ID: 1124370592

View in Genome Browser
Species Human (GRCh38)
Location 15:29102838-29102860
Sequence GGGACCTGGGCAATAGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 317}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124370582_1124370592 18 Left 1124370582 15:29102797-29102819 CCAGGGCGTTCTTTTTCACATAA 0: 1
1: 0
2: 1
3: 8
4: 109
Right 1124370592 15:29102838-29102860 GGGACCTGGGCAATAGGGAAGGG 0: 1
1: 0
2: 2
3: 30
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124370592 Original CRISPR GGGACCTGGGCAATAGGGAA GGG Intronic
900318093 1:2069357-2069379 GGGTCCTGGGCAAGGGGGCATGG + Intronic
900497569 1:2982939-2982961 GGGCCCTGGGGACTAGGGGAAGG + Intergenic
900886859 1:5421322-5421344 TGGATGTGGGAAATAGGGAAGGG - Intergenic
902055899 1:13600174-13600196 GGCACCTGGGCAGAAGGGGAAGG + Intronic
903378964 1:22883916-22883938 GGGGCCAGGGCACAAGGGAAAGG - Intronic
903557137 1:24202313-24202335 GGGGCCTGGACAAGAAGGAAAGG - Intergenic
903639524 1:24848752-24848774 GCCACCTGGGCACTAGGAAAAGG + Intergenic
905451164 1:38057511-38057533 GGGGCCTGAGGTATAGGGAAAGG + Intergenic
905684578 1:39899793-39899815 GGGAACTGGGGAATGGGGTATGG - Intronic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
906205880 1:43986042-43986064 GGGACCTGAGCAGTATGGGAAGG + Intronic
906803716 1:48759589-48759611 GGGGCCTGGGGAGTTGGGAAGGG - Intronic
907585860 1:55617289-55617311 GGGACTTGGCCAATATGTAAAGG - Intergenic
909549139 1:76878526-76878548 GGTACCTGTGCACTGGGGAAAGG - Intronic
912125119 1:106526910-106526932 GGGAGCTAGGGAATGGGGAATGG - Intergenic
912319088 1:108693126-108693148 GGGAGTTGGGCAAGAGGGATGGG + Intronic
912776195 1:112507997-112508019 GGGGCGTGGTAAATAGGGAAGGG - Intronic
912955343 1:114151721-114151743 GGGAGCTGGGGAGTAGGGAGAGG + Intronic
912955804 1:114153535-114153557 GGGACCGGGGCTTTGGGGAAGGG + Intronic
913026049 1:114841649-114841671 GGGACTTTTGCAATAGGGCAAGG + Intergenic
914247677 1:145897896-145897918 GGGACCTGGAAGAAAGGGAAGGG + Exonic
915269971 1:154747003-154747025 GGGACCTGGGCAGCAGGGAGAGG - Intronic
915560126 1:156682267-156682289 GGCACCTGGGAAGCAGGGAAAGG + Intergenic
918007905 1:180559197-180559219 TGGAACTGGGCAACAGGCAAAGG + Intergenic
918736952 1:188076657-188076679 GGGACTGGGGCGATAGAGAAAGG - Intergenic
918935202 1:190912824-190912846 TGGACCTGGGTAACAGGGAGAGG - Intergenic
919041085 1:192389448-192389470 GGTACCTGGGCAATAGTTGAGGG - Intergenic
919779974 1:201215475-201215497 GGCACCTGGGGAATATAGAAAGG - Intronic
920599800 1:207312550-207312572 GGGAGCTAGGGAATGGGGAATGG - Intergenic
921314797 1:213880255-213880277 TGGACCTGGGTGATGGGGAAAGG + Intergenic
921577487 1:216853689-216853711 GGCACTTGGGGAATAAGGAATGG - Intronic
921671376 1:217927447-217927469 GGGACCAGGACAATAGTGATGGG + Intergenic
921826521 1:219678196-219678218 GGGTCCTGGGCCATAGTGGATGG + Intergenic
922198717 1:223382793-223382815 GGGACCTGTGCTATAGGAAAAGG + Intergenic
922900688 1:229134233-229134255 TGGAACTGGGCAATAGGCAGAGG + Intergenic
923032367 1:230259608-230259630 GGGAGCTGGGGACTAGGGAGTGG + Intronic
923523310 1:234752809-234752831 GGGAGGTGGGAAGTAGGGAACGG + Intergenic
