ID: 1124372068

View in Genome Browser
Species Human (GRCh38)
Location 15:29109684-29109706
Sequence GCTGGTGCCCAGAACGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124372051_1124372068 26 Left 1124372051 15:29109635-29109657 CCAGATAGCTCAGCCACGGACCC 0: 1
1: 0
2: 0
3: 5
4: 57
Right 1124372068 15:29109684-29109706 GCTGGTGCCCAGAACGAAGAGGG 0: 1
1: 0
2: 1
3: 22
4: 152
1124372056_1124372068 13 Left 1124372056 15:29109648-29109670 CCACGGACCCATGGGGAGGCTGG 0: 1
1: 0
2: 2
3: 20
4: 192
Right 1124372068 15:29109684-29109706 GCTGGTGCCCAGAACGAAGAGGG 0: 1
1: 0
2: 1
3: 22
4: 152
1124372059_1124372068 6 Left 1124372059 15:29109655-29109677 CCCATGGGGAGGCTGGGAAGTGG 0: 1
1: 0
2: 2
3: 41
4: 334
Right 1124372068 15:29109684-29109706 GCTGGTGCCCAGAACGAAGAGGG 0: 1
1: 0
2: 1
3: 22
4: 152
1124372061_1124372068 5 Left 1124372061 15:29109656-29109678 CCATGGGGAGGCTGGGAAGTGGG 0: 1
1: 0
2: 3
3: 64
4: 632
Right 1124372068 15:29109684-29109706 GCTGGTGCCCAGAACGAAGAGGG 0: 1
1: 0
2: 1
3: 22
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124372068 Original CRISPR GCTGGTGCCCAGAACGAAGA GGG Intronic
900426789 1:2584162-2584184 CCTGGACCCCAGAACGAAGGAGG + Intergenic
900640806 1:3687291-3687313 GCTGGTTCCCTGAATGAGGAAGG + Intronic
901863406 1:12088897-12088919 GCTGAAGCCCAGGATGAAGAGGG - Intronic
902676116 1:18009539-18009561 GCTGGTTCCCAGAGCCAAGAGGG - Intergenic
904949628 1:34226076-34226098 GCTGCTGCCCAAAGAGAAGAGGG + Intergenic
905250832 1:36647233-36647255 GCTGGTCCCCAGAAAGACCAAGG - Intergenic
906059192 1:42937252-42937274 GCTGGTGCCCAGCACGGTGGTGG + Intronic
906283475 1:44569855-44569877 GCTGGGGCCCAGGACGATGCGGG - Intronic
907220603 1:52904698-52904720 GCTGTGGCCCAGAACGAGGAGGG - Exonic
912658525 1:111508429-111508451 GCTGCTGCCGAGAAAGAAAACGG + Intronic
913671921 1:121105050-121105072 GCTGGTGACCAGAAAGAACAAGG - Intergenic
914023696 1:143892495-143892517 GCTGGTGACCAGAAAGAACAAGG - Intergenic
914662172 1:149800442-149800464 GCTGGTGACCAGAAAGAACAAGG - Intronic
914807025 1:150999150-150999172 GCTGGGTCCCAGAGTGAAGATGG + Intronic
918566834 1:185943809-185943831 GCTGGTCACCAGAAAGACGAAGG - Intronic
920352884 1:205349353-205349375 GCTGGTGCCTGGAACCTAGAGGG + Intronic
922602480 1:226867548-226867570 GCTGGTGGCCAGAAAGACTAAGG - Intergenic
922749501 1:228063949-228063971 GCTGGGGCCCAGAGAGGAGATGG + Intergenic
923671207 1:236042855-236042877 GCTGGTGGCCAGAAAGACCAAGG + Intronic
924183968 1:241467272-241467294 GATGGTGACCAGGACCAAGATGG + Intergenic
1069879467 10:71582822-71582844 GCAGGTTCCCAGGGCGAAGATGG - Intronic
1070443150 10:76466230-76466252 ACTGGTGCCCAGAACTCTGAGGG + Intronic
