ID: 1124376824

View in Genome Browser
Species Human (GRCh38)
Location 15:29133762-29133784
Sequence GAGTTAGCTGCCGCTGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124376824_1124376825 10 Left 1124376824 15:29133762-29133784 CCAGTGACAGCGGCAGCTAACTC 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1124376825 15:29133795-29133817 GAACTACAGCTCCTGTCATCTGG 0: 1
1: 0
2: 0
3: 8
4: 111
1124376824_1124376826 13 Left 1124376824 15:29133762-29133784 CCAGTGACAGCGGCAGCTAACTC 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1124376826 15:29133798-29133820 CTACAGCTCCTGTCATCTGGTGG 0: 1
1: 0
2: 1
3: 13
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124376824 Original CRISPR GAGTTAGCTGCCGCTGTCAC TGG (reversed) Intronic
901143697 1:7051735-7051757 GAGGGAGCAGCCTCTGTCACAGG - Intronic
901626088 1:10625879-10625901 GGCTTTGCTGCCGCTGTCCCTGG + Intronic
905127722 1:35727281-35727303 GGGTTGGCTGAGGCTGTCACTGG - Intronic
916662539 1:166935759-166935781 GAGTGGGCTGCTGCTGTCACTGG - Intronic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
1067091995 10:43271867-43271889 GAGTTGGATTCCTCTGTCACAGG - Intergenic
1071289041 10:84175136-84175158 GAGATGGCTGCTGCTGACACTGG - Intronic
1076372053 10:129961793-129961815 GAGTTAGCTGCCTTTGTTATAGG + Intronic
1079005845 11:16790673-16790695 GAGTGAGCAGCAGCTGTCAGGGG - Intronic
1083686798 11:64381373-64381395 GAGGTCTCTGCCGCTGTGACAGG - Intergenic
1094508542 12:31081955-31081977 CAGTCAGCTTCAGCTGTCACTGG - Intronic
1096856121 12:54484759-54484781 GAGTTACCTGCCACAATCACAGG - Intergenic
1102958700 12:117077044-117077066 AAATTAGCTGCCTCTGTAACAGG - Intronic
1103927290 12:124429899-124429921 GACTGAGCTGCCCATGTCACAGG - Intronic
1104658133 12:130589532-130589554 GAGTTAGCTGCCTGTGTGGCAGG - Intronic
1105820149 13:24073481-24073503 GCCTCAGCTGCCACTGTCACAGG - Intronic
1105830352 13:24158774-24158796 GAGTGAGGTCCCACTGTCACCGG + Intronic
1106840378 13:33680359-33680381 GTGTGTGCTGCCGCGGTCACGGG - Intergenic
1110503364 13:76254947-76254969 GAGTTTGCTCCTGCTCTCACAGG - Intergenic
1118345451 14:64937385-64937407 GAGATAGCTGGCTCTGTTACTGG + Intronic
1121405151 14:93715354-93715376 GAGTGAGCAGCCGCTGTCTAGGG + Intergenic
1123996768 15:25723919-25723941 GAGTAAACTGCAGCTGTGACTGG + Exonic
1124376824 15:29133762-29133784 GAGTTAGCTGCCGCTGTCACTGG - Intronic
1136344108 16:29664176-29664198 GAGCTAGCTGCCGTGGTAACAGG - Exonic
1141435709 16:83998664-83998686 GCCTCAGCTGCTGCTGTCACAGG + Intronic
1146945739 17:36872226-36872248 CAGTTAGCTGCCTCTGCCACCGG - Intergenic
1148186618 17:45649163-45649185 GAGCTGGCAGCCTCTGTCACAGG - Intergenic
1151813578 17:76459620-76459642 GAGTGAGCTTCCGGAGTCACAGG + Intronic
1152103870 17:78317887-78317909 GAGTTAGCTGTGGCTGCCAGAGG + Intergenic
1152283127 17:79396953-79396975 GCGTTCCCTGCCGCTGTGACAGG - Intronic