1062864762 10:842780-842802 TGGACCTGGGCAGAAAGGAACGG + Intronic
1063607150 10:7532859-7532881 GGGACCTGGGCAAAGGGCAAGGG - Intergenic
1065071419 10:22028224-22028246 GGGACCTGGACAATAGTTCAAGG - Intergenic
1065916423 10:30357824-30357846 GGTACCTGGGAGAGAGGGAAGGG - Intronic
1069742047 10:70690996-70691018 GGCTCCTGGGCACTCGGGAATGG + Intronic
1069871602 10:71536377-71536399 AGGCCCTGGGCAAGAGGGAGGGG + Intronic
1070353083 10:75611949-75611971 GGGAACTGGGGAATAGGAGAAGG - Intronic
1073724680 10:106216239-106216261 GGGAGCTGGGCTATAGGGAAAGG - Intergenic
1074967898 10:118508448-118508470 TGGACCTGAGCTGTAGGGAATGG - Intergenic
1075938082 10:126360734-126360756 TGGAACTGGGCAACAGGCAAAGG - Intronic
1076392058 10:130110671-130110693 GGGGCCTGGGCGTTAGGGACGGG - Intergenic
1078110500 11:8388154-8388176 TGGCACTGGGCAACAGGGAAGGG + Intergenic
1078175536 11:8967049-8967071 GGGACCAGGGAAAAGGGGAATGG + Intergenic
1078508065 11:11966652-11966674 GGAACCTGGGAAATAAGGAGTGG + Intronic
1079101027 11:17542560-17542582 GGGACCTGGGGAAGAGGAACAGG + Intronic
1079568696 11:21915839-21915861 TGGAACTGGGTAACAGGGAAAGG + Intergenic
1079945055 11:26731878-26731900 TGGAACTGGGCAATAGGCAGAGG + Intergenic
1080272579 11:30466570-30466592 GGGAGCAGGGCAATGAGGAATGG + Intronic
1081199860 11:40202734-40202756 GGGATCTGTGCAATAAGGGAAGG + Intronic
1081646332 11:44793017-44793039 GGGAGCTGGGAAAATGGGAAGGG + Intronic
1084204381 11:67583589-67583611 GGGACCTGGGAAAGAGGGAAAGG + Exonic
1084583176 11:70037247-70037269 GGGACCTGGGCAATACTCAGTGG + Intergenic
1084642790 11:70435808-70435830 GTGACCTGGGCATCAGGGGATGG - Intronic
1085151281 11:74254482-74254504 CGTGCCTGGGCAATAGGGACAGG - Exonic
1086212756 11:84340874-84340896 GAGAGATGGGAAATAGGGAATGG + Intronic
1086451365 11:86920117-86920139 GGGACCTGGGCAACAGCTCAAGG + Intronic
1089418317 11:118312354-118312376 GGGACATGGGGACTTGGGAAGGG - Intronic
1089508234 11:118979229-118979251 GGGACTTGGGCAGTAGGCGAGGG + Intronic
1094201275 12:27797021-27797043 GGGACATGGGAAATGGGAAAAGG + Intronic
1096210084 12:49758487-49758509 GTGAACTGGGAAACAGGGAATGG + Intronic
1097081182 12:56432340-56432362 GGGACTCGGGCAATAGGCCAGGG + Intronic
1097853606 12:64438439-64438461 GGGATCTGGGAAACAGTGAAGGG + Intronic
1098284661 12:68895137-68895159 ATGACCTGGGCCTTAGGGAATGG - Intronic
1099228632 12:79997719-79997741 GGGACAAGGGCAATTGTGAAAGG - Intergenic
1100660126 12:96687786-96687808 TGGAGCTTGGCAATTGGGAATGG + Intronic
1101534861 12:105607480-105607502 GGTAACTGGGCACTGGGGAAAGG - Intergenic
1102322474 12:111949082-111949104 CCAACCTGGGCAATAGGGCAAGG + Intronic
1102471897 12:113164020-113164042 TGGACCTGGGGTATGGGGAAGGG - Intronic
1103037460 12:117667895-117667917 GGGAGCTGGGCAAAAAAGAATGG - Intronic
1103862307 12:124024997-124025019 GGTATCTGGGCCTTAGGGAATGG + Intronic
1105958704 13:25308665-25308687 GGGAAAAGGGCAATAGGTAAAGG + Intronic
1108933870 13:55863712-55863734 TGGAACTGGGTAATAGGGAGAGG + Intergenic
1112011110 13:95294598-95294620 GAGACCTGGCCAATAGGAAGTGG - Intronic
1113914011 13:113860414-113860436 AGGACCTGGGCAGTAGGGCTGGG + Intronic
1114550443 14:23529845-23529867 GGGAGTTGGGCACTAGAGAAAGG + Intronic