1070937822 10:80315289-80315311 GGAGGTGCCCAGAGCGAGGAAGG - Intergenic
1071449402 10:85780013-85780035 GCTAGTGCCTGGAAAGAAGATGG - Intronic
1072693124 10:97584491-97584513 GCTGCTACCCAGAAGGAACAGGG + Exonic
1074121048 10:110494829-110494851 GAAGGTGCCCAGAAAGCAGAAGG - Intergenic
1074392729 10:113071584-113071606 GCTGCTGCCCAGAACGGAAAAGG - Intronic
1079428331 11:20364296-20364318 GCTGGCGCCCAAAATAAAGACGG - Exonic
1084802229 11:71552454-71552476 GCTGATGCCAAGAAGGAAGGAGG - Intronic
1085478926 11:76805904-76805926 GCTGGTGCCCAGCACATAGTTGG + Intergenic
1090372173 11:126263982-126264004 GCCGGTGCCCACAAAGACGATGG + Exonic
1091798531 12:3310585-3310607 GCTGCCGCCCAGAACCTAGAGGG + Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1095598067 12:43981389-43981411 GCTGGAGCACAGAAAGAGGAAGG + Intronic
1096567287 12:52492493-52492515 GCTGGTGCCCAGCAAGCAGCAGG - Intronic
1101640050 12:106581320-106581342 GCTGAGGCCCAGAACGATGAAGG + Intronic
1101879613 12:108617368-108617390 GCTGGGGCCTAGGACTAAGAGGG - Intergenic
1103839039 12:123847907-123847929 TCTGGTGCACAGAAGGAAGTGGG - Intronic
1105054755 12:133088045-133088067 GCTGGAGCCCAGGAGGCAGAGGG + Intronic
1106683228 13:32029914-32029936 GCTGGTGCCAGGAGCGAACATGG + Intergenic
1107325322 13:39235671-39235693 GCTGGTGGCCAGAAAGACTAAGG - Intergenic
1107452377 13:40521508-40521530 GCTGACGGCCAGAAAGAAGATGG + Intergenic
1111640870 13:90968274-90968296 GCTGTGGCCCAGGAAGAAGAGGG - Intergenic
1117611234 14:57485319-57485341 GCTGGTGCCCAGGAATAAGCTGG + Intronic
1119048013 14:71338049-71338071 GCTGGTGCCCAGAGGGAAAAGGG - Intronic
1120022597 14:79547630-79547652 GCTGGTGCTCAGAGGGAATAGGG + Intronic
1122261083 14:100523448-100523470 CCTGGTCCTCAGAAAGAAGAAGG - Intronic
1123042974 14:105497985-105498007 GCTGGTGCCCAGAGCGAGGCTGG - Intronic
1124372068 15:29109684-29109706 GCTGGTGCCCAGAACGAAGAGGG + Intronic
1124506275 15:30277301-30277323 GATGGTGCCAAGAAAAAAGAGGG + Intergenic
1124737281 15:32261335-32261357 GATGGTGCCAAGAAAAAAGAGGG - Intergenic
1127284894 15:57523841-57523863 TCTGGTGCCCAGAATCCAGAGGG - Intronic
1128129040 15:65213376-65213398 GCTGGTGGCCAGGAGGGAGACGG - Intergenic
1128649436 15:69399899-69399921 GCAGGTGCTGAGAAGGAAGAGGG + Intronic
1129254673 15:74327288-74327310 GCTGGGGCCCAGAGCGAGGAAGG - Intronic
1129929319 15:79396554-79396576 ACTGGAGCCCAGAGGGAAGATGG - Intronic
1131179615 15:90230898-90230920 GCAGGTACCCAGAATGAAGGGGG + Intronic
1132652172 16:1026443-1026465 TCTGGTGTCCACAGCGAAGAAGG - Intergenic
1132781096 16:1626071-1626093 TCTGGTGGCGAGAAGGAAGAAGG + Exonic
1135690003 16:24528754-24528776 GCTGGAGCCCAGAAGGCTGAAGG - Intergenic
1137767594 16:50990154-50990176 AGTGGTGCCAAGAACCAAGATGG + Intergenic
