ID: 1124374649

View in Genome Browser
Species Human (GRCh38)
Location 15:29122425-29122447
Sequence AAGGGACCTGCTTTATCAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124374643_1124374649 3 Left 1124374643 15:29122399-29122421 CCCGGGGAAAGGTCAGCTCTGGG 0: 1
1: 1
2: 3
3: 50
4: 2223
Right 1124374649 15:29122425-29122447 AAGGGACCTGCTTTATCAGGAGG 0: 1
1: 0
2: 2
3: 14
4: 149
1124374645_1124374649 2 Left 1124374645 15:29122400-29122422 CCGGGGAAAGGTCAGCTCTGGGT 0: 1
1: 0
2: 1
3: 25
4: 227
Right 1124374649 15:29122425-29122447 AAGGGACCTGCTTTATCAGGAGG 0: 1
1: 0
2: 2
3: 14
4: 149
1124374641_1124374649 10 Left 1124374641 15:29122392-29122414 CCGCATGCCCGGGGAAAGGTCAG 0: 1
1: 0
2: 0
3: 9
4: 178
Right 1124374649 15:29122425-29122447 AAGGGACCTGCTTTATCAGGAGG 0: 1
1: 0
2: 2
3: 14
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124374649 Original CRISPR AAGGGACCTGCTTTATCAGG AGG Exonic
903242117 1:21990022-21990044 AAGGGACCTTCTTTACAAGGTGG + Intronic
903245627 1:22013209-22013231 AAGGGACCTTCTTTACAAGGTGG + Intergenic
904815493 1:33193725-33193747 AAGGGACTTTCTCTAACAGGCGG - Intergenic
906227389 1:44133069-44133091 AAGGGACCGTCTTGATCTGGGGG + Intronic
911098654 1:94076643-94076665 AAGGGACCTGTGTTATTTGGGGG + Intronic
1065392001 10:25192236-25192258 AAGGCACCTTCTTCATAAGGTGG - Intronic
1066490697 10:35891347-35891369 TAGAAAACTGCTTTATCAGGAGG - Intergenic
1072246635 10:93549447-93549469 AAGAGAGATGCTTTATCAGCAGG + Intergenic
1075732318 10:124643928-124643950 AAGGGACCAGCCTTTTCTGGGGG - Intronic
1077806756 11:5597845-5597867 AAAGGACCTTCTTTCCCAGGTGG - Intronic
1078108840 11:8375763-8375785 AAGGCACCTTCTTTACAAGGTGG - Intergenic
1080583787 11:33664375-33664397 CAGGAACCTGCCTTCTCAGGAGG + Intronic
1081341621 11:41935113-41935135 AGGGGACCAGCTTTATCAAAGGG - Intergenic
1081459629 11:43260076-43260098 AGGGGCCCTGCTTTTTCAGCTGG - Intergenic
1081674584 11:44961239-44961261 AAGGCACCTGCTTTCTAATGTGG - Intergenic
1089684764 11:120139603-120139625 AAGTGAACTGCTTTGTGAGGTGG - Intronic
1089772644 11:120814729-120814751 ACGGGACCTGCTCTACCTGGGGG + Intronic
1092252164 12:6905566-6905588 ATGAGACCTTCTTTTTCAGGAGG + Exonic
1095917689 12:47496823-47496845 AAGGTACCTGTTTAATCAGCTGG + Intergenic
1096802096 12:54117390-54117412 AAGAGACCTGATTTAGCAGAGGG + Intergenic
1097479991 12:60111783-60111805 ATGGGACTTGTATTATCAGGGGG - Intergenic
1097483359 12:60161137-60161159 ATGGGCCCTGTTTTCTCAGGTGG + Intergenic
1101304961 12:103519138-103519160 AAGGCACCTTCTTTACAAGGTGG - Intergenic
1103126173 12:118424327-118424349 ATGGGACCTGCCTGAGCAGGTGG - Intergenic
1103335134 12:120183750-120183772 GAGGGTCCTGCATTACCAGGCGG - Intronic
1103936448 12:124480065-124480087 GAGGCACCTCCTTTATCAGGAGG - Intronic
1105579744 13:21684096-21684118 AAGAGTCCTGCTTCTTCAGGTGG - Intronic
1106524088 13:30524475-30524497 AAGGCACCTTCTTTACAAGGCGG + Intronic
1106793505 13:33180691-33180713 CAGGGATCTGCTTTGTGAGGAGG + Intronic
1107193315 13:37616989-37617011 AAGGCACCTTCTTTACAAGGTGG - Intergenic
1109399709 13:61809408-61809430 AAGGGACCTGTTATAGAAGGGGG + Intergenic
1109977317 13:69855649-69855671 CAGGGACCTTCTTTACGAGGCGG - Intronic
