16:80074310-80074332 TCCTTACACCCCCACGAAATGGG - Intergenic
1141429555 16:83964676-83964698 TCCCCACGACCTCACGAAATAGG + Intronic
1141450499 16:84097340-84097362 TCATGACAGCCCCACGAGGTAGG + Intronic
1141615892 16:85209218-85209240 TCACAACAACCCCACGAGGTAGG + Intergenic
1142077435 16:88128249-88128271 TCCTGACAGCCCCCCGAGAAAGG - Intergenic
1142197966 16:88747546-88747568 ACCCCACAGCACCACGAGCTAGG + Intronic
1142231751 16:88903370-88903392 TCCCCACAGGCCCAGCAGAGGGG - Intronic
1145241996 17:21245547-21245569 TCCCCAAAGCCTCAGGAGAGTGG + Intronic
1146129618 17:30260093-30260115 TCACAACAACCCTACGAGATAGG + Intronic
1146504534 17:33393625-33393647 TCTCCACAGCCCTATGAGATAGG - Intronic
1147323271 17:39658558-39658580 TACCCACAGCCCCAAGAGAGGGG + Intronic
1147979313 17:44264991-44265013 TCCCCACAGCCCCCAGTGCTCGG - Intronic
1147979335 17:44265050-44265072 TCCCCACAGCCCCCAGTGCTCGG - Intronic
1148745342 17:49914911-49914933 TCTCCACAGCCCTAGGAGATAGG + Intergenic
1156584376 18:38415742-38415764 TCTCCACAGCCCCAGCAGCTTGG + Intergenic
1157381973 18:47226811-47226833 TCTCCACAACCCCAAGAGGTAGG + Intronic
1157428433 18:47603410-47603432 TCACCACAACCCGAAGAGATAGG - Intergenic
1157549051 18:48568341-48568363 TCCCAGCAGCCCCATGAGGTGGG + Intronic
1160270962 18:77382965-77382987 TCCTCACAACCCCTGGAGATGGG - Intergenic
1160327882 18:77967453-77967475 GCCCCACAGCACCACGAGCTTGG + Intergenic
1160736390 19:664422-664444 TACCCCCAGTCCCATGAGATTGG + Intergenic
1160933325 19:1581036-1581058 TCCCCACGGCCACAAGAGACAGG + Intronic
1161298410 19:3531385-3531407 TCCACACAGGCCCAGGAGCTGGG - Intronic
1161507385 19:4651125-4651147 ACCCCACAGCTCCATGAGGTGGG - Intronic
1163450300 19:17373239-17373261 TCACCTCAGCCCCCCAAGATGGG - Intronic
1163476509 19:17529192-17529214 CCCCCCCAGCCCCATGAGCTAGG - Intronic
1165409229 19:35648621-35648643 TCCCACCAGCCCTATGAGATAGG + Intronic
1165883521 19:39060504-39060526 TCTCCACAACCCTATGAGATAGG - Intergenic
1166020453 19:40024203-40024225 TTCCCACAGCAACATGAGATTGG + Intergenic
1166075942 19:40413822-40413844 TCACCACAGCCCCATAAGGTGGG - Intergenic
1166122448 19:40693701-40693723 TCCCAACAGCCCCATGAGGAAGG - Intronic
1166945184 19:46391872-46391894 TCCACACAGCTCCACGGGAGAGG - Intronic
1167382259 19:49145540-49145562 TCCCAACAACCTCACGAGTTAGG - Intronic
1167492838 19:49802000-49802022 TGCCCGCAGCCCCAGGAGGTCGG - Exonic
925907592 2:8548470-8548492 TTCCCACAGCCCCAGGAGGCTGG + Intergenic
925985574 2:9212339-9212361 TCACCACAGCCCCACGCCCTGGG - Intronic
927873589 2:26639940-26639962 CCCCCACAGCCCCACGAGAAGGG + Intronic
929992856 2:46804125-46804147 TTGCCACAGCCCCACGAGGCAGG - Intergenic
933723122 2:85410585-85410607 TCCACACAGCCCCACCACAGTGG + Intronic
933776784 2:85775930-85775952 TCACCACAGCCCCACAAATTGGG + Intronic