1138535748 16:57659463-57659485 GCTCGTGTCCAGCAGGAAGACGG - Exonic
1142138694 16:88463042-88463064 GCAGGTGCCCAGAAGGAAGTGGG - Intronic
1142747493 17:1967144-1967166 GCTCCTCCCCAGAAGGAAGAGGG + Intronic
1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG + Intronic
1145878633 17:28338447-28338469 GCTGGTGCCAAGAAAGGGGAAGG + Intronic
1148957465 17:51365568-51365590 GCTGGTGCCCAGAGAGAGAAAGG - Intergenic
1149774395 17:59345923-59345945 GCTGGTGAGAAGAACCAAGACGG + Intronic
1151921008 17:77155492-77155514 GCTGGTGCCCAGATGGGAGCTGG + Intronic
1152403179 17:80081932-80081954 GCTGGAGCTCAGGAGGAAGACGG + Exonic
1152993638 18:385846-385868 ACTGGTTACCAGAACAAAGAGGG + Intronic
1154432786 18:14321129-14321151 GGTGGTGGGCAGAAGGAAGAGGG + Intergenic
1157126490 18:44961034-44961056 GCTGGTGTCCAGAATGATGAGGG + Intronic
1157758330 18:50238757-50238779 TCTGGTGCCCAGAAAGATGTTGG - Intronic
1160706355 19:531943-531965 GCTAGTGCCCAGCTCGCAGAAGG + Exonic
1163344594 19:16732426-16732448 CCTGAAGCCCAGTACGAAGAGGG - Intronic
1163708500 19:18831862-18831884 CCTGGTGCCCAGCAGGAAGACGG - Intergenic
1165781026 19:38434394-38434416 CCTCCTGCCCAAAACGAAGAAGG - Intronic
1166907962 19:46127344-46127366 GCTGTTGCAAAGAAAGAAGAAGG + Intergenic
1168534703 19:57159136-57159158 GCTGGGGAACAGAACTAAGAGGG + Intronic
925219482 2:2126452-2126474 TCTGGGGCCCAGAAAGAAGAGGG + Intronic
925900210 2:8503878-8503900 GCTGGTGCCCAGACTGAGGGTGG - Intergenic
926672815 2:15591689-15591711 CATGGTGCCCAGAACGAAGGCGG + Exonic
929489992 2:42387646-42387668 GCTGGGCCCCAGAAAGAAGGTGG - Intronic
931472466 2:62552840-62552862 GCTGGTGCCCAGAAGCATGTTGG - Intergenic
931547806 2:63408488-63408510 GGGGGTGGCCAGAAGGAAGACGG + Intronic
933177786 2:79195342-79195364 GCTGCTACCCAGAAGGAAGAAGG - Intronic
935363433 2:102267022-102267044 GGTGGTGCCCACAATAAAGAAGG - Intergenic
936103181 2:109601214-109601236 GCTGGTCACCAGAAAGAACAAGG - Intronic
937932970 2:127219931-127219953 GCTGCTGCCCAGAAGGCTGACGG - Intronic
938960062 2:136332896-136332918 GCTGGGGTCCAGGAGGAAGAGGG + Intergenic
940308846 2:152255433-152255455 GCTGGTGACCTGAACCAAGAAGG + Intergenic
944161449 2:196664724-196664746 GCTGGTCCCCAGAAAGATCAAGG - Intronic
944587505 2:201185663-201185685 TCTAATGCCCAGAACGGAGAAGG + Intronic
948847912 2:240691830-240691852 GCTGGTTCCCACAACCCAGAGGG - Exonic
949045794 2:241872169-241872191 GCTGGTACCCACAAGGGAGAAGG - Exonic
1169967967 20:11238208-11238230 GCTGTTGCTCAGAAAGAAGCAGG + Intergenic
1170666774 20:18393350-18393372 CCTGGTGCCCAGCATGAGGATGG - Intronic
1171426446 20:25051539-25051561 GCAGATGCCCAGAACGGGGACGG - Intronic
