ID: 1124365412

View in Genome Browser
Species Human (GRCh38)
Location 15:29067671-29067693
Sequence TTGTGGAAAAGGCGAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 376}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124365412_1124365418 27 Left 1124365412 15:29067671-29067693 CCATCCTCTCGCCTTTTCCACAA 0: 1
1: 0
2: 0
3: 28
4: 376
Right 1124365418 15:29067721-29067743 GTATATTCCTAAAAGCAGACAGG 0: 1
1: 2
2: 1
3: 7
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124365412 Original CRISPR TTGTGGAAAAGGCGAGAGGA TGG (reversed) Intronic
900487457 1:2930102-2930124 TGGTGGAAAAGGAGAGAAGCCGG + Intergenic
902406050 1:16184265-16184287 TTGTGGAACTGGAGAGAGGCTGG + Intergenic
902513901 1:16979975-16979997 CTGTGGAAGAGGCCAGAGGTGGG - Intronic
902678209 1:18023755-18023777 TTGGGGAAAAGGTGGGAGGAAGG + Intergenic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
904353498 1:29924049-29924071 TTGTGGAGGAGGGGAGAGGAAGG - Intergenic
904829553 1:33298081-33298103 TTCTGGCAAAGGCGATTGGAAGG + Intronic
905315071 1:37077302-37077324 TTGTGGTAGAGGCATGAGGAGGG + Intergenic
905882960 1:41476447-41476469 TTATGGAAAAGGCAGGAGGAGGG + Intergenic
907900769 1:58739318-58739340 TTGTGGCAAAGGCAAGGGTAAGG + Intergenic
910576897 1:88775310-88775332 TTGTGGAAAAGGCAAAACTACGG - Intronic
911171974 1:94779934-94779956 ATGTTGAAAGGGAGAGAGGAGGG - Intergenic
911653908 1:100421535-100421557 TTGAGGAAAAGGGCAGGGGAAGG - Intronic
911958401 1:104266682-104266704 TTGTTGAACAGGGGAGTGGAAGG + Intergenic
912208764 1:107535835-107535857 TTTTGCAAAAAGCGAGAGAAGGG - Intergenic
912244427 1:107945987-107946009 TTATGGAATGAGCGAGAGGAGGG + Intronic
912597000 1:110889033-110889055 TTGTGCAAAGGGCAACAGGAAGG + Intronic
914677037 1:149913501-149913523 TGGGGGCAAAGGCGAGCGGATGG - Exonic
916087899 1:161284521-161284543 GTGTGGAGAAGGGGAGAGAAGGG - Exonic
916609309 1:166374646-166374668 TTATGGAAAAGGCTAGAGTAAGG - Intergenic
917355973 1:174126634-174126656 TTTTGTATAAGGCGAAAGGAAGG + Intergenic
917616382 1:176749663-176749685 TTATGGAAAAGGCAAAATGATGG - Intronic
918213036 1:182368402-182368424 TTGAGGAAAAGGTGGAAGGAAGG + Intergenic
919468871 1:197954311-197954333 TTGAGGAAAAGGCAAGATGGAGG - Intergenic
921089974 1:211833019-211833041 TTGTAGTATAGGCAAGAGGAAGG - Intergenic
922020856 1:221703113-221703135 TGAAGGAAAAGGAGAGAGGAAGG + Intronic
922641730 1:227239201-227239223 TTCTGGAAAAGGCAAAAGTATGG + Intronic
923388722 1:233492221-233492243 TTGTGGGAAAGGAGTGAGGCAGG + Intergenic
923576279 1:235161534-235161556 TTGTTGAAAAGGAGGGAGGGAGG + Intronic
924124464 1:240835870-240835892 TTCTGGAAAAGGCGAAACGATGG + Intronic
924138912 1:241001722-241001744 TTGTGGAAAAGGCAAAACTATGG + Intronic
924589031 1:245385907-245385929 ATGTGGGAAAAGAGAGAGGATGG + Intronic
1062924830 10:1308221-1308243 TTCTGGAAAAGGCAAGACCATGG - Intronic
1063877859 10:10498639-10498661 ATGGGGAAGAGGCTAGAGGAAGG - Intergenic
1065229178 10:23579511-23579533 TTGAGCAAAAGGAAAGAGGAGGG + Intergenic
1066251729 10:33639671-33639693 TTTTTGAAAAGGAGAGAAGAAGG - Intergenic
1067477800 10:46578154-46578176 TTGCGGGAAAGGCGGGAGTAAGG - Intergenic
1067616937 10:47763633-47763655 TTGCGGGAAAGGCGGGAGTAAGG + Intergenic
1068752305 10:60609050-60609072 TTGAAGAAAAGGAAAGAGGAAGG + Intronic
1070731194 10:78829605-78829627 TTTTGCTAAAGGGGAGAGGAAGG + Intergenic
1071472240 10:85991851-85991873 ATGTGGAAAATGTGGGAGGAGGG + Intronic
1071502471 10:86213572-86213594 TGTGGGAAAAGGCCAGAGGAGGG - Intronic
1072044125 10:91637671-91637693 GTGAGGAAAAGGAGAGGGGAGGG + Intergenic
1072847029 10:98842906-98842928 TTCTGGAAAAGGCAAAAGTATGG - Intronic