1110724364 13:78802687-78802709 AAGGCACCTTCTTCATAAGGCGG + Intergenic
1113086306 13:106572676-106572698 AAGGCACCTTCTTTACAAGGTGG - Intergenic
1113119103 13:106907222-106907244 AATGCACCTGCTTTATTGGGTGG + Intergenic
1115145253 14:30218886-30218908 AAGGGACCCTCTTTCTCTGGTGG - Intergenic
1116607697 14:47023015-47023037 AAGGGGCAAGCTTTTTCAGGTGG + Intronic
1117492396 14:56262927-56262949 TAGTGACCTGTTTTATCTGGGGG + Intronic
1121666073 14:95673344-95673366 TAGGGACCTGCTATAGGAGGCGG - Intergenic
1121812135 14:96900662-96900684 AAGGGAGCTGCTTTAACTTGGGG - Intronic
1124176172 15:27426257-27426279 ACGAGGCCTGCTTTATCAGGTGG - Intronic
1124374649 15:29122425-29122447 AAGGGACCTGCTTTATCAGGAGG + Exonic
1126309289 15:47297778-47297800 AAGGGAGCTGCTCTATGAAGGGG + Intronic
1130123155 15:81069634-81069656 AAGGCACCTCCTTCACCAGGTGG - Intronic
1130163571 15:81427460-81427482 AAGGCACCTTCTTCACCAGGCGG - Intergenic
1132362927 15:101233027-101233049 AAGGGACCTGGTTGGTGAGGAGG - Intronic
1134321242 16:13166346-13166368 AACTGATCTGCTTTATCAAGAGG - Intronic
1135962283 16:27006190-27006212 AATGCACCAGCATTATCAGGTGG + Intergenic
1137900385 16:52261417-52261439 AAGGGACCAGATTTGGCAGGAGG + Intergenic
1138632820 16:58312568-58312590 AAGCAACCTGTTTTATCAGCAGG + Intronic
1140310110 16:73840824-73840846 AAGGGACATGTTTTACCGGGAGG - Intergenic
1141638566 16:85328628-85328650 AAGGGACCTGCATTCTGAGGAGG - Intergenic
1141828212 16:86495471-86495493 TAGGGACTTGCTGTATCCGGTGG + Intergenic
1142015664 16:87745438-87745460 AAGGTACCTGCAGCATCAGGCGG - Intronic
1143645570 17:8227934-8227956 AAGGCACCTGCATTCACAGGCGG - Exonic
1144157008 17:12514269-12514291 GAGTGGCCTGCTCTATCAGGGGG + Intergenic
1148348484 17:46920915-46920937 AAGGGACTTCCTTTATCATGGGG - Intergenic
1148966394 17:51439571-51439593 AAGGGAGATGCTTCATCAGTAGG + Intergenic
1150419337 17:65017410-65017432 AAGAAACCTGCCTTATGAGGAGG + Intronic
1152316415 17:79583216-79583238 GAGGGCCCTGCTTTACCAGGAGG - Intergenic
1154296081 18:13149998-13150020 AAGGCACCTTCTTTACCAGGTGG + Intergenic
1155175170 18:23295455-23295477 AAGGTACCTGTTTAATCAGCTGG + Intronic
1155575029 18:27235196-27235218 AAGGGACAGGCTTTATCATTGGG - Intergenic
1156339060 18:36195030-36195052 AAGAGAGCTGATTAATCAGGAGG + Intronic
1158701219 18:59749222-59749244 GAAGAACCTGCTTTCTCAGGTGG + Intergenic
1159791657 18:72788848-72788870 GAGGGACCTGGTTGAGCAGGTGG - Intronic
1161517082 19:4702592-4702614 AAGGGACCTACCTTCCCAGGAGG + Exonic
1164249275 19:23462903-23462925 CAGGGACCTTCTTCAACAGGTGG + Intergenic
1165636375 19:37343720-37343742 ATGGGACCTGCTTTATCCAGTGG - Intronic
1165651168 19:37491398-37491420 CAGGCACCTTCTTTATAAGGTGG - Intergenic
1167452397 19:49579481-49579503 AGGGGACTTCCTTTATCAGGTGG - Intronic
925087581 2:1121638-1121660 AAGGCACCTTCTTCATAAGGTGG + Intronic
925449842 2:3959627-3959649 AAGTAACCTGCTATCTCAGGGGG + Intergenic
925794316 2:7526278-7526300 AAGGTACCTTCTTTATAAAGTGG + Intergenic
930122286 2:47769895-47769917 AAGGGCCCTCCTGTATCAGCCGG + Intronic
936270076 2:111042573-111042595 AAGGGGCCTGCCTTATCAGGAGG + Intronic
