ID: 1124365276

View in Genome Browser
Species Human (GRCh38)
Location 15:29066793-29066815
Sequence CTGGCTCAACTTGGTTTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124365276_1124365281 13 Left 1124365276 15:29066793-29066815 CCTCTAAAACCAAGTTGAGCCAG 0: 1
1: 0
2: 2
3: 8
4: 110
Right 1124365281 15:29066829-29066851 AGCCATTATCACACCGTGTTAGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124365276 Original CRISPR CTGGCTCAACTTGGTTTTAG AGG (reversed) Intronic
903772467 1:25772554-25772576 CTTGCTCAACTTGCTTTATGGGG - Intronic
906941855 1:50262505-50262527 CAGGCCCAGCTTGGTTTTAAAGG - Intergenic
910888768 1:91995086-91995108 CTGTCTCAACTTGGTTCTGGTGG + Intronic
912423582 1:109565824-109565846 CAGGCTCAACCTGGCTTTACAGG - Intronic
912819135 1:112853246-112853268 CTGGGCCATCTTGGTTTTAGTGG - Intergenic
918316596 1:183327890-183327912 CTGGCTCCCCTGGGTTTCAGAGG + Intronic
919504764 1:198385207-198385229 CAGGTTCAACTTGGTTATATGGG + Intergenic
920174608 1:204092706-204092728 CTGGGCCTACTTGGATTTAGGGG + Intronic
921576109 1:216836839-216836861 ATGGCTGAAATTGGTTTGAGTGG + Intronic
923018197 1:230143012-230143034 CTGGTTCAAACTGTTTTTAGGGG + Intronic
1069513306 10:69057910-69057932 CTGACTCCTCTTGGCTTTAGAGG + Intergenic
1074973243 10:118560117-118560139 CTGGGCCTACTTGGTTTTACAGG + Intergenic
1075478035 10:122753470-122753492 CTTTCTAAAGTTGGTTTTAGGGG + Intergenic
1075667917 10:124244148-124244170 CTGGGTCAACTGGGTGGTAGAGG - Intergenic
1078596886 11:12695210-12695232 CGGGCTCATTTTGATTTTAGAGG + Intronic
1087137773 11:94738197-94738219 CTAGCTCCATTTGATTTTAGTGG + Intronic
1087766854 11:102164696-102164718 ATGTATCAACTTGGTTTTAGTGG + Intronic
1088939403 11:114438512-114438534 CTTTGTCATCTTGGTTTTAGTGG - Intronic
1090164963 11:124536847-124536869 CTGGCTCATCCTGGTTGCAGTGG - Intergenic
1090305011 11:125683796-125683818 CTTCCTCAACCTGGTTTCAGAGG - Intergenic
1090305866 11:125690482-125690504 CTGCCTCAACCTGGTTTCAGAGG + Intergenic
1091166492 11:133480682-133480704 CTGGCACAACAAGGTTTCAGGGG - Intronic
1094164222 12:27425729-27425751 CTGGATCAACTTGGTTTACCTGG + Intergenic
1095574165 12:43715575-43715597 AGAGCTCAACTTGGTTCTAGTGG + Intergenic
1096219735 12:49821476-49821498 CTTTCTCAACTTGGCTTGAGTGG - Intronic
1100181308 12:92089014-92089036 CTGGCTGTGCTTGGTCTTAGGGG + Intronic
1100506762 12:95228705-95228727 CTGGCTAGACTTGGTCTTAATGG - Intronic
1105898105 13:24734858-24734880 CTGTTGCAACTTGGGTTTAGGGG + Intergenic
1110345262 13:74439699-74439721 CTGGCTAAACTTGGTCTTGAAGG + Intergenic
1111086137 13:83377684-83377706 CAGGCTCAACTTGGTTTCACTGG - Intergenic
1116164555 14:41317562-41317584 CTGGCATAACATGGTTTTGGTGG - Intergenic
1119904709 14:78291041-78291063 CTGGCTCAGCATGGTTTAAAGGG - Intronic
1123433188 15:20235577-20235599 CTGGCTAATTTTTGTTTTAGTGG - Intergenic
1123504291 15:20923933-20923955 AAGTCTCAACTTGTTTTTAGGGG - Intergenic
1123561537 15:21497630-21497652 AAGTCTCAACTTGTTTTTAGGGG - Intergenic