1072985651 10:100137660-100137682 GTTTGGAAAAGGCCAGAGTATGG + Intergenic
1073076047 10:100826477-100826499 TTGAGGGAAAGGCGGGAGGGCGG + Intronic
1075695971 10:124435550-124435572 ATGTGCAAAAGAAGAGAGGATGG + Intergenic
1076091634 10:127691632-127691654 TTAGGGAAAAAGCGAGAGTAAGG - Intergenic
1077989910 11:7396946-7396968 TTGTGGAAAAGGGGAAGGGCAGG - Intronic
1078173056 11:8944464-8944486 TTGTGGAAAAGGCAAAACCATGG - Intergenic
1078197707 11:9150155-9150177 ATGTGGGAAAGGCCAGAGCATGG - Exonic
1078605440 11:12771085-12771107 TTGGGGAAAAGGAGAAGGGAAGG + Intronic
1078634367 11:13035120-13035142 ATTTGGAAAAGGAGAGGGGATGG + Intergenic
1079865824 11:25732452-25732474 TTTTGCAAAAGGTGTGAGGAAGG - Intergenic
1080391213 11:31848415-31848437 TTGTGCAAAAGGAGAAAGCAAGG - Intronic
1080890675 11:36406410-36406432 TTTTAGAGAAGGCCAGAGGATGG + Intronic
1083742062 11:64716359-64716381 CTGTGGGAAAGGCGAGGGGCAGG + Intronic
1084604098 11:70162450-70162472 GTGGGGACAAGGAGAGAGGAGGG + Intronic
1085759973 11:79233433-79233455 TTGTGGAAGAGGCAGGGGGACGG + Intronic
1087495686 11:98888076-98888098 TTTTGGAAAAGGCAAGACTATGG - Intergenic
1087528778 11:99352769-99352791 GTGTTGAAAAGGGAAGAGGAAGG + Intronic
1087682960 11:101235609-101235631 TTGTGGAGAATGCGATATGAAGG - Intergenic
1088267762 11:108003865-108003887 TTCTTGATAAGGCAAGAGGATGG - Intergenic
1089514053 11:119020346-119020368 TGGTGGAGAAGGTGGGAGGAGGG + Intronic
1090644830 11:128758873-128758895 TTGTAGAAATGGAGACAGGAGGG + Intronic
1090698230 11:129270302-129270324 TTCTGGAAAAGGCAAAAGTATGG + Intronic
1091322382 11:134660947-134660969 TTGAGGTCAAGGCGAGAGGCTGG + Intergenic
1091599678 12:1910229-1910251 TTCTGGAAAAGGCAAGACTAGGG + Intronic
1091608219 12:1976833-1976855 TTGAGGAAAGGGGGAGAGGGAGG + Intronic
1093235958 12:16608612-16608634 TTGGGGAAAAAGGAAGAGGATGG - Intronic
1093625314 12:21339742-21339764 TTGTGGAGAAGGGGAAAGCAAGG - Intronic
1094483298 12:30902371-30902393 TTGAGAAAAAGAAGAGAGGAAGG + Intergenic
1094692224 12:32781072-32781094 TTGTGGGAAAGGGGAGAGAGAGG + Intergenic
1095960339 12:47830499-47830521 TTTTGGAAGAGGAAAGAGGAAGG - Intronic
1097408575 12:59223186-59223208 TTTTGTAAAAGGTGTGAGGAAGG + Intergenic
1098357489 12:69625312-69625334 TTGTGGAAAAGGCAAAACTATGG - Intergenic
1098469398 12:70826309-70826331 TAGTGGGAAAGGTGAGAAGAGGG + Intronic
1099406454 12:82269467-82269489 TTGTGGTGAAGGTGAGAGGTAGG + Intronic
1101201043 12:102436602-102436624 TTGTGGCAAAGGAGGGTGGAAGG + Intronic
1101356110 12:103978961-103978983 TTTTTCAAAAGGCAAGAGGAGGG - Intronic
1101473365 12:105020237-105020259 TTGTGGAAATGGCTAGAGCTAGG - Exonic
1101744422 12:107527734-107527756 TTATGGAGAAGGAGAGATGAAGG - Intronic
1102373519 12:112402175-112402197 TTGTGGAAAAGGCAAAACTAAGG - Intergenic
1102631901 12:114288418-114288440 TTGGGGAGAGGGAGAGAGGAGGG + Intergenic
1102885305 12:116517363-116517385 TTCTGGAAGAGGCCAGAAGAAGG - Intergenic
1103605928 12:122086120-122086142 AGCTGGAAAAGGCGAGGGGACGG + Intronic
1103692170 12:122784100-122784122 TTGTGGAAAAGGCAAAACTATGG - Intronic
1103769114 12:123306611-123306633 AGGTGGACAAGGTGAGAGGATGG + Intronic
1105319640 13:19305968-19305990 TTCTGGAAAAGGCAAGACTATGG + Intergenic
1105580352 13:21689940-21689962 ATGTGGGAGAGGTGAGAGGAAGG - Intronic
1106320614 13:28634442-28634464 TAGTGGAAAAGGAGGAAGGAAGG + Intergenic
1107804980 13:44145267-44145289 TAGTGGGAAAGGAGTGAGGATGG + Intronic
1107976220 13:45691178-45691200 TTGGGGAAAAGGGGATGGGAAGG - Intergenic
1109662863 13:65488390-65488412 TTATGGAAAAGGCAAAAGTATGG + Intergenic