938409034 2:131048636-131048658 AGAGGACATGCTTTATCAGTAGG - Exonic
940906459 2:159174249-159174271 AAGGGACCTGCAGTGTCAGCAGG - Intronic
941587484 2:167379147-167379169 AAGGCACCTTCTTCATAAGGGGG + Intergenic
943774958 2:191755302-191755324 AGGGGACCTGATTTAACAGAAGG - Intergenic
943819283 2:192299639-192299661 AAGGAACCTTCTTTGTCAGACGG + Intergenic
948139162 2:235660134-235660156 GAGGGACAGGCTTTCTCAGGGGG + Intronic
948722266 2:239908507-239908529 AAGGGAGCTGCCTTAGCAGTGGG - Intronic
949065459 2:241987639-241987661 GAGAGACCTGCTTTTGCAGGTGG + Intergenic
1169427530 20:5508345-5508367 AAGGGAACTGCTTCAAGAGGGGG + Intergenic
1169613840 20:7415277-7415299 AAAAAACCTGCTTTATCATGTGG + Intergenic
1169640578 20:7746261-7746283 AAGGCACCTTCTTCATAAGGTGG + Intergenic
1175113166 20:56663360-56663382 AATGGAGCTGCTTGCTCAGGTGG + Intergenic
1175168209 20:57061397-57061419 CAGGGACGTACTTTATTAGGAGG - Intergenic
1176215550 20:63946083-63946105 CAGGGACCTACTTTTGCAGGGGG + Intronic
1177560486 21:22744505-22744527 AAGGCACCTTCTTTACAAGGTGG + Intergenic
1177727987 21:24993088-24993110 GATTGACCTGCTCTATCAGGAGG - Intergenic
1177929320 21:27260774-27260796 CAGGGACCTGCTTCCTCTGGGGG - Intergenic
1181955290 22:26583866-26583888 AATGGAACTGCTTATTCAGGTGG + Intronic
950739828 3:15041350-15041372 AAGGGACCTGCCATCTCAGCTGG - Intronic
956371033 3:68561884-68561906 AAGGGACCAGCTTTAGTAAGAGG - Intergenic
956658335 3:71574909-71574931 AACGGAGCTCCTTTTTCAGGAGG - Intronic
959207818 3:103334679-103334701 AAGGGAGATGCCATATCAGGAGG + Intergenic
959302327 3:104618986-104619008 AAGGCACCTTCTTCATAAGGCGG - Intergenic
965249885 3:166329248-166329270 AAGGCACCTTCTTTACAAGGTGG + Intergenic
969548515 4:7848260-7848282 AAGGGAGGTGATTTATTAGGGGG + Intronic
970276549 4:14407068-14407090 GAGGGACCTTCTTTATCAGGAGG - Intergenic
972363019 4:38346253-38346275 AAGGTACCTGCTTCACAAGGTGG - Intergenic
973666654 4:53166475-53166497 AATGGACCTGCCTTATAAGGAGG + Intronic
975302189 4:72802890-72802912 AAGGCACCTTCTTCATAAGGTGG + Intergenic
977118862 4:93071154-93071176 TAGGGATCTTCTTTATCAGCAGG + Intronic
978573303 4:110163873-110163895 AAGGAATCTTCCTTATCAGGTGG + Intronic
979996493 4:127437921-127437943 AAGGTACCTTCTTTACAAGGCGG + Intergenic
980338783 4:131513619-131513641 AAGGCACCTTCTTCATAAGGTGG - Intergenic
984697615 4:182795193-182795215 AAGGGTGCTGCTGAATCAGGAGG - Intronic
986991963 5:13564695-13564717 AAGGCACCTGCTTCACAAGGCGG - Intergenic
987077563 5:14398244-14398266 AAGTGGCCTGCTTTATCACCTGG - Intronic
987331324 5:16860043-16860065 CAGGAAGCTGCTTTATCAGTGGG + Intronic
988824252 5:34918460-34918482 AAGGCACCTGCTTTAGAATGAGG - Exonic
989522899 5:42422347-42422369 AAGGGGCGTGTTTTATCATGGGG - Intergenic
992591392 5:78299685-78299707 AAGGCACCTGCTTCACAAGGTGG - Intergenic
992941398 5:81765895-81765917 TAGGCCCCTGCTTTATAAGGAGG - Intergenic
993202865 5:84840251-84840273 AAGCCACCTACTTTATAAGGCGG - Intergenic
995988524 5:118208515-118208537 AAGGCACCTTCTTTACAAGGTGG - Intergenic
996197082 5:120621739-120621761 AAGGCACCTTCTTTACAAGGTGG - Intronic
997365346 5:133321875-133321897 AGGGGACCTGCTTCATGAGTGGG + Intronic