1116396726 14:44455538-44455560 GGGACCTAGGCAATGGATAAAGG - Intergenic
1116692548 14:48128293-48128315 GGGCCATGGGAAATAGAGAAAGG - Intergenic
1116991390 14:51280741-51280763 GGGAACAGGGCAGAAGGGAATGG - Intergenic
1117216642 14:53558718-53558740 GGTAACTGTGCAATGGGGAAAGG + Intergenic
1117725333 14:58667734-58667756 GGGGCCTGGGCTACTGGGAAGGG + Intergenic
1119466615 14:74863451-74863473 GGGACCAGGGCAACAGGAAGGGG - Exonic
1119759784 14:77142018-77142040 GGGACCTAGCCGAGAGGGAAGGG - Intronic
1119771390 14:77222270-77222292 GGGACCTGGGTAAGAGGGAGAGG - Intronic
1120973479 14:90229082-90229104 GGTAACTGTGCATTAGGGAAAGG + Intergenic
1121211671 14:92212003-92212025 GGGCCCTGACCAATAGGGGAGGG - Intergenic
1122587399 14:102818611-102818633 GGGAGCGGGGGAATGGGGAAAGG - Intronic
1202903492 14_GL000194v1_random:55982-56004 GGGCGCTGGGTACTAGGGAAGGG - Intergenic
1123794572 15:23758498-23758520 GGGATCTGGGCAAAAAGAAATGG + Intergenic
1124370592 15:29102838-29102860 GGGACCTGGGCAATAGGGAAGGG + Intronic
1128382104 15:67120677-67120699 TGGGCCTGGGAAATTGGGAAGGG + Intronic
1129035906 15:72648255-72648277 GGGGGCTGGGTAACAGGGAACGG - Intergenic
1129120568 15:73393972-73393994 GGGACCAGGGCTACAGGGGAAGG + Intergenic
1129213979 15:74088961-74088983 GGGGGCTGGGTAACAGGGAACGG + Intergenic
1129391444 15:75222969-75222991 GGGGGCTGGGTAACAGGGAAAGG - Intergenic
1129400033 15:75276402-75276424 GGGGGCTGGGTAACAGGGAACGG - Intronic
1129472860 15:75764887-75764909 GGGGGCTGGGTAACAGGGAACGG + Intergenic
1129731114 15:77933306-77933328 GGGGGCTGGGTAACAGGGAACGG + Intergenic
1130468137 15:84203086-84203108 GGTACCTGGGAAGGAGGGAAGGG - Intergenic
1130590430 15:85207684-85207706 GGTACCTGGGAAGGAGGGAAGGG - Intergenic
1131348800 15:91677330-91677352 GTGACCAGGGGAATAGGGAGAGG - Intergenic
1132128401 15:99251363-99251385 GGGAGCTGGGGAAGAGGGAGCGG - Exonic
1132213263 15:100042118-100042140 TGCACCTGGGCAACAGGGTAAGG - Intronic
1132246512 15:100300363-100300385 GGGTCCTTGGCATTTGGGAAGGG - Intronic
1132583614 16:696281-696303 GGGACCTGGGCAACAGAGTAAGG - Intronic
1132984729 16:2759334-2759356 GAGACCTGGGAAATAAGGAAAGG - Exonic
1133080385 16:3314450-3314472 GGGTCTTGGGCAGCAGGGAAAGG - Intronic
1133630184 16:7613013-7613035 GAGACGTGATCAATAGGGAAAGG + Intronic
1134326563 16:13213106-13213128 GGGACCCAGGGAACAGGGAAGGG - Intronic
1134885374 16:17786062-17786084 GGGACCAGAGCAATGGGGGATGG - Intergenic
1135298184 16:21301350-21301372 GGGACTTGGGGCATAGGGTAGGG + Intronic
1135304362 16:21355792-21355814 GGGTCGTGGGCTACAGGGAAAGG - Intergenic
1135588985 16:23691896-23691918 GGGTCCTGGGCAATAAGAAATGG - Intronic
1136030688 16:27500583-27500605 GGCACCAGGGCCAAAGGGAATGG - Intronic
1136422951 16:30148037-30148059 GGGACTTGGGGAGTAGGGAGGGG - Intergenic
1136501198 16:30670322-30670344 GGGACCTGGGCTGGAGGGAAGGG + Exonic
1138141591 16:54573300-54573322 GGGACCTGCACAATAGGGAGTGG + Intergenic
1139795929 16:69482763-69482785 GGGACCTGGGCTTAAGGGATGGG + Intergenic
1142239945 16:88940590-88940612 GGGACCCGGGCAGGAGGGAGAGG + Intronic
1142605695 17:1079926-1079948 GGGGCGTGGGCAAGAAGGAAGGG + Intronic