1123597781 15:21934910-21934932 AAGTCTCAACTTGTTTTTAGGGG - Intergenic
1124365276 15:29066793-29066815 CTGGCTCAACTTGGTTTTAGAGG - Intronic
1124963172 15:34413269-34413291 CTGGCTCAACTTAGCTTTAGAGG - Intronic
1124979794 15:34559495-34559517 CTGGCTCAACTTAGCTTTAGAGG - Intronic
1130394545 15:83490602-83490624 CAGGCTGAACTAGGTTGTAGGGG - Intronic
1202969882 15_KI270727v1_random:224754-224776 AAGTCTCAACTTGTTTTTAGGGG - Intergenic
1133470193 16:6067700-6067722 CTTCCTCAAATTGGTTTTAATGG - Intronic
1135401072 16:22166412-22166434 CTGGATGAACTTGGTTTCCGGGG - Exonic
1140326530 16:74009295-74009317 TAGGCTCATGTTGGTTTTAGTGG - Intergenic
1140641398 16:76977647-76977669 CGTGGTCATCTTGGTTTTAGTGG - Intergenic
1141266245 16:82500146-82500168 CTGGCTCCACTGGGTCCTAGAGG + Intergenic
1144631880 17:16877725-16877747 CTGTCTCCACTTGCATTTAGGGG + Intergenic
1146991536 17:37277854-37277876 ATGGCTGAATTTGGTTTTAAAGG + Intronic
1147960127 17:44162212-44162234 CTGCCTCAGCTTAATTTTAGAGG + Exonic
1149378564 17:56070021-56070043 CTTGCCCATCTTGGTTTTGGTGG + Intergenic
1150471613 17:65442389-65442411 CTGAGTCAACATGGTTTCAGTGG + Intergenic
1151169943 17:72237458-72237480 CTGGCTCAGCTGAGTTTAAGGGG + Intergenic
1153756136 18:8285365-8285387 CTGTCTCACCTTGGCTTAAGTGG - Intronic
1160038443 18:75322093-75322115 CTGGCTCAGCTGGGTTTTTCCGG - Intergenic
1160355073 18:78220929-78220951 ATGTATCAACTTAGTTTTAGAGG + Intergenic
1162769142 19:12938548-12938570 CTGGGTCAGGTTGGTTTGAGAGG + Intergenic
1165148661 19:33748587-33748609 CTGTCTCAACATGGTGTTGGGGG + Intronic
1166623340 19:44325443-44325465 CTGGCATAACTTGGCTTTTGAGG - Intergenic
1167889050 19:52525475-52525497 CTGGCTCTACTTGGTAATGGAGG - Intergenic
1167890230 19:52534281-52534303 CTGGCTCTACTTGGTAATGGAGG - Intronic
1167894303 19:52568924-52568946 CTGGCTCTACTTGGTAATGGAGG - Intronic
1167914288 19:52727471-52727493 CTGGCTCTACTTGGTAATGGAGG + Intronic
1167915574 19:52737371-52737393 CTGGCTCTACTTGGTAATGGAGG + Intergenic
1167930482 19:52859298-52859320 CTGGCTCTACTTGGTAATGGAGG + Intergenic
1167938364 19:52925636-52925658 CTGGCTCTACTTGGTAATGGAGG + Intergenic
1168003289 19:53466352-53466374 CTGGCTCTACTTGGTAATGGAGG - Intergenic
933470591 2:82717974-82717996 CAGGCTCAAATTGGTATTAGTGG - Intergenic
937470407 2:122169487-122169509 TTGTCACAACTTGGTGTTAGAGG + Intergenic
939118629 2:138089527-138089549 CTGGCTAAACTGTGTTTTACTGG - Intergenic
940540489 2:155009953-155009975 CTGGCTAAACTCTGTTTTACAGG - Intergenic
941365935 2:164611536-164611558 TTGGCTCTACTTGGTTTAATAGG - Intronic
947071710 2:226294954-226294976 CTGGCTCAACTTAGTTGAAAGGG + Intergenic
948212695 2:236206888-236206910 CTGACTCAACTTGCTTCCAGCGG - Intronic
948523682 2:238557838-238557860 CTAGCTCATCTTGGTTTGACTGG + Intergenic
1169063083 20:2675603-2675625 ATGGGTCAACTTGGATTTGGTGG + Intergenic
1169297425 20:4412204-4412226 CTGGGTCAACTTGGTTAAACGGG - Intergenic
1170657177 20:18298718-18298740 CTGGCTAAAGTGGCTTTTAGGGG + Intronic
1173498111 20:43533610-43533632 CTGACTCCACTGGGGTTTAGGGG + Intronic