1109696494 13:65967040-65967062 TTGTTGAAGAGGCCAGATGAGGG + Intergenic
1109999704 13:70179491-70179513 TTGTGTACAAGGCAAGAGGATGG + Intergenic
1112594702 13:100797135-100797157 TTGAGGACAAGGCCTGAGGATGG - Intergenic
1113662746 13:112118236-112118258 GTGTGGTAGAGGAGAGAGGACGG + Intergenic
1113868814 13:113545880-113545902 TTGTGGAAAAGTCCAGAGGTAGG + Intronic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1115227680 14:31121271-31121293 GTGTGGAAGGGGTGAGAGGAGGG - Intronic
1115365205 14:32549962-32549984 ATGTGGATCAGGCAAGAGGAAGG + Intronic
1115573497 14:34689122-34689144 TTGAGGAAAGGAGGAGAGGACGG + Intergenic
1115881806 14:37927698-37927720 TTTTTGTAAAGGCAAGAGGAGGG - Intronic
1116063459 14:39953019-39953041 TTTTGTAAAAGGTGAAAGGAAGG - Intergenic
1116909083 14:50438778-50438800 TTGGGGAAATGGAGAAAGGAAGG - Intronic
1118341793 14:64900088-64900110 ATGTGGAGAAGTTGAGAGGAGGG - Intergenic
1121529066 14:94640013-94640035 CTGTGGAAAGGGCGAGAGCAAGG + Intergenic
1122635582 14:103128153-103128175 TAGGGGAGAAGGTGAGAGGAAGG + Intronic
1122676222 14:103416407-103416429 TTTTGGAATAGGTGAGGGGATGG + Intronic
1123181604 14:106476473-106476495 TTTTGGTAAAGACGAGAGAAAGG - Intergenic
1202945301 14_KI270726v1_random:20256-20278 TTTTGGTAAAGACGAGAGAAAGG + Intergenic
1124365412 15:29067671-29067693 TTGTGGAAAAGGCGAGAGGATGG - Intronic
1127845244 15:62865113-62865135 TGATGGTAAAGGTGAGAGGAGGG + Intergenic
1128579044 15:68796016-68796038 GTGTGGAAAAGGGGAGATGAAGG + Intronic
1130561686 15:84963926-84963948 CTGTGGAAGAGCCGAGAGGAAGG - Intergenic
1131009362 15:89004392-89004414 TTGTGTAAAACAGGAGAGGATGG - Intergenic
1131551698 15:93362868-93362890 TTGTTGAAAAGTCCAGAGGCAGG + Intergenic
1131743834 15:95423230-95423252 TTGTGGAAAAGGCGAAACTATGG + Intergenic
1133113987 16:3565548-3565570 TTCTGGAAAAGGCAAAAGTATGG + Intronic
1134586196 16:15413532-15413554 TTGTGGACAAAGAAAGAGGAAGG - Intronic
1135010852 16:18877366-18877388 TTCTGGAAAAGGCAAAACGACGG + Intronic
1135317736 16:21464951-21464973 TTCTGGAAAAGGCAAAACGATGG + Intergenic
1135370631 16:21896750-21896772 TTCTGGAAAAGGCAAAACGATGG + Intergenic
1135441155 16:22473969-22473991 TTCTGGAAAAGGCAAAACGATGG - Intergenic
1136165012 16:28447970-28447992 CTGTGGAAAGTGAGAGAGGAAGG - Intergenic
1136197955 16:28667010-28667032 CTGTGGAAAGTGGGAGAGGAAGG + Intergenic
1136214300 16:28781187-28781209 CTGTGGAAAGTGAGAGAGGAAGG + Intergenic
1136259022 16:29061032-29061054 CTGTGGAAAGTGGGAGAGGAAGG + Intergenic
1136314511 16:29444633-29444655 TTCTGGAAAAGGCAAAACGATGG + Intronic
1136327951 16:29546401-29546423 TTCTGGAAAAGGCAAAACGATGG + Intergenic
1136442638 16:30286402-30286424 TTCTGGAAAAGGCAAAACGATGG + Intergenic
1138453043 16:57105187-57105209 TAGTGGAAGTGGGGAGAGGACGG + Intronic
1139217874 16:65146873-65146895 ATGTGGAAAATGCGTGAGGCGGG - Intergenic
1139365946 16:66433759-66433781 TTGTGAAAGAGGCCACAGGATGG - Intronic
1139759318 16:69171670-69171692 CTGTGGGAGAGGGGAGAGGAGGG + Intronic
1140514732 16:75533712-75533734 CTGTGTAAAAGGAGAGAGAAAGG + Intronic
1141259492 16:82439879-82439901 TGGTGGAAAAGGAGACAGGAAGG - Intergenic
1143540373 17:7564935-7564957 TGGTGGAAAGGGAGAGAGGAGGG - Intronic
1143706031 17:8698217-8698239 TTGTGCAGGAGGCCAGAGGAAGG + Intergenic
1144051617 17:11501857-11501879 TAGTGGAAAAGGAGAGAAAAGGG + Intronic
1144082113 17:11772921-11772943 CTGTGAACAAGGCAAGAGGAAGG - Intronic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144422821 17:15113545-15113567 GTTTGAAAAAGGCCAGAGGAAGG - Intergenic
1144819036 17:18058593-18058615 CTGAGGAAAAGGCCAAAGGATGG - Intronic
1147314608 17:39613671-39613693 TTGTGCAAAAGGCAAGGGAAGGG - Intergenic