1146491471 17:33286289-33286311 GGGGGTTGGGCAATAGTGAAGGG + Intronic
1150410737 17:64938915-64938937 GTGCCCTGGGCAAAAGGCAAAGG - Intergenic
1151192612 17:72409366-72409388 GGGAGCTGGGCAAAAGGGGTGGG + Intergenic
1151722614 17:75866144-75866166 AGGGGCTGGGCAACAGGGAATGG - Intergenic
1152134610 17:78496541-78496563 GGGAAGGGGGCAAGAGGGAAGGG - Intronic
1154404322 18:14074804-14074826 TGGAACTGGGTAACAGGGAAAGG - Intronic
1156620204 18:38842688-38842710 GGAGGCTGGGCACTAGGGAATGG - Intergenic
1157190932 18:45581035-45581057 GAGACCAGGGCCATGGGGAAGGG + Intronic
1157439326 18:47697880-47697902 AGGACCTGGGCAATGGAGAGGGG - Intergenic
1158127806 18:54121438-54121460 GGGAGGTGAGCAACAGGGAAAGG - Intergenic
1161198441 19:3000548-3000570 GGGACCTGGGGGACAGGGACAGG + Intronic
1161261566 19:3340625-3340647 TGGCCCTGCGCAGTAGGGAAAGG - Intergenic
1161486254 19:4537402-4537424 GAGATCTGGGAAACAGGGAACGG + Exonic
1161759566 19:6161304-6161326 GGGAGGTGGGCACTGGGGAAAGG + Intronic
1162183220 19:8885130-8885152 TGGAGCTGGGCCAGAGGGAAAGG + Intronic
1162184100 19:8891332-8891354 TGGAGCTGGGCCAGAGGGAAAGG + Intronic
1162783493 19:13019979-13020001 AGGACATGGGAAATGGGGAAAGG - Intronic
1162940634 19:14006929-14006951 GGGCCATGGGCAGTGGGGAAGGG - Intronic
1164506779 19:28867465-28867487 AGGACCAGGGCAAAAAGGAAGGG - Intergenic
1165687764 19:37837072-37837094 GGGAATTGGGAAAGAGGGAAGGG + Intergenic
1166352830 19:42208313-42208335 GTGACCTAGGAAATAAGGAAGGG - Intronic
1166784548 19:45359712-45359734 GGGACCTGAGCAGGAGGGGAGGG - Intronic
1166825680 19:45607502-45607524 AGAACCTGGGCAATGGGGAAGGG + Intronic
1167359309 19:49021485-49021507 GGGAGATGGGTAATAGGTAAAGG + Intergenic
1167565943 19:50257225-50257247 GGGACCTGGGCCAAAGGTCAAGG - Intronic
1167715570 19:51140988-51141010 GGGGCATGGCCAATAGGAAAGGG + Intergenic
1167959526 19:53095047-53095069 GGGGCCTGGGCAGTGGGGAAGGG - Intronic
1167959574 19:53095168-53095190 GGGGCCTGGGCAGTGGGGAGGGG - Intronic
1167959595 19:53095231-53095253 GGGGTCTGGGCAATGGGAAAGGG - Intronic
1168374692 19:55866865-55866887 GGGACATGGGGACTTGGGAATGG + Intronic
926039833 2:9664203-9664225 GGCAGCTGGGCAAGAGGGCAGGG - Intergenic
926521109 2:13915103-13915125 GGGCCATGGGGAAGAGGGAATGG + Intergenic
926887070 2:17607616-17607638 GGGACCTGTGCTATAGGGACAGG - Intronic
927263658 2:21120289-21120311 GGAAACTGGGCAACAGTGAAAGG + Intergenic
927775358 2:25898759-25898781 GGGACCTGGGGAAGAGGGGCTGG + Intergenic
927847697 2:26479930-26479952 GGGACCTGGGGCAGAGGGCAGGG - Intronic
928322612 2:30295507-30295529 TGACCCTGGCCAATAGGGAAAGG - Intronic
928594161 2:32844679-32844701 TGGAACTGGGCAATGGGGAGAGG + Intergenic
928874681 2:36024195-36024217 GGGACGTGGGGAATAAAGAAGGG + Intergenic
930214511 2:48680834-48680856 GGGTCCTGGGCAATGTGGATGGG + Intronic
930368761 2:50477417-50477439 TGAACCTGGGCCTTAGGGAACGG + Intronic
930701158 2:54457953-54457975 GGGACCTGAGCCATAGGGAGGGG + Intronic
933596963 2:84291923-84291945 GGGCCCTGGGCATTAGGGGTTGG - Intergenic
934503173 2:94874440-94874462 GGGCGCTGGGTACTAGGGAAGGG + Intronic
935405712 2:102707106-102707128 GGGAGCTGGGCAAGGGGCAAGGG + Intronic