1177319883 21:19508108-19508130 CTCTATCAACTTGGTTTCAGGGG + Intergenic
1182583788 22:31331238-31331260 CTGGTTCTGCTTTGTTTTAGGGG - Intronic
949472402 3:4410221-4410243 CTGGGGTAGCTTGGTTTTAGAGG + Intronic
955579983 3:60408437-60408459 CTTGCCCCACTGGGTTTTAGTGG - Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
961326823 3:126113753-126113775 CTGGCTGAACATGGTCTTACTGG + Intronic
961518225 3:127451598-127451620 AGGGCTCAACTTGGGATTAGAGG + Intergenic
967905245 3:194494107-194494129 CTGGCTTCATTTGGTTATAGTGG - Exonic
970993214 4:22236643-22236665 CTGGCTTCACCTGGTTTTAATGG + Intergenic
972582819 4:40410068-40410090 TTGGCTAAACTTTGTTTTAATGG + Intergenic
973167268 4:47093033-47093055 CTCACACAACTTGGTTTTACAGG + Intronic
977406240 4:96602928-96602950 CTGCCTTACCTTGATTTTAGTGG + Intergenic
979570085 4:122212151-122212173 CTGGCTGAACTGGGTTTTGAAGG + Intronic
980621678 4:135314948-135314970 CTGGCTCAATTATGTTTTAAAGG + Intergenic
1015547127 6:134372599-134372621 CTGGCTCAAGGAGTTTTTAGTGG + Intergenic
1016798576 6:148144382-148144404 CTGGGTTAAATTGATTTTAGGGG + Intergenic
1017991053 6:159490082-159490104 CTGGCTCAACTTGGTCAAACTGG - Intergenic
1018084078 6:160286982-160287004 ATGGCTTAACTTGGGTTCAGAGG + Intergenic
1018535935 6:164818841-164818863 CTGACTCAACTCAGTCTTAGGGG + Intergenic
1022478624 7:30728332-30728354 CTTGGCCATCTTGGTTTTAGAGG - Intronic
1023482722 7:40651710-40651732 CAGCCTCAACTTGGTTTTATGGG + Intronic
1025264150 7:57441413-57441435 CTTGCTCAACTTGGTATAAATGG + Intergenic
1025635075 7:63314679-63314701 CTTGCTCAACTTGGTGTAAATGG - Intergenic
1025647620 7:63433491-63433513 CTTGCTCAACTTGGTGTAAATGG + Intergenic
1026778804 7:73249601-73249623 CTGGCCCCACTTAGTTTTATTGG + Intergenic
1026837320 7:73647636-73647658 CTGGCTCAGCTGGGTTGAAGGGG - Intergenic
1027019666 7:74803009-74803031 CTGGCCCCACTTAGTTTTATTGG + Intronic
1027068360 7:75142932-75142954 CTGGCCCCACTTAGTTTTATTGG - Intronic
1036823817 8:11960614-11960636 GTGGCTGAACTTGGTGTTAATGG - Intergenic
1038409284 8:27345547-27345569 CTGGCTCAGCTTGCCTTTACAGG - Intronic
1039279770 8:35971766-35971788 CTATCTCAAATTGGTTATAGTGG + Intergenic
1040517621 8:48147450-48147472 TTGGCTCAGGCTGGTTTTAGAGG + Intergenic
1041318860 8:56593225-56593247 CTGCTTCAACTTGTTTTTAGAGG + Intergenic
1042503063 8:69530583-69530605 CTGCCTAAAATGGGTTTTAGAGG + Intronic
1045886873 8:107108633-107108655 CTGGGACACCTTGGGTTTAGGGG - Intergenic
1053462469 9:38281292-38281314 CTGGCTCGACCTGTTTTAAGTGG + Intergenic
1055025953 9:71721480-71721502 CAGGCTCAACTTGATGTTTGAGG + Intronic
1058371226 9:104270226-104270248 CTGGATTAATTTGGTTGTAGTGG - Intergenic
1059361778 9:113748809-113748831 CTGGGTCCACATGGTTTAAGAGG - Intergenic
1061643122 9:131975785-131975807 TTTACTCAACTTAGTTTTAGTGG - Intronic
1062003105 9:134226588-134226610 CTGGGTCAATTTGGATTTTGGGG + Intergenic
1186587443 X:10890642-10890664 CTGGCTAATTTTGTTTTTAGTGG - Intergenic
1193986194 X:88243274-88243296 CGTGATCATCTTGGTTTTAGTGG + Intergenic