935710586 2:105894732-105894754 TCATCACAGCCCCATGAGGTGGG + Intergenic
936119271 2:109727331-109727353 TCACCACAGTTCCATGAGATAGG + Intergenic
936461548 2:112718063-112718085 TCCTAACAGCCCCACGAGACAGG - Intergenic
937457943 2:122059118-122059140 TCCCCTCAGCCCCAGGAAGTAGG + Intergenic
938250991 2:129815579-129815601 CCCCCACAGCCTCAGGACATGGG + Intergenic
940884072 2:158973618-158973640 TCCCCACAGCCCCATTTTATGGG - Intronic
941670518 2:168287779-168287801 TCCCCCCTCCCCCAAGAGATGGG - Intergenic
941739808 2:169023312-169023334 TCCCAACAGCCTCCTGAGATGGG + Intronic
942211678 2:173677364-173677386 TACCCACAGCCCCTGGAGGTGGG - Intergenic
945995321 2:216431593-216431615 CTCCCACAGCTCCATGAGATAGG + Intronic
946457263 2:219837636-219837658 TCCCCACACCCCCATGATATAGG + Intergenic
948310224 2:236980035-236980057 TCCTCACAGCCTCACTGGATAGG + Intergenic
1169941804 20:10945775-10945797 TCCTCACAGCTGCAAGAGATAGG + Intergenic
1170038937 20:12019942-12019964 TTCACACAGCCCCACCAGACAGG + Intergenic
1170907250 20:20527599-20527621 CCCCCACACCCCCAAGAGCTGGG + Intronic
1173501845 20:43559582-43559604 TTCCCACAACCCCACGGGTTAGG - Intronic
1173867501 20:46321994-46322016 TCCCCAAATCCCCATGAGGTGGG - Intergenic
1173878914 20:46395845-46395867 TCCCAGCAGCCCCACGAATTAGG + Intronic
1174113447 20:48211720-48211742 CCCCCACAGCCCCAGGAAGTTGG - Intergenic
1174168405 20:48600787-48600809 TCTCCACAGCCCCAGGAAGTCGG + Intergenic
1174201283 20:48808326-48808348 TCCCCACAGCCCCATCAGCGAGG + Intronic
1174306158 20:49615708-49615730 TCCCCACAGTCCCACGGTGTAGG - Intergenic
1174525171 20:51164731-51164753 TCCCCACAAGCCCATGAGATTGG - Intergenic
1175202625 20:57288585-57288607 TCTCCACAGCCCCATGAGGTAGG - Intergenic
1175234997 20:57503653-57503675 TCCCCACAGGCCCCTGAGAGGGG - Intronic
1175263676 20:57690026-57690048 TCACCTCAGCTCCACGAGCTAGG + Intronic
1175385350 20:58591466-58591488 TCCCAACAGCCACTCGAGGTAGG + Intergenic
1175915314 20:62423306-62423328 GACCCACAGCCCCAGGAGCTGGG - Intronic
1176040115 20:63060800-63060822 AAGCCACAGCCCCACCAGATGGG + Intergenic
1176408586 21:6435342-6435364 ACACCACAGCACCAAGAGATGGG - Intergenic
1181474580 22:23160470-23160492 TCCTCACAGCCCCACCGGACAGG + Intronic
1183133445 22:35862821-35862843 TCACAGCAGCCCCATGAGATAGG - Intronic
1183212234 22:36458153-36458175 TCCCCACAGCCCCTGGGGGTGGG + Intergenic
1183238610 22:36639203-36639225 TCAAAACAGCCCCACAAGATGGG - Intronic
1183498563 22:38164423-38164445 TCACGACAGTCCCACGAGGTGGG - Intronic
1184878655 22:47291304-47291326 TCCACACAGCCCCCTGGGATGGG + Intergenic
1185179199 22:49349540-49349562 TCCACACAGCCCTGCGAGAGAGG + Intergenic
949467064 3:4354899-4354921 TCCCCACAACCCCACAAGGTAGG + Intronic
951612866 3:24511247-24511269 TCTCTAGAGCCCCAAGAGATTGG - Intergenic