1153081034 18:1225439-1225461 GAGTAAACTGCCACTGTCATGGG + Intergenic
1153925155 18:9828979-9829001 CATTTACCTGCTGCTGTCACAGG + Intronic
1157749180 18:50162882-50162904 GAGGGAGATGCCGCTGTGACAGG - Intronic
1158126349 18:54103582-54103604 GAGTTAGCAGCCCCTTGCACAGG + Intergenic
1165705158 19:37970709-37970731 GAGTTAGCTTCAGCAGTCATTGG + Intronic
935418946 2:102846524-102846546 GGCTTAGCTGCTGCTCTCACAGG + Intergenic
948982248 2:241500337-241500359 GAGTTCTCTGCCTCTCTCACAGG + Intronic
1175656202 20:60773074-60773096 GAGTTAGGGGCAGCTGTCAGAGG + Intergenic
1177249414 21:18572728-18572750 GATTTTGCTGCACCTGTCACTGG + Intergenic
1182856517 22:33522269-33522291 GAGTTAGCCACCTCTGTCACAGG + Intronic
1183323891 22:37181034-37181056 GAGATACCTGCCCCTGCCACCGG + Exonic
1183981033 22:41540380-41540402 GAGAAGTCTGCCGCTGTCACCGG + Intronic
1184335941 22:43853356-43853378 AAGTGAGCTGCCACTGTCATGGG - Intronic
953753572 3:45628107-45628129 CAATTAGCTGGGGCTGTCACTGG - Intronic
953821244 3:46209070-46209092 GAGTGATCTGCCCATGTCACAGG - Intronic
958576201 3:95952250-95952272 GAGATAGCTGCAGTGGTCACTGG - Intergenic
968560400 4:1277898-1277920 GAGGTGACTGCCGCTGGCACGGG - Intergenic
975910965 4:79266251-79266273 GAGTGAGCTGCCTCCATCACGGG - Intronic
983420278 4:167507507-167507529 GAGTAACCTGCTGCTGCCACAGG - Intergenic
985861769 5:2477147-2477169 GAGGTAGCTGGCCCTGTCTCAGG + Intergenic
987308125 5:16657560-16657582 TAGTTAGCAGTCTCTGTCACAGG + Intergenic
993046651 5:82873809-82873831 GAGTTTGCTGCAGCTGTGGCTGG - Intergenic
993495597 5:88605366-88605388 GAGGCAGCTGCCCTTGTCACAGG - Intergenic
997284389 5:132667932-132667954 GCGCCAGCTGCCTCTGTCACGGG + Intergenic
1003368662 6:5502065-5502087 GAGTTAACTGCCCCAGCCACTGG - Intronic
1003674164 6:8187856-8187878 GATTTAGCTGCATCTATCACTGG + Intergenic
1006929570 6:37679638-37679660 CAGGAAGCTGCCGCTGTCACTGG - Intronic
1019986457 7:4659840-4659862 GATTTAGCTGCTGCTGCCAAAGG - Intergenic
1022522471 7:31017028-31017050 GACTTAAATGCCACTGTCACAGG + Intergenic
1026521715 7:71123584-71123606 GACTGAGCTGTCACTGTCACAGG - Intergenic
1032724085 7:134575290-134575312 GAGTTAGCTGAAGCATTCACAGG - Intronic
1044724059 8:95178236-95178258 GAGTCAGCAGGGGCTGTCACAGG + Intergenic
1046871192 8:119207857-119207879 GAGTCAGCTGCAGCAGCCACTGG - Intronic
1052611132 9:30774625-30774647 GAGTTAGTTGCTGCTGTCCAGGG - Intergenic
1060698614 9:125731346-125731368 GGGTTGGCTGAGGCTGTCACTGG + Intergenic
1060720412 9:125972840-125972862 GAGTGAGCTGCCGCACGCACTGG + Intergenic
1060987809 9:127829803-127829825 GAGTCAGCTCCAGCTGTGACGGG + Exonic
1189771300 X:44430407-44430429 GAGTTAGCAGCTTCTGTCATCGG + Intergenic
1190689746 X:52903568-52903590 GTGTCAGATGCCTCTGTCACAGG + Intronic
1190696237 X:52952224-52952246 GTGTCAGATGCCTCTGTCACAGG - Intronic
1190745251 X:53318750-53318772 GAGTCCGCTCCCTCTGTCACAGG + Intronic