1148717257 17:49724486-49724508 TTCTGGGATATGCGAGAGGATGG + Intronic
1149029778 17:52069433-52069455 TTGTGGGTAAGGTCAGAGGAAGG + Intronic
1149394892 17:56230343-56230365 TTTTGGGGAAGGAGAGAGGAAGG + Intronic
1150878599 17:68997989-68998011 TTCTGGAAAAGGCGAAACTATGG - Intronic
1151592053 17:75051644-75051666 TGGTGGGAGAGGCAAGAGGATGG - Intronic
1152417287 17:80170843-80170865 TTCTGAAAAAGGAGAGAAGAGGG - Intronic
1153130722 18:1852909-1852931 TTGGGGTAAAGGTGAGGGGAGGG - Intergenic
1155370844 18:25098583-25098605 TTCTGGAAAAGGCAAGGGCAGGG + Intronic
1155564397 18:27117596-27117618 TTCTGGAAAAGGCAAGACCATGG - Intronic
1156229103 18:35136743-35136765 TGGGGGCAAAGGAGAGAGGAAGG - Intronic
1156548295 18:37987798-37987820 TTGAGTAAAAGCAGAGAGGATGG + Intergenic
1156774773 18:40773588-40773610 TTGTTAAAAAGGCCAGGGGAAGG - Intergenic
1157268490 18:46249761-46249783 TGGAGGAAAAGGAGATAGGATGG - Intronic
1157879901 18:51311570-51311592 TTGGGGTAAGGGAGAGAGGATGG + Intergenic
1159503334 18:69301786-69301808 CTCAGGAACAGGCGAGAGGAAGG - Intergenic
1159802805 18:72921663-72921685 TTGGGGCAGAGGCGAGGGGAGGG + Intergenic
1160073870 18:75653233-75653255 ATGGGGAAAAGGTGAGAGAAAGG - Intergenic
1160901871 19:1432795-1432817 TGGTGGGAAAGGGGAGAGGGAGG + Intronic
1164561161 19:29293194-29293216 CTGTGGAAGAGGCCACAGGAAGG + Intergenic
1164815666 19:31200512-31200534 TTCTGGAAAAGGCAAAATGATGG + Intergenic
1164884692 19:31768408-31768430 ATGTGGGAAGGGGGAGAGGAGGG + Intergenic
1164992700 19:32695975-32695997 TTGTGGAAAATGGGATACGAAGG - Intronic
1166476175 19:43126841-43126863 TCTTGGAAAGGGCGGGAGGAAGG - Intronic
1167569253 19:50276729-50276751 TTGGGGGAAAGGAGAGAGGATGG - Intronic
1168052287 19:53838439-53838461 TTGGGGAAAAGGTGGGAGTAGGG + Intergenic
925548683 2:5044959-5044981 TGGAGGAAAAGAAGAGAGGAAGG + Intergenic
926286526 2:11493163-11493185 TTGTGGAAACTGCGACATGAAGG + Intergenic
927044238 2:19261377-19261399 TTCTGGAAAAGGCGAAACTATGG + Intergenic
929308870 2:40399324-40399346 ATGTGAAAAAGGGGAGACGAGGG - Intronic
929829451 2:45335202-45335224 TTCTAGAAAATGCTAGAGGATGG + Intergenic
930380434 2:50621252-50621274 TTGTGGAGAAGGGGGGAGAAAGG + Intronic
931067831 2:58606790-58606812 CTGTGGAAAAGCAGAGGGGAAGG + Intergenic
932074554 2:68650904-68650926 GTGTGGAAAAGCCTAGAGGTGGG + Intronic
932626771 2:73302717-73302739 TTGGGGCAAAAGAGAGAGGAAGG + Intergenic
932687741 2:73887475-73887497 TTGTGGAGGAGGCGGGAGGCGGG - Intergenic
934663325 2:96154511-96154533 TAGAGGAAAAGGAGAGAGAAGGG - Intergenic
934867500 2:97826146-97826168 TTGTGGAAAATGGGATATGAAGG + Intronic
935061673 2:99614067-99614089 ATTTGGAAAAGGTGAGAGGAGGG + Intronic
935073024 2:99712483-99712505 TTGTGCCAAAGGAGTGAGGAAGG - Intronic
937284307 2:120740669-120740691 GTGTGAAAAAGGCCAGAGAATGG - Intronic
937333937 2:121049148-121049170 ATGTGGAGAAGGCCAGAGAATGG + Intergenic
938611142 2:132948775-132948797 GTGGGGAAAAGGCAAGAGAAGGG - Intronic
940128015 2:150349058-150349080 TTATGGCAATGGGGAGAGGAGGG + Intergenic
944876879 2:203971449-203971471 ATGTGGAAAAGACGAGAAAATGG - Intergenic
944892632 2:204133581-204133603 TTGTTGAAATGGGTAGAGGAAGG + Intergenic
945396560 2:209325337-209325359 GTGTGGAAATGGGGAGAGGAGGG - Intergenic
945701761 2:213179256-213179278 TTGGGGAAAGGGCAAGAGGAAGG + Intergenic
945756498 2:213853874-213853896 TTGTGGACAAAGCTTGAGGAGGG + Intronic
946762469 2:223008341-223008363 TTGTGCAAAAGGAAAGCGGAAGG + Intergenic
1169744482 20:8929529-8929551 TTTTGGAAGAGGCTAGATGAGGG - Intronic
1169964142 20:11196438-11196460 GGGTGGAAAAGGTGGGAGGAAGG + Intergenic