951730477 3:25805240-25805262 TCACCACAGCCCTAAGAAATAGG - Intergenic
951950379 3:28193808-28193830 GCCCCACAGCCCCACCTGCTAGG - Intergenic
951950962 3:28200032-28200054 TCTCCACATCCCCACTAGATTGG + Intergenic
953660084 3:44885513-44885535 TCCCCAAAGCCCCATGAGTAGGG - Intronic
954333606 3:49903721-49903743 TCCCGACAGCCCCAAGATAGCGG + Intronic
954452007 3:50576818-50576840 CCACCACATCCCCACGAGGTGGG + Intronic
954638178 3:52082949-52082971 TCCCCACAGGGCTCCGAGATTGG + Intronic
954644574 3:52123098-52123120 TCACAGCAGCCCCATGAGATGGG - Intronic
954695001 3:52419288-52419310 TCCCAACAGCCCTAGGAGGTAGG - Intronic
955040486 3:55313110-55313132 TCCTCACAACCCCAGGAGGTAGG - Intergenic
955406356 3:58628031-58628053 TCCCCACAGCCCCATGCAGTGGG - Intergenic
957292190 3:78292303-78292325 TCCCCACAGCCCAAGGAGCAAGG + Intergenic
958033967 3:88149215-88149237 CCCCCACAGCCCCAAGAGGTAGG + Intronic
959420214 3:106119108-106119130 TGCCCACAGCCCCAACAGAGTGG - Intergenic
963397346 3:144750642-144750664 TCTCCACCTCCCCACCAGATTGG - Intergenic
965629216 3:170713620-170713642 CCCCAACAGCCCCATGAGGTAGG - Intronic
969592131 4:8127929-8127951 CCCCCACAGCCCCGCGTGCTGGG + Intronic
970139916 4:12970792-12970814 TTCCAACAGCCCCAAGAGACAGG + Intergenic
970682910 4:18532128-18532150 TCCCAACAACCCTATGAGATAGG + Intergenic
970805427 4:20024960-20024982 TCCCCAGAGACCCCAGAGATGGG + Intergenic
973829889 4:54747954-54747976 TCACAACAGCCCTAGGAGATAGG + Intergenic
974070628 4:57120168-57120190 TCCCCACAACCTCATGAGATGGG - Intergenic
974364358 4:60927041-60927063 TCCCCACAGACCCACAATAAGGG + Intergenic
976194097 4:82516518-82516540 TCACCACAGCCCTAGGAAATAGG - Intronic
979668532 4:123338697-123338719 TCACAGCACCCCCACGAGATGGG - Intergenic
981315749 4:143337717-143337739 TCTCCTCCGCCCCTCGAGATGGG + Intronic
981745995 4:148052893-148052915 TCCCCAGACCCCCAAGAGGTAGG - Intronic
981800862 4:148653920-148653942 TCCTAACATCCCCATGAGATAGG - Intergenic
987085124 5:14461069-14461091 TCCCTCCAGCCCCACATGATCGG + Exonic
988705185 5:33719061-33719083 TCCTCACAGCCCTGTGAGATGGG + Intronic
990852269 5:60220096-60220118 TCTCCACACCCCCAGGACATAGG - Intronic
990980789 5:61600943-61600965 TCTCCACACCACCAGGAGATTGG - Intergenic
992436404 5:76759654-76759676 TCCCCACAGCCCTACAAGGCAGG - Intergenic
992684802 5:79188901-79188923 TCCCAACAGCCACACGCAATAGG + Intronic
993280642 5:85920880-85920902 AACCCACAGCCCCACCAGACTGG + Intergenic
993784145 5:92107711-92107733 TCCCCACAACCCCCCGACAAGGG - Intergenic
995055187 5:107751688-107751710 TCCTCACATCCCCATGTGATTGG - Intergenic
997469006 5:134106214-134106236 TCACCACAGCCACATGAGCTTGG - Intergenic
997605134 5:135169897-135169919 TCCCAAGAGCCCTACGAGCTAGG + Intronic
997856104 5:137374050-137374072 TCCCGACAGTCCTATGAGATAGG - Intronic