998764670 5:145472410-145472432 AAGTGACCTAGTTTATCAGTTGG + Intronic
999192752 5:149760787-149760809 AAGGGACCTGCTATACCTTGGGG - Intronic
1000516113 5:162237851-162237873 AAGGCACCTTCTTCATGAGGCGG + Intergenic
1001397845 5:171429472-171429494 AGGGGAGCTGCGTTTTCAGGTGG + Intronic
1002958082 6:1888358-1888380 AAGGCACCTTCTTCATAAGGCGG + Intronic
1014678183 6:124394395-124394417 AAGGGCCATGCATTATTAGGAGG - Intronic
1017650225 6:156574231-156574253 AAGGAACCTGGTATATCAGAGGG - Intergenic
1018168951 6:161128737-161128759 AAGTGACCTGCTTCATCACATGG - Intergenic
1019199859 6:170305938-170305960 CAGGGACCTGCACGATCAGGTGG + Intronic
1020379352 7:7526131-7526153 GATGGACCTGCTTTATCACGAGG + Intronic
1021586741 7:22216524-22216546 AAGGGACGTGTGTTATCAGATGG - Intronic
1022317687 7:29260773-29260795 ACCGGACCTGTTTTATGAGGTGG + Intronic
1027498760 7:78922066-78922088 AACAGACATGCTTTATCAGTTGG + Intronic
1027953752 7:84854470-84854492 AAGGCACCTTCTTTACAAGGTGG + Intergenic
1031172361 7:118308219-118308241 AAGGCACCTTCTTCATAAGGTGG + Intergenic
1031661859 7:124435696-124435718 AAGGTACCTTCTTTACAAGGTGG + Intergenic
1037933627 8:22899457-22899479 AAGGAACCTGCTTTTGCAGGGGG + Intronic
1039932894 8:42010844-42010866 AAGGGACCTTCTTTGCCAGTAGG - Intronic
1041014997 8:53584381-53584403 AAATGACCTGCTTAATCAAGTGG + Intergenic
1043505058 8:80894231-80894253 AGGGGGCCTGCTTGCTCAGGTGG + Intergenic
1043774955 8:84254842-84254864 AAGGGACCTTCTTCACAAGGTGG + Intronic
1044562105 8:93622560-93622582 AAGGCACCTTCTTCATAAGGCGG - Intergenic
1044617933 8:94161305-94161327 AAGGGAATTGATTTATGAGGGGG - Intronic
1045849156 8:106672838-106672860 AAGGCACCTTCTTTACAAGGTGG - Intronic
1046331812 8:112726034-112726056 AAGGCACCTTCTTTACAAGGTGG + Intronic
1047203567 8:122785733-122785755 CAGGGCCCTTCTTTCTCAGGCGG - Intronic
1048114585 8:131507413-131507435 AAGGCACCTGCTTCAAAAGGCGG - Intergenic
1048695761 8:137026130-137026152 AAGGCACCTTCTTTACAAGGCGG + Intergenic
1049034407 8:140063021-140063043 AAGGGACCTTCTTCAGAAGGCGG + Intronic
1049223436 8:141438278-141438300 AAGGGCCCTGCTAGATCAGGAGG - Intergenic
1050453044 9:5804242-5804264 AAGAGACCTGCATTCTCTGGAGG + Intronic
1052554327 9:29994478-29994500 AAGGGACCTCCTTCACAAGGTGG + Intergenic
1054153522 9:61624287-61624309 AAGAGACCTGATTTAGCAGAGGG - Intergenic
1054967728 9:71048897-71048919 AAGGGACATGATTTCTCATGAGG + Intronic
1060236707 9:121868882-121868904 ATGGGAGCTGCTTTTTCAGTGGG - Intronic
1186319652 X:8410604-8410626 AAGGCACCTTCTTTACAAGGCGG + Intergenic
1186489853 X:9962951-9962973 AGGTGAATTGCTTTATCAGGTGG + Intergenic
1188606888 X:32042374-32042396 AAGGCACCTCCTTTACAAGGTGG + Intronic
1189271487 X:39755233-39755255 AAGGAACAGGCTTTCTCAGGGGG + Intergenic
1193889459 X:87026907-87026929 AAGGCACCTTCTTTACAAGGTGG + Intergenic
1194625371 X:96220779-96220801 CAGGGACCTTCTTTACAAGGTGG + Intergenic
1197582825 X:128306033-128306055 ATGGGACTTGCTTTATCATATGG - Intergenic
1197925658 X:131644768-131644790 AAGGGTCCTTCTTTGTCAGAAGG + Intergenic
1198127952 X:133665712-133665734 AAGGAACATTCTTTATCTGGTGG + Intronic
1201378837 Y:13350567-13350589 GAAGGACCTGCTTTATCTGATGG - Intronic