1169975218 20:11317994-11318016 TTGGGGAAAGGGTGGGAGGAGGG - Intergenic
1170131271 20:13022759-13022781 TTGTGGCAGAGGGGAGGGGAGGG - Intronic
1170405645 20:16032853-16032875 ATGAGGAAAAGGTAAGAGGAAGG + Intronic
1171241826 20:23575640-23575662 TTGGGGGAAGGGTGAGAGGAGGG - Intergenic
1173183027 20:40818923-40818945 GGGTGGAAGAGGAGAGAGGATGG - Intergenic
1174209153 20:48863442-48863464 TTGTGGAGAAGGAGCGGGGAGGG - Intergenic
1174911866 20:54616678-54616700 TTGTGAAAAACTGGAGAGGAAGG - Intronic
1175376131 20:58525195-58525217 GGGTGGAAAAGGCGAGTGTATGG - Intergenic
1175377586 20:58539864-58539886 TTATGGCAAAGGCTACAGGATGG - Intergenic
1177633843 21:23760720-23760742 TTCTGGAAAAGGCAAGACTAAGG + Intergenic
1178262109 21:31109106-31109128 TTTTGGTAAAGACGAGAGGAGGG - Intergenic
1178460268 21:32796261-32796283 GTGGGGAGGAGGCGAGAGGAGGG + Intronic
1178603446 21:34014877-34014899 TTCTGGAAAAGGCAAAATGATGG + Intergenic
1178895376 21:36553284-36553306 AGGTGCAAAAGGCGAGAGGAAGG + Intronic
1179081181 21:38172037-38172059 TTGGGGAAGAGGCATGAGGAGGG + Intronic
1179513622 21:41891693-41891715 AGGTGGAACAGGGGAGAGGAAGG + Intronic
1180010419 21:45046369-45046391 TTCTGGAAAAGGCAAAATGATGG + Intergenic
1181771233 22:25127288-25127310 TTGTGCAAAAGCTGGGAGGAAGG - Intronic
1182300746 22:29335584-29335606 CTGTGGAAAGGGGGAGAGGGTGG - Intronic
1182847910 22:33446694-33446716 TTGTGGTCAAGGCCAGAGTAAGG + Intronic
1183137897 22:35907382-35907404 TTGTGGAAAGGGGGAAATGATGG + Intronic
1183625699 22:39000011-39000033 TGGAGGAAATGGAGAGAGGATGG - Intergenic
1184349717 22:43935748-43935770 TGGTGAAAAATGGGAGAGGAGGG + Intronic
1184565051 22:45286854-45286876 TTGTGTAAAATGGGAAAGGAAGG - Intronic
1185017815 22:48355390-48355412 TTCTGGAAAAGGCAAAATGATGG - Intergenic
949419173 3:3846898-3846920 TTGTGGCAGAGTGGAGAGGACGG + Exonic
949982996 3:9514713-9514735 TTCTGGAAAAGGCAAAAGTATGG - Intronic
950448441 3:13051982-13052004 CTCTGGAAAAGGCTAGGGGAGGG - Intronic
953125757 3:40090378-40090400 TTGGGGAAAAGAGGAAAGGAAGG + Intronic
954733848 3:52688396-52688418 TTGGTGAAAAGGTGGGAGGAGGG - Intronic
956115830 3:65917725-65917747 TTCTGGAAAAGGCAAAACGATGG + Intronic
956937572 3:74120827-74120849 TTGCCGAAAAAGGGAGAGGAGGG + Intergenic
957566459 3:81890533-81890555 TTGTGGGAAGTGCAAGAGGAAGG + Intergenic
958112150 3:89162524-89162546 TTGAGGAGAAGGAGAGAGGTTGG - Intronic
958784052 3:98577442-98577464 TGGTGGCAAAGGGCAGAGGAAGG + Intronic
960717344 3:120589804-120589826 TTGGTGAGAAGGTGAGAGGAAGG + Intergenic
960947213 3:122974927-122974949 TTGTGGAAAAGGAGAGCTGGGGG - Intronic
961503235 3:127352117-127352139 TTGTGGGAGTGGCAAGAGGAGGG + Intergenic
961548394 3:127652214-127652236 ATGTGGAAAAGGCGAGAGATGGG + Intronic
961684350 3:128619005-128619027 TTATGGAAAAGGTGAGAAGGAGG - Intergenic
962614155 3:137107765-137107787 TTCTGGGAAAGGAGAAAGGAAGG - Intergenic
962692776 3:137917153-137917175 TTTTGTAAAAGGCGTAAGGAAGG + Intergenic
963004670 3:140715333-140715355 ATGTGGAAAAGGCTGGTGGACGG - Intergenic
963021495 3:140876459-140876481 TTGTGGAAAATGGGATACGAAGG + Intergenic
963668832 3:148226150-148226172 TTGTGGAACAGCCAACAGGATGG - Intergenic
964225603 3:154397045-154397067 TTTTGGATATGGTGAGAGGAAGG + Intronic
964660517 3:159115310-159115332 TGGTGAAAAAGGTGAGAGAATGG + Intronic
964877906 3:161390170-161390192 TAGTGGCAAAGGGGAAAGGATGG + Intergenic
965685246 3:171295553-171295575 TTGTGGAGAGGGTGAGAGGCAGG - Intronic
966961334 3:184942459-184942481 TTTTGGGGAAGGGGAGAGGAAGG - Intronic
967859330 3:194139837-194139859 CTGTGGGAAAGGCCAGAGCAGGG - Intergenic
968012898 3:195298551-195298573 TTAAGGAAAAGGAGAGAGGCTGG - Intronic