998743294 5:145229154-145229176 GTCCCACAGCCCCACAAGAAAGG + Intergenic
998843027 5:146276541-146276563 TCCCCACAGCCTCTCAAGACAGG + Intronic
1000140427 5:158397923-158397945 TTCCCACAGCCCCATGACTTAGG - Intergenic
1000946154 5:167425794-167425816 TCACAACAGCCCCATGAAATAGG - Intronic
1001407026 5:171483664-171483686 TCCCCGCAGACCCATGAGAGGGG - Intergenic
1001561733 5:172674224-172674246 ACACCCCAGCCCCACAAGATGGG - Intronic
1002522813 5:179800789-179800811 TCCCTGCCTCCCCACGAGATAGG + Intronic
1003211422 6:4071428-4071450 TCCTCACAGCCTCATGAGATAGG + Intronic
1003908681 6:10724413-10724435 TCACTACAGCCCCAGGAAATCGG + Intronic
1004859725 6:19790461-19790483 TCCCAACAGCCTAACGAGATAGG - Intergenic
1006591967 6:35164882-35164904 TCACCACAGACCTTCGAGATGGG - Intergenic
1007018535 6:38495243-38495265 TCACCACATTCCCATGAGATGGG - Intronic
1007627697 6:43255537-43255559 TCCCCCCACCTCCAGGAGATGGG + Exonic
1007695768 6:43733562-43733584 TCACCACAGCCCTACGAGGTAGG - Intergenic
1008753360 6:54763796-54763818 TCTCCACAGCAACACTAGATTGG - Intergenic
1010198368 6:73262222-73262244 TCACCACAGCCCTATGAAATGGG - Intronic
1013308853 6:108874638-108874660 TCACCACATCCCCAAGAGGTGGG + Intronic
1017962333 6:159233213-159233235 TCCTCCCAGCCCCGGGAGATGGG - Exonic
1019732285 7:2634749-2634771 TTCCCACAGCCCCAGGAGGTGGG + Intronic
1020000772 7:4754359-4754381 TCCCCACAGCCCCACCCTCTGGG + Intronic
1020186616 7:5963671-5963693 TCCCCTCAACCCCACAAGACAGG + Intronic
1020296300 7:6761103-6761125 TCCCCTCAACCCCACAAGACAGG - Intronic
1022045994 7:26622860-26622882 TCGCCACAGCCAGATGAGATTGG - Intergenic
1022510597 7:30932826-30932848 TGCCCACAGCTCCAGGAGCTTGG - Intergenic
1022645929 7:32228665-32228687 TTCCCACAGCCCGACCCGATGGG + Intronic
1024617164 7:51125642-51125664 TTCCCAAATCCCCACAAGATAGG - Intronic
1024840924 7:53586701-53586723 TCCCCATAACCCCATGAGATAGG + Intergenic
1025231505 7:57205849-57205871 TCACAACAGCCCTATGAGATGGG + Intergenic
1026078045 7:67191285-67191307 ACCCCACTGCCCTAGGAGATGGG - Intronic
1026698832 7:72621008-72621030 CCCCCACTGCCCTAGGAGATGGG + Intronic
1026986314 7:74557203-74557225 TCCCCACAGACACAGGGGATGGG - Intronic
1029585648 7:101469112-101469134 TCCCCAGGGCCCCACGAGGCAGG - Intronic
1031812283 7:126385740-126385762 TCACAACAGCCCCATGAGGTTGG - Intergenic
1032484018 7:132269403-132269425 TCTCCACAGCTCCACCAGACCGG + Intronic
1036532025 8:9600058-9600080 TCCTAACAGCCCTATGAGATAGG + Intronic
1037969791 8:23163921-23163943 TCCCCAAAGTCCCATGAGAAGGG + Exonic
1039787081 8:40843305-40843327 ACCCCACAGCCCCATGACAAAGG + Intronic
1042829245 8:73008914-73008936 TCCGCACAGCCCCGCGGGCTCGG - Exonic
1043567326 8:81562342-81562364 TCCCCACAGCCACCCAAGGTGGG - Intergenic