1171426524 20:25051984-25052006 CATGGTGGCCAGAACAAAGATGG - Intronic
1172910341 20:38404321-38404343 CCTGGATCCCAGAATGAAGAGGG - Intergenic
1173139850 20:40472203-40472225 GCTGATACCCAGAACACAGATGG - Intergenic
1175871454 20:62211278-62211300 CCTGGTGCCCAGAACACAGTAGG + Intergenic
1176197764 20:63845245-63845267 GCTGGTGCCCAGCACGGATTAGG + Intergenic
1177791905 21:25731433-25731455 TCTGTTGCCCAGAATGAACACGG + Intronic
1178981288 21:37267361-37267383 GGCGGGGCCCAGAACGAAGCGGG - Exonic
1179490806 21:41740609-41740631 GCAGGTGCCTAGATCGATGATGG + Exonic
1179586189 21:42375470-42375492 GCTGGGGCCCGGGAGGAAGAAGG - Intronic
1180685897 22:17666502-17666524 GATGGTTACCAGAACTAAGAAGG - Intronic
1181871755 22:25904897-25904919 CCTGGTGGCCAGAAAGAAAAAGG + Intronic
1181979696 22:26757179-26757201 GCTGGGGCCCAGCACGTAGTAGG - Intergenic
1182489694 22:30663162-30663184 GATGGTGCCCAGAAGAAAGAGGG - Exonic
1184108795 22:42383514-42383536 GCGGGGGCCCAGAACCAAGTTGG + Exonic
1184867398 22:47209348-47209370 GCTGGTGGCCAGGAGGAACATGG - Intergenic
1184901913 22:47451595-47451617 GCTGGTGCCCAGATGGACCAGGG - Intergenic
949218132 3:1596224-1596246 GATGGTGCCAAAAGCGAAGAAGG - Intergenic
949455200 3:4230735-4230757 GCTGGTCACCAGAAAGACGAAGG - Intronic
949538132 3:5011722-5011744 GCTGGTCCCGAGAATGAGGAAGG - Intergenic
949940432 3:9150322-9150344 GCTGGAGCCCAGAAGTAAGAAGG + Intronic
957737521 3:84221832-84221854 GCTGGTCACCAGAAAGAACAAGG - Intergenic
961585354 3:127917580-127917602 GCTGGTCCCCGGAAAGAATAAGG - Intronic
962825488 3:139096623-139096645 ACTGGGGCCCAGAAAGAGGAAGG - Intronic
965276592 3:166691191-166691213 GCTGGTGCCCAGAAGAATGTTGG + Intergenic
966807701 3:183819532-183819554 GCTGGAGCCCAGATGGGAGAGGG + Intronic
967054980 3:185823887-185823909 GCTGGAGCCCAGACAGGAGACGG - Intronic
968846431 4:3044808-3044830 GCTGGTCACCAGAAAGAAGAAGG + Intergenic
969656512 4:8501812-8501834 GCTGGGGCCCAGAAAGGACAGGG - Intergenic
972224396 4:36995745-36995767 GCTGGTGACCAGAAAGACCAGGG - Intergenic
972709187 4:41577226-41577248 GCTGGAGACCAGAACTAAAAGGG + Intronic
979693283 4:123583580-123583602 GCTGGAGCCCAGGAGGCAGAAGG - Intergenic
985769493 5:1799849-1799871 GCTGCTGCCAGGAAGGAAGATGG + Exonic
992907129 5:81357561-81357583 GCTGCTGCCCACCAGGAAGAGGG - Intronic
997953895 5:138263649-138263671 CCTGGATCCCAGAATGAAGAAGG + Intronic
998032330 5:138881582-138881604 GCTGTTGCTCACAACCAAGAAGG - Intronic
998306543 5:141083250-141083272 GCTGGAACCCAGAAGGCAGAAGG - Intergenic
1000646169 5:163762916-163762938 GCTGGTGACCAGAACAAGGGAGG + Intergenic
1002999577 6:2318556-2318578 GCTGGTCCCCAGAAAGATCAAGG - Intergenic
1003623248 6:7720839-7720861 GGTGAGACCCAGAACGAAGAAGG - Intergenic