935626080 2:105173346-105173368 TGGACCTGGGTAACAGGCAAAGG - Intergenic
936009610 2:108917020-108917042 CGGAGCTCGGCAATAAGGAATGG + Intronic
936076633 2:109405552-109405574 GGGACATGGGCAGGTGGGAAGGG - Intronic
936837315 2:116723778-116723800 TGGAACTGGGCAATAGGCAAAGG - Intergenic
936897146 2:117440838-117440860 GCGACCTGGGCAACAGAGCAAGG + Intergenic
938210829 2:129464678-129464700 GGGACCTGGAGAAGAGGGCAGGG - Intergenic
940903254 2:159146225-159146247 GGGCTCTGTGCATTAGGGAAGGG + Intronic
942631380 2:177953653-177953675 AGGAGATGGGAAATAGGGAATGG - Intronic
942811589 2:180006673-180006695 GGGACCCGGGCACTAGGAAAGGG + Intronic
943324284 2:186479594-186479616 GGGAAATGGGCAATGTGGAAAGG - Intergenic
944412367 2:199457467-199457489 AGGACCTGGGGAAGAGGGAAGGG - Exonic
944942199 2:204640692-204640714 GGGACCTGGGCAAGAAGAGATGG - Intronic
945724763 2:213462909-213462931 TGGAACTGGGTAATAGGCAAAGG + Intronic
946311163 2:218883442-218883464 GGGTCCTGGTGAAAAGGGAAGGG - Intronic
946333666 2:219023975-219023997 GGGACCTGGGTCCTTGGGAATGG - Intronic
948436581 2:237957841-237957863 GGGCCCTGGGGAATAGGTGATGG - Intergenic
948662372 2:239515360-239515382 GGGACCTTGGCAGGAGGGCAGGG - Intergenic
1169122062 20:3102707-3102729 GGGCCCTGGGCCCAAGGGAAGGG + Intergenic
1169371794 20:5033688-5033710 GGGACCTGGGGATCAGGGAGTGG - Intergenic
1169775975 20:9253513-9253535 GGGAACAGGGCAACAGGGAAGGG - Intronic
1171333020 20:24357937-24357959 GGCACCTGGGCCTCAGGGAAGGG - Intergenic
1172522869 20:35579488-35579510 AAGACCTGGGGAACAGGGAAAGG + Intergenic
1173253143 20:41375161-41375183 GGGACCCGGGCAAAAGGAGAAGG - Intergenic
1173599012 20:44279702-44279724 GTTCCCTGGGCAAGAGGGAAGGG - Exonic
1173642677 20:44614936-44614958 GGGACCTGGGCTAGGGGGCAGGG - Intronic
1174704311 20:52640002-52640024 TGCACCTGGGCATCAGGGAAAGG - Intergenic
1174775014 20:53335357-53335379 TAGACTTGGACAATAGGGAAAGG + Intronic
1175400991 20:58699754-58699776 GGTTCCTGGGCAGTGGGGAAAGG - Intronic
1175844840 20:62052833-62052855 GGGACCTGGGATATGGGGGATGG - Intronic
1176622858 21:9070750-9070772 GGGCGCTGGGTACTAGGGAAGGG - Intergenic
1177505797 21:22015901-22015923 GGTAACTGTGCAATGGGGAAAGG - Intergenic
1178127137 21:29527657-29527679 GGGAACTGGGTAATGGGTAATGG - Intronic
1180747589 22:18101595-18101617 TGATCCTGGGCATTAGGGAAGGG - Exonic
1181573491 22:23780321-23780343 GGGGCCTGGGCCTCAGGGAAGGG - Intronic
1182297577 22:29318718-29318740 GGCCCCTGGGGAATAGGGATTGG - Intronic
1183466968 22:37984712-37984734 TGGGCCTGGGCAGTAGGGCAGGG - Intronic
1183668799 22:39260070-39260092 GTGCCCAGGGCAATTGGGAAGGG - Intergenic
950099960 3:10350573-10350595 GGGACCTGGGCAGGAGGGCAGGG + Exonic
950461687 3:13125880-13125902 GGGACCTGGCCACCTGGGAATGG + Intergenic
950832303 3:15886762-15886784 TGGAACTGGGCAATAGGTAGAGG + Intergenic
950958362 3:17079237-17079259 GGGACCAGGGCCAGAGGGGAGGG - Intronic
952743738 3:36759266-36759288 GGGGGCTGGGAAATAGGGGATGG - Intergenic
953060421 3:39423753-39423775 GGGACCCAGACAAAAGGGAATGG - Intergenic
953706450 3:45234661-45234683 GCCACCTGGGCAGCAGGGAAAGG - Intergenic
954300681 3:49699367-49699389 GGGGCCTGGGCTCTAGGGCAGGG - Intronic