968466181 4:752568-752590 TTGTGGATAAGGAGTGAGGTGGG + Intronic
968793986 4:2689864-2689886 TGGTGGCAGATGCGAGAGGATGG - Intronic
969374534 4:6754437-6754459 GTGTGGAAAATGCCAGAGGGTGG + Intergenic
969540168 4:7783842-7783864 TTGAGGAAAAGGCGTGTGAAAGG + Intronic
970105318 4:12575992-12576014 TAGTGGAAAAGGAGAGAAAAGGG + Intergenic
971723161 4:30273266-30273288 TTTTGGATAAGGTGAAAGGAAGG + Intergenic
971938382 4:33183806-33183828 TTGTGGTACAGGCTTGAGGAAGG - Intergenic
972555143 4:40174080-40174102 TTGTCAAAAAGACGAGAGGCTGG + Intergenic
972753173 4:42013714-42013736 TTTTGTAAATGGCGAGAGAAGGG - Intronic
972886569 4:43498583-43498605 TTGTGGAAAAGGCAAAACTATGG - Intergenic
975524987 4:75339243-75339265 TGGAAGAAAAGGAGAGAGGAGGG - Intergenic
977969887 4:103200950-103200972 TTGTGGCAATGGAGAGAGGTAGG + Intergenic
977992973 4:103466843-103466865 TTGAGGGAAAGGAGAAAGGAAGG + Intergenic
978003204 4:103582461-103582483 TAGTGCTAAAGGAGAGAGGAAGG - Intergenic
978311667 4:107391206-107391228 TTGTGGAAGACGGGAGAGGGAGG + Intergenic
978346108 4:107771857-107771879 TTCTGGAAAAGGCAAAAGTAAGG + Intergenic
978450951 4:108833054-108833076 TTGAGGAAGAGGTGACAGGAAGG - Intronic
978525750 4:109663474-109663496 TTGTGGAAGGGGAGAGAGGCAGG - Intronic
980874331 4:138645760-138645782 CTGTGGAAAAGGTGAGAAGCAGG + Intergenic
980952927 4:139399566-139399588 TTGTGAAAAATGTGAGAGAAAGG - Intronic
981013493 4:139950502-139950524 CTGTGAAAAAGGTGATAGGAGGG - Intronic
982343862 4:154334213-154334235 TTGAGGGAAGGGAGAGAGGAAGG + Intronic
982460201 4:155660448-155660470 TTGTAGAAAAGGAGGGAAGAAGG - Intergenic
983690574 4:170464842-170464864 TTGTGGCAAGGGAGACAGGAAGG + Intergenic
986236565 5:5915999-5916021 TGCTGGAAAAGTCGAGGGGATGG - Intergenic
986485625 5:8233380-8233402 TTATGGAAAATGCGGGAAGAAGG + Intergenic
986616544 5:9623296-9623318 GTTTGGAACAGGCTAGAGGAAGG - Intergenic
986857455 5:11887324-11887346 TTTTGGCAAAGGTGAGGGGAAGG - Intronic
987441335 5:17960761-17960783 TTTTAGAGAAGGTGAGAGGAAGG + Intergenic
987955249 5:24730211-24730233 TTGTTGAAAGGGCGGGGGGAGGG + Intergenic
989165858 5:38433084-38433106 TTGTGGAAAAGACTTGATGAAGG - Intronic
990094553 5:52095604-52095626 TTCTGGAAAAGGCGAAACTATGG - Intergenic
991095390 5:62734455-62734477 TTGGGCAAAAAGCGGGAGGAGGG - Intergenic
991336392 5:65552605-65552627 TGGTAGAAAAGGAGAGGGGAAGG - Intronic
991667169 5:69011036-69011058 TAGGGGAAAATGGGAGAGGATGG + Intergenic
992290662 5:75276069-75276091 TTGTGGAAAAGAGCAAAGGAGGG + Intergenic
992305480 5:75432868-75432890 TTTTGTACAAGGTGAGAGGAAGG + Intronic
992781119 5:80128857-80128879 TTGTGGAAGAGAGGAGAGGGAGG - Intronic
992861302 5:80913175-80913197 TTCTGGAAAAGGCAAAAGGGAGG + Intergenic
993214107 5:84997461-84997483 TTGTGAAAAAAGCTAGAGGCCGG + Intergenic
994042009 5:95269548-95269570 TTGGAGAGAAGGCTAGAGGAAGG - Intronic
994786007 5:104164240-104164262 TTGCAGAAAAGTTGAGAGGAAGG - Intergenic
995502700 5:112825255-112825277 TTGTAGAACAGGAGAGACGATGG - Intronic
996580029 5:125021563-125021585 TTCTGGAAAAGGCGAAACTATGG + Intergenic
996698351 5:126423375-126423397 CTGTGGAAAAGCCGAGAGGGAGG - Intronic
996809360 5:127497857-127497879 TTCTGGAAAAGGCGAAACTATGG + Intergenic
997893953 5:137699292-137699314 TTGGTGAAATGGCGAGAGGTTGG + Intronic
998458029 5:142288847-142288869 TTGTGGAGAAGGAGGGAGGCTGG - Intergenic
998662025 5:144249417-144249439 TTGTGGGAGAGGGGAGGGGAAGG - Intronic
1001272472 5:170325162-170325184 TTGTGGAGAAGGCAATATGATGG + Intergenic
1001364397 5:171122410-171122432 TTGTGGAGGAGGCGAGTGTAGGG - Intronic
1001381858 5:171310803-171310825 TTGTTGAAAATCCGAGAGGGCGG - Intronic