1044568063 8:93687034-93687056 TCTTCACATCCACACGAGATAGG + Intergenic
1045502721 8:102755754-102755776 TGCCCACTGCCCCACAAGGTAGG + Intergenic
1047403036 8:124562004-124562026 GCCCCACAGCCCCACCTGCTGGG - Intronic
1047430465 8:124786727-124786749 TCACAACAGCCCTATGAGATGGG - Intergenic
1048176299 8:132155523-132155545 TTACCACAGCCCTAGGAGATAGG + Intronic
1048255912 8:132905032-132905054 TCCCCACAACCCTATGGGATAGG - Intronic
1049685358 8:143937229-143937251 TCCCCACAGCCCCGGGAGAAGGG - Exonic
1051357081 9:16249477-16249499 TCCCAACAGTCCTATGAGATAGG - Intronic
1054954494 9:70893183-70893205 TCCCCACAGGTCCTCCAGATTGG + Intronic
1057229210 9:93308712-93308734 TCCCCACAGCCCCAAGAACTAGG + Intronic
1057331864 9:94122413-94122435 ACCACACAGCCCAAAGAGATGGG + Intergenic
1057801165 9:98192317-98192339 TCCCAACAACCCCGCGAGAAGGG + Intronic
1060107118 9:120879523-120879545 ATGCAACAGCCCCACGAGATGGG - Intronic
1060859144 9:126939554-126939576 TTACCACAGCCACATGAGATGGG + Intronic
1060918589 9:127405312-127405334 ACCCCACAGCCCCACAGGCTGGG + Intronic
1061012586 9:127964198-127964220 CCCCAACAGCCCCATGTGATGGG - Intronic
1061127852 9:128688419-128688441 TCACAACAGCCCCAAGCGATAGG - Intronic
1061933673 9:133846091-133846113 TCCCGATAGCCCCACAAGATGGG + Intronic
1062178145 9:135175772-135175794 TCCCCACAGCCCCCAGAGCCAGG + Intergenic
1190119521 X:47649106-47649128 TCACCACAACCCCATGAGATAGG - Intronic
1191875936 X:65796428-65796450 TACCCACTGCCCCACCAGACTGG + Intergenic
1191955323 X:66637804-66637826 TCACAACAGCCCCATGAGGTGGG + Intronic
1192219603 X:69188411-69188433 TCCCCACAACGCCATGACATGGG - Intergenic
1192382882 X:70636188-70636210 TCCCCACAGCCCCACACACTAGG + Intronic
1194240765 X:91444604-91444626 TCCCCACAGCCTCACCTGGTGGG + Intergenic
1194974954 X:100385216-100385238 TTCCCACAGCTTCACCAGATTGG + Intronic
1196692622 X:118576559-118576581 TCCCCACAGCCCTTGGAGACAGG - Intronic
1196847260 X:119906092-119906114 TCACAACAGCCCTACGAAATAGG - Intronic
1197404352 X:126030565-126030587 TCCCAACAGCTCCAGGAGAATGG - Intergenic
1198713695 X:139533383-139533405 TCACAAAAGTCCCACGAGATAGG - Intronic
1200128333 X:153828672-153828694 TCCACACGTCCCCACGAGGTTGG + Intronic
1200684790 Y:6248459-6248481 TCCCACCAACCCCATGAGATTGG + Intronic
1200990320 Y:9339724-9339746 TCCCGCCAACCCCATGAGATTGG + Intronic
1200992981 Y:9360039-9360061 TCCCGCCAACCCCATGAGATTGG + Intronic
1200995635 Y:9380317-9380339 TCCCGCCAACCCCATGAGATTGG + Intronic
1200998300 Y:9400663-9400685 TCCCACCAACCCCATGAGATTGG + Intronic
1201000808 Y:9469195-9469217 TCCCACCAACCCCATGAGATTGG + Intronic
1201003476 Y:9489527-9489549 TCCCACCAACCCCATGAGATTGG + Intronic
1201006132 Y:9509809-9509831 TCCCACCAACCCCATGAGATTGG + Intergenic
1201008790 Y:9530122-9530144 TCCCGCCAACCCCATGAGATTGG + Intronic