954741831 3:52758238-52758260 GGGACTGGGGTAGTAGGGAATGG + Intronic
956551103 3:70460856-70460878 TGGAACTGGGTAATAGGCAAAGG + Intergenic
958018257 3:87967912-87967934 TGGAACTGGGCAACAGGCAAAGG + Intergenic
958836140 3:99147575-99147597 TGGAACTGGGCAATAGGCAGAGG + Intergenic
959086359 3:101854560-101854582 GGAACCTGGGGAACATGGAAAGG - Exonic
959596133 3:108130317-108130339 GGTAGCTTGCCAATAGGGAATGG + Intergenic
959972965 3:112427640-112427662 TGGAACTGGGTAATAGGGAGAGG + Intergenic
960537426 3:118828790-118828812 AGGACCTTCGCAATGGGGAATGG + Intergenic
961028640 3:123583804-123583826 GGGAGCTGGGTAGAAGGGAAAGG + Intronic
961222810 3:125213046-125213068 GGGACCAGGGGACTAGGGACAGG + Intergenic
961268553 3:125669946-125669968 GGAAACAGGGAAATAGGGAAAGG + Intergenic
962437153 3:135377651-135377673 AGGACCCTGGCAATAGGGAGGGG + Intergenic
964693965 3:159486300-159486322 GGGACATGGGGAAGAGGGTAGGG - Intronic
965543983 3:169896914-169896936 GGGACCTGGGGCATATGGGAAGG + Intergenic
968645347 4:1737856-1737878 GCGACCTGGGCAGTAGTGACAGG - Intronic
969120222 4:4903067-4903089 GGGAGCTGGGGGATTGGGAAGGG + Intergenic
969304455 4:6317823-6317845 GGGGCCTGGGCTGTGGGGAAAGG + Intergenic
971896719 4:32605872-32605894 GGGACTTGGGAACTAGGTAATGG - Intergenic
973800409 4:54471967-54471989 GGCACCTAGGGAAGAGGGAAAGG - Intergenic
974812072 4:66957599-66957621 TGGAACTGGGTAATAGGCAAAGG - Intergenic
975600169 4:76090905-76090927 GGGGACTGGGAAACAGGGAAAGG - Intronic
978255908 4:106692542-106692564 TGGAACTGGGAAATAGGCAAAGG + Intergenic
979055175 4:115984310-115984332 GGGACCAGGGCCATAGAGGATGG + Intergenic
979792170 4:124798538-124798560 TGGAATTGGGCAATAGGGAGAGG + Intergenic
980979215 4:139639706-139639728 GGCAACTGGGCAGTTGGGAAAGG + Intergenic
982790673 4:159587612-159587634 TGGAACTGGGTAATAGGCAAAGG - Intergenic
982847591 4:160272924-160272946 GGTAACTGTGCATTAGGGAAAGG + Intergenic
983596576 4:169474104-169474126 AGGACTTGGGAAAGAGGGAAGGG + Intronic
984931365 4:184850352-184850374 GGGACATGGGCAAGATGGAAGGG - Intergenic
985451126 4:190063297-190063319 GGGACCTTAGCAATGGGCAAGGG - Intergenic
987504219 5:18748478-18748500 GGTAGCTGTGCAATGGGGAAAGG + Intergenic
989306281 5:39960365-39960387 TGGACCTGGGCAATATGTGAAGG + Intergenic
989457830 5:41663155-41663177 GGTAACTGTGCACTAGGGAAAGG - Intergenic
990281001 5:54250648-54250670 GGGACATGGGTAGTAGGGACGGG + Intronic
992995089 5:82324623-82324645 AGGAACCGGGGAATAGGGAAAGG + Intronic
994183463 5:96793484-96793506 GGAACCTGGTCACTATGGAATGG - Exonic
995241243 5:109887201-109887223 GGGACCTGGGAAGGAGGGCAGGG - Intergenic
996255785 5:121401819-121401841 TGGAACTGGGCAACAGGCAAAGG + Intergenic
996908872 5:128633406-128633428 GGTAACTGTGCATTAGGGAAAGG - Intronic
997591672 5:135076990-135077012 GGGACCGTGGCAGTAAGGAATGG - Intronic
997977060 5:138446723-138446745 GGACCCTGGGCAAGAGGGGATGG - Exonic
998535337 5:142925206-142925228 GGGAGGTGGGCAACAGGGCATGG - Intronic
1000768428 5:165319873-165319895 TGGAACTGGGCAATAGGCAGAGG - Intergenic
1001047451 5:168385674-168385696 GGGACTAGGGGAATTGGGAATGG + Intronic
1001169585 5:169406303-169406325 GGGTACTGGGGGATAGGGAAAGG - Intergenic