1001484613 5:172110826-172110848 TCGTGGCAAAAGCGAGAAGATGG + Intronic
1001813424 5:174648011-174648033 TTGTGGCTGAGGCGAGAGGCAGG + Intergenic
1004976768 6:20976081-20976103 TTCTGGAAAAGGCGAAACTATGG - Intronic
1006304721 6:33212023-33212045 TGGTAGAAGAGGGGAGAGGAGGG + Intronic
1006878431 6:37318329-37318351 TTATGGAGAAGGCTACAGGATGG + Intronic
1007375129 6:41451334-41451356 CTGTGGAAAAGGCAGGAGGGAGG - Intergenic
1007437228 6:41823493-41823515 TTATGGAAAAGATGTGAGGAGGG - Intronic
1008875987 6:56328545-56328567 TTGTGGAAAATGTGACAGGCAGG - Intronic
1009407349 6:63328195-63328217 TTGTGGAAAATGGGATATGAAGG - Intergenic
1011371250 6:86639139-86639161 TTGTGTAAAAGCCAAGAGAAAGG - Intergenic
1011627105 6:89291559-89291581 GTGAGGAAAAGGCAAGAAGAAGG - Intronic
1011880335 6:92016046-92016068 TTCTGGAAAAGGCAAAAGTATGG - Intergenic
1012441182 6:99263782-99263804 TTGTGGAAAATGGGATATGAAGG - Intergenic
1012545555 6:100415069-100415091 CTAGGGAAAAGGCAAGAGGAGGG + Intronic
1012781250 6:103560393-103560415 TTCTGGAAAAGGCAAGACTATGG - Intergenic
1013003840 6:106051767-106051789 TTTTTGAAAAGGTGAGTGGATGG + Intergenic
1013088600 6:106877695-106877717 TTGTGGAAAAGGCCAAATTATGG - Intergenic
1013352870 6:109321448-109321470 TTCTGGAAAAGGCGAAACTATGG + Intergenic
1014233023 6:118925100-118925122 AGGGGGAAAAGGGGAGAGGAGGG + Intronic
1014596295 6:123344481-123344503 TTCTGGAAAAGGCAAAAGTATGG - Intronic
1014853238 6:126367468-126367490 TGGTGGAAAAGGATAAAGGAGGG + Intergenic
1014929991 6:127324577-127324599 TTATGGAAAATGGTAGAGGATGG - Intronic
1015014254 6:128391288-128391310 TGGTGGTAATGGGGAGAGGAAGG - Intronic
1015636342 6:135278733-135278755 TGGTGGGGAGGGCGAGAGGAGGG + Intergenic
1015738242 6:136424457-136424479 TTGAGGTAAAGACAAGAGGAAGG + Intronic
1016820740 6:148343494-148343516 GTGTGGAAAAGGCGAGAAAGAGG + Intronic
1017235208 6:152111515-152111537 TTGTGGGAAAGGCCAGTGAAAGG + Intronic
1017534623 6:155333540-155333562 ATGTGGAAAAGGTCAGGGGAAGG + Intergenic
1017652021 6:156592648-156592670 TTCTGGAAAAGGCAACATGAGGG + Intergenic
1017990873 6:159488865-159488887 TTCAGGAAAAGGGGAGATGAAGG - Intergenic
1020347011 7:7176178-7176200 TTGTGGAAAAAGGTCGAGGAAGG + Intronic
1021044027 7:15900276-15900298 TTGTGGAAAAGGCAAAACTATGG + Intergenic
1021086408 7:16425202-16425224 TTCTGGAAAAGGCAAAAGCATGG - Intergenic
1022055848 7:26733634-26733656 TTGTGGAGAAGGGGAGAGCAGGG + Intronic
1022096680 7:27145585-27145607 TTGGGGAACAGGCGAGGGCAAGG + Exonic
1022809762 7:33857318-33857340 TTGAGGAAAAGGAAACAGGAGGG + Intergenic
1022873293 7:34502062-34502084 TTATGAAGAAGGCTAGAGGATGG + Intergenic
1023245806 7:38202470-38202492 GTGTGAAAAAGGCCAAAGGAGGG + Intronic
1024037823 7:45523743-45523765 TTGTGGAGAAAGGGAGATGAAGG + Intergenic
1024062032 7:45704985-45705007 CTGTGGAAAAGGAGAGTGCAAGG - Intronic
1024412685 7:49064065-49064087 TTGTAGAAAAGCCCAGAGGAAGG + Intergenic
1025147289 7:56515747-56515769 TTGTGGAGAGGCCGAGAGGGAGG - Intergenic
1027430018 7:78102202-78102224 TTGGGGAAAAGGGGAGATAATGG + Intronic
1027789370 7:82619887-82619909 TTGAGGAGAAGGCTAGAGAAAGG + Intergenic
1028162021 7:87496797-87496819 TTCTGGAAAAGGCAAGACTATGG - Intergenic
1030098772 7:105925858-105925880 TTCTGGAAAAGGCAAAACGATGG - Intronic
1031255658 7:119444653-119444675 TTTTGTAAAAGGTGAAAGGAAGG + Intergenic
1031329787 7:120450450-120450472 GAGTGGAAAAGGAGAGGGGATGG + Intronic
1031376799 7:121036270-121036292 TTGGGGAAAAGGCTGGGGGATGG - Intronic
1031732137 7:125312900-125312922 TTGTGGAAAACGAGATATGAAGG + Intergenic
1031969286 7:128052452-128052474 ATGGGGAAAAGGAGACAGGATGG - Intronic