1005097731 6:22136364-22136386 GCTGATGCCCAGAACCAAAGAGG + Intergenic
1005505216 6:26463581-26463603 GATGGAGCCCAGAACGGGGATGG + Intronic
1005838858 6:29727118-29727140 GATGGTGCCAAGAACGAAGAAGG - Exonic
1006579674 6:35069513-35069535 GCTAGTGCCTAGAACACAGAGGG + Intronic
1012925391 6:105262167-105262189 GCTGGACCCTAGAAGGAAGATGG + Intergenic
1017832131 6:158140230-158140252 GCTGGTGGCCAGAAAGACTAAGG + Intronic
1019194677 6:170274160-170274182 GCTGGTGCTCAGAAGGCAGATGG - Intergenic
1019773528 7:2898480-2898502 GCTGGTGCCCAAAGCAAAAATGG - Intergenic
1023606000 7:41931516-41931538 GCTGGTGCTCACATGGAAGATGG + Intergenic
1023693428 7:42818604-42818626 GGTGGAGCACAGAAAGAAGAAGG + Intergenic
1023818653 7:43968445-43968467 CCTGGTGCCCAGAAAGGATAAGG + Intergenic
1026617480 7:71918668-71918690 GCACGTTCCCAGAAGGAAGAAGG + Intronic
1030479453 7:110083852-110083874 AGTGGTGCCCAGAACAAAAAAGG + Intergenic
1033074163 7:138233093-138233115 CCTGGTGGACCGAACGAAGAGGG + Intergenic
1033401092 7:141026117-141026139 GCTTGAGCCCAGGACGCAGAGGG - Intergenic
1034904191 7:154929574-154929596 ACAGGTGCCTAGAATGAAGAGGG - Intronic
1035132620 7:156669684-156669706 GCTGGGACCCAGACCAAAGAGGG + Intronic
1035468010 7:159092238-159092260 GCTGGGGCCCAGAGCGAAATTGG + Intronic
1036030416 8:4964560-4964582 GCAGGAGCACAGAACCAAGAAGG + Intronic
1038355770 8:26827974-26827996 GCTGGAGCCCAGAAAGTTGAGGG - Intronic
1039567770 8:38563732-38563754 GCTGGAGCTCAGAAAGAAAAGGG - Intergenic
1040744771 8:50628017-50628039 GCTGGTTACCAGAAAGAACAAGG - Intronic
1043923606 8:86011693-86011715 GCTGGTGCCCTGGAAAAAGAAGG + Intronic
1045953750 8:107882738-107882760 ACTGGGGCCCAGAAAAAAGAAGG - Intergenic
1049392693 8:142380312-142380334 GGTGGTGCCCGGAAGGAGGAAGG - Intronic
1050324949 9:4490099-4490121 GCTGGTGTGGAGAACGGAGAGGG + Intergenic
1055639475 9:78308429-78308451 GCTGGTGCCCAGAAGAATGTTGG + Exonic
1057855914 9:98600583-98600605 GCAAGTGCCCAGTACAAAGAAGG + Intronic
1058016076 9:100033754-100033776 GCTGGTACTCAGAAGCAAGAGGG + Intronic
1059325801 9:113503499-113503521 GCTGGTGCCCAGGAGGGTGAGGG + Intronic
1060246521 9:121951006-121951028 GAGTGTGCCCAGAAAGAAGATGG - Intronic
1060726031 9:126006516-126006538 GCTGGTCCCCAGGAGGAAGGAGG - Intergenic
1061919941 9:133777226-133777248 GCTGGAGCCCAGAGAGAAGATGG - Intronic
1185998991 X:4987550-4987572 GCTGATGACCTTAACGAAGATGG + Intergenic
1187225463 X:17372193-17372215 GCTCCAGCCCAGAAGGAAGAAGG - Intergenic
1191136479 X:57070154-57070176 GTTGGAGCCCAGAAGGAAAATGG - Intergenic
1193693926 X:84682506-84682528 GCTGGGGGCCAGAAGGAAAAGGG + Intergenic
1195310697 X:103629400-103629422 GCTGGTGCCCAGAAAGTGGGGGG + Intronic