1002329456 5:178431407-178431429 GGGTTCTGGGGATTAGGGAAGGG - Intronic
1002523319 5:179803141-179803163 TGGACCTGGGCAGGAGGGAAAGG + Intronic
1003364529 6:5459764-5459786 GGGAGGTGGGGAAAAGGGAAAGG - Intronic
1003530089 6:6929874-6929896 GGGACTTGGGCAAGAGGAACAGG - Intergenic
1004156764 6:13175950-13175972 GGGTCCAGGGCAGGAGGGAAAGG + Intronic
1004571520 6:16850326-16850348 GGGAGGGGGGCAATAGAGAAGGG + Intergenic
1004585667 6:16997424-16997446 TGGACCTGGGCATTTTGGAATGG - Intergenic
1006424148 6:33953729-33953751 GTGACCTGGGGGAGAGGGAATGG + Intergenic
1008247982 6:49202831-49202853 GGGACTGGGGCACTAGAGAATGG - Intergenic
1008768228 6:54946142-54946164 TGGACCTGGGAAAGACGGAAGGG + Intergenic
1008778139 6:55066061-55066083 TGAACATGGGCAATAGAGAAAGG + Intergenic
1009550668 6:65088257-65088279 TGGAACTGGGCAATAGGAAGAGG + Intronic
1010565411 6:77405953-77405975 TAGAACTGGGCAATAGGGTATGG + Intergenic
1012001749 6:93663077-93663099 GGTAACTGTGCATTAGGGAAAGG + Intergenic
1012421571 6:99071401-99071423 GGGTGCTGGGCAATAGAGATGGG - Intergenic
1013096742 6:106952259-106952281 GGGACCAGGGCAATGGGGGCGGG + Intergenic
1013439530 6:110148732-110148754 GAGACTTGGGCAGTGGGGAATGG + Intronic
1013729992 6:113154134-113154156 TGGAACTGGGCAATGGGCAAAGG + Intergenic
1014631473 6:123795412-123795434 GGTAACTGTGCAATGGGGAAAGG + Intergenic
1015121043 6:129702012-129702034 GGGATCTGGGTCATAGGGAAAGG - Intronic
1015199148 6:130559590-130559612 GGGACCTGGCTCATAGGGAAGGG + Intergenic
1017002346 6:150005160-150005182 GGGACCTGGGGCACAGGGGACGG + Intergenic
1017031382 6:150226039-150226061 GGCCACTGGCCAATAGGGAAAGG + Intronic
1017817868 6:158028214-158028236 GGGAGCTGTGCAAGAAGGAAGGG + Intronic
1019376336 7:694503-694525 GGGGCCTGGGCATTAGGGGAAGG - Intronic
1019735923 7:2649673-2649695 TGGACCTGGGCACTGGGGGAGGG + Intronic
1019794567 7:3040300-3040322 AGGGCCTGGCCAAGAGGGAATGG + Intronic
1021759913 7:23893719-23893741 TGCACCTGTGCAAAAGGGAAAGG - Intergenic
1022477936 7:30723847-30723869 GGGGCCTGGGAACCAGGGAAGGG + Intronic
1023062830 7:36344982-36345004 GAGACCTGGACAATAGGGATAGG - Intronic
1024098063 7:46000787-46000809 GGGACCTGGGCTGGAGGGCAGGG - Intergenic
1026198769 7:68195991-68196013 GGGAACCTGGCAATAGGGTAGGG - Intergenic
1028238476 7:88389632-88389654 GGGACTTGGGCAATAGATGAGGG + Intergenic
1029020221 7:97357255-97357277 GGGCCCTGGGCACCAGGGTATGG + Intergenic
1029515269 7:101019771-101019793 GGGAGATGGGCAAGAGGGACTGG - Intergenic
1031130552 7:117828413-117828435 GGGACCTAGGCAAAAGGTGAAGG + Intronic
1031857524 7:126940416-126940438 GGGACCATGGCATTAGGGAATGG - Intronic
1032477699 7:132223637-132223659 GGCACCTGGGCACAGGGGAAGGG + Exonic
1032550142 7:132777325-132777347 GGAAGCTGGGGAAGAGGGAAGGG - Intergenic
1034535439 7:151723175-151723197 GGCAACTGGGCATTAGGGAAAGG - Intronic
1034544408 7:151780645-151780667 GGGCTCTGGGCAGCAGGGAATGG - Intronic
1035165496 7:156987134-156987156 AGGGACAGGGCAATAGGGAAAGG + Intergenic
1044052299 8:87521406-87521428 TGGACCTGAGCTATAGGGAATGG + Intronic
1044595879 8:93957996-93958018 GGAACCTGGGGGATAGGGAAGGG - Intergenic
1046065285 8:109189186-109189208 GAGACTTGGGCAATAGTTAAAGG + Intergenic