1032504529 7:132425414-132425436 TGGTGGGAAAGGGGAGGGGAAGG + Intronic
1033160841 7:138995408-138995430 TGGTGGAGAAGGGGAAAGGATGG - Intergenic
1034541629 7:151762194-151762216 GTGGGGAGAAGACGAGAGGAAGG + Intronic
1039999329 8:42563096-42563118 TTGTGGAAAATGGGATATGAAGG - Intergenic
1040532187 8:48275116-48275138 GTGTGGAATAGGGGAGAGGAGGG + Intergenic
1040807657 8:51411326-51411348 TTGTGGAAATGGCAAGAGCAGGG - Exonic
1040999756 8:53438940-53438962 TTGTGGAGAATGAGAAAGGAAGG - Intergenic
1042205832 8:66328863-66328885 GTGTGGAGAACGCAAGAGGAAGG - Intergenic
1042346282 8:67731384-67731406 TTGTGGAAGAAGTGAGAGGATGG - Intronic
1044065870 8:87699643-87699665 GGGTGGAAAAGGGGAGTGGATGG - Intergenic
1044820721 8:96154147-96154169 TTGGGGAGAAGGACAGAGGACGG - Intronic
1046594518 8:116246133-116246155 TTCTGGAAAAGGCAATATGAAGG + Intergenic
1047063637 8:121255426-121255448 TGCTGGAAAAGGCGAGTGAATGG + Intergenic
1047309909 8:123683241-123683263 TTGTGGAGGAGGAGAAAGGAGGG + Intronic
1048748504 8:137643585-137643607 ATGTTGAAAAGGAGTGAGGAAGG + Intergenic
1049493745 8:142918554-142918576 TTTTGGAAAAGGCCAAAGCATGG - Intergenic
1050965651 9:11798086-11798108 TTCTGGAAAAGGCGACACTATGG + Intergenic
1053578524 9:39378396-39378418 TTGTAGAAAAAGTGAGAGAAAGG - Intergenic
1053843048 9:42206475-42206497 TTGTAGAAAAAGTGAGAGAAAGG - Intergenic
1054100108 9:60937201-60937223 TTGTAGAAAAAGTGAGAGAAAGG - Intergenic
1054121505 9:61212828-61212850 TTGTAGAAAAAGTGAGAGAAAGG - Intergenic
1054586237 9:66969684-66969706 TTGTAGAAAAAGTGAGAGAAAGG + Intergenic
1055494113 9:76837562-76837584 ATGTGGAAAAGGATAGAGCAGGG + Intronic
1056530655 9:87484321-87484343 TTGTGGAAAAGGCAAAACTATGG + Intergenic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1058429890 9:104908821-104908843 TTCTGGAAAAGGTGAAATGAAGG + Intronic
1059438919 9:114291860-114291882 TTGTGGGAGAGGAGAGGGGAAGG + Intronic
1059756045 9:117294403-117294425 TTGTTGAAGAGGAGAGAGGAGGG + Intronic
1059759709 9:117326381-117326403 TTGTGAAAAATGGGAGAGTAAGG - Intronic
1059766722 9:117390548-117390570 TTCTGGAAAAGGCAAGACTATGG - Intronic
1061207602 9:129173891-129173913 CTGTGGTAAAGGAGAGTGGATGG - Intergenic
1061786231 9:133030315-133030337 ATGTGGAAAAGGCGAGCGCGGGG - Intergenic
1061905732 9:133695965-133695987 TTCTGGAAGAGTAGAGAGGAAGG + Intronic
1186280217 X:7985037-7985059 TTATGGAAAAGGCAAAAGTATGG + Intergenic
1186353179 X:8760959-8760981 TTATGGAAAAGGCAAAAGTATGG - Intergenic
1186534154 X:10329788-10329810 TTATGGCAAAGGTGATAGGAGGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187323146 X:18259459-18259481 TTGTGGCAACAGCCAGAGGAAGG + Intronic
1187595262 X:20764766-20764788 TGGGGGAAAAGTGGAGAGGATGG - Intergenic
1187839313 X:23470555-23470577 TTGAGGAAAAGGAGAGAGACAGG - Intergenic
1188310485 X:28611113-28611135 TTGTGGAGAAGGGAAGAGGTTGG + Intronic
1188444324 X:30240675-30240697 TTCTGGAAAAGGCAAAAGTATGG - Intergenic
1189324499 X:40104762-40104784 TTCGGGGAAGGGCGAGAGGAGGG - Intronic
1190144647 X:47879277-47879299 TTCTGGAAAAGGAAAGATGAGGG - Intronic
1190410201 X:50129530-50129552 CTGTGGAAAAGACCAGAGGCAGG + Intergenic
1190456563 X:50633757-50633779 GTCTGCAAAAGGCAAGAGGATGG + Exonic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191898662 X:66019397-66019419 ATGTGGAAAAGGGGAGAGGTAGG - Intergenic
1192097812 X:68231732-68231754 TTTTGGAAAAGGCAAAAGTATGG + Intronic
1192248441 X:69391698-69391720 ATGTGGAAGAGGGGAGAGCAGGG - Intergenic
1198134696 X:133737141-133737163 TTCTGGAAAAGGCAAAAGCATGG + Intronic
1201515662 Y:14816686-14816708 TTGTGGAGAATGGGAGATGAAGG - Intronic