1048601507 8:135923612-135923634 GGGAGGTGGACAAAAGGGAAAGG - Intergenic
1048945552 8:139443857-139443879 GTGACCTAGGGAATGGGGAAGGG + Intergenic
1050837797 9:10105829-10105851 AGGACCCCTGCAATAGGGAAAGG + Intronic
1051079065 9:13275594-13275616 TGGAACTGGGTAATAGGTAATGG + Intronic
1051488345 9:17633167-17633189 GGGAACTGGGCAATCTGGGAAGG + Intronic
1052124163 9:24755206-24755228 TGGAACTGGGCAATAGGCAGAGG + Intergenic
1052803092 9:32988356-32988378 GGGATCTTGGCAATAGCTAAGGG - Intronic
1053307353 9:36994101-36994123 AGGCCCTGGGCACTAGGGAAAGG + Intronic
1053887744 9:42657414-42657436 GGGGGCTGGGCTAAAGGGAACGG - Intergenic
1054226764 9:62464864-62464886 GGGGGCTGGGCTAAAGGGAACGG - Intergenic
1055372602 9:75616486-75616508 GGGACCCAGGCAGTAGAGAAGGG + Intergenic
1056314426 9:85374336-85374358 GGTAACTGTGCATTAGGGAAAGG - Intergenic
1056356072 9:85803140-85803162 GGGAACTGGGGAAGAGGGGATGG + Intergenic
1057387915 9:94620763-94620785 GGGAGCTGGGGACTAGGGGAGGG + Intronic
1057820512 9:98326743-98326765 TGGACCTGGCCAATACAGAAGGG + Intronic
1057844773 9:98514967-98514989 GGCACCTGGGCCTCAGGGAAAGG + Intronic
1058179632 9:101780833-101780855 GGCAACTAGGCAATAGAGAATGG + Intergenic
1058499180 9:105592938-105592960 TGGAACTGGGTAATAGGCAAAGG - Intronic
1058965197 9:110031044-110031066 GGGATCTGGGCTAGAGGGTAGGG + Intronic
1060763403 9:126275138-126275160 GGGACCTGGGAACCTGGGAAAGG - Intergenic
1060933421 9:127503015-127503037 GGCTCCTGGGCAGTGGGGAAGGG - Exonic
1061186676 9:129059074-129059096 GGGACCTGGGGGTGAGGGAAGGG + Intronic
1061415549 9:130445140-130445162 GGGACCGAGGCAGGAGGGAAGGG + Intronic
1061419767 9:130466829-130466851 GGGAAGGGGGCTATAGGGAAAGG - Intronic
1061669786 9:132182379-132182401 GGGAACTGGGCAGGAGGGTAGGG - Intronic
1061986499 9:134133050-134133072 GGGACCTGGGCCAGCGGGGAGGG + Intergenic
1062424379 9:136499255-136499277 AGGATCTGGGCAACAGGGAGAGG + Exonic
1203746047 Un_GL000218v1:41178-41200 GGGCGCTGGGTACTAGGGAAGGG - Intergenic
1203564064 Un_KI270744v1:78304-78326 GGGCGCTGGGTACTAGGGAAGGG + Intergenic
1185653257 X:1664368-1664390 GTGGCCTGGGCAACAGAGAAAGG + Intergenic
1186842752 X:13501007-13501029 GAGAGCTGGACAATAGGCAAGGG - Intergenic
1188757547 X:33981893-33981915 GGAACATAGGCAATAGGGATAGG + Intergenic
1188863531 X:35286441-35286463 TGGAACTGGGCAACAGGGAGAGG - Intergenic
1189050334 X:37638311-37638333 GGCACCTGGTCAAAAGGGCAGGG + Intronic
1189945524 X:46173696-46173718 GGGACTTGGGGGAAAGGGAAGGG - Intergenic
1192173974 X:68874510-68874532 GGGACCAGGGGAATTGGTAAGGG + Intergenic
1192369372 X:70500419-70500441 GGGACTTGGTGAATAGGGAGTGG + Intronic
1196513119 X:116537542-116537564 GGGACTTGGAGAACAGGGAAAGG - Intergenic
1197111711 X:122782658-122782680 GGGGCTGGGGCAATAAGGAAAGG + Intergenic
1198402645 X:136282324-136282346 GGGACCTGGAAAAGAGGGATGGG + Intergenic
1198612498 X:138417653-138417675 TGGAACTGGGTAATAGGGAGAGG + Intergenic
1200515058 Y:4134282-4134304 TGGAACTGGGCAATAGGTAGAGG + Intergenic
1201159372 Y:11156190-11156212 GGGCGCTGGGTACTAGGGAAGGG - Intergenic
1201251810 Y:12066328-12066350 GGGACTTGGGAAAAAGGGAAGGG + Intergenic