ID: 1124377772

View in Genome Browser
Species Human (GRCh38)
Location 15:29139646-29139668
Sequence GAGCAGAGGCTGCCACACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 1, 2: 0, 3: 33, 4: 327}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124377770_1124377772 -9 Left 1124377770 15:29139632-29139654 CCGCAGGTGCAAGTGAGCAGAGG 0: 1
1: 0
2: 2
3: 21
4: 230
Right 1124377772 15:29139646-29139668 GAGCAGAGGCTGCCACACACTGG 0: 1
1: 1
2: 0
3: 33
4: 327
1124377768_1124377772 -3 Left 1124377768 15:29139626-29139648 CCCTCTCCGCAGGTGCAAGTGAG 0: 1
1: 0
2: 1
3: 18
4: 155
Right 1124377772 15:29139646-29139668 GAGCAGAGGCTGCCACACACTGG 0: 1
1: 1
2: 0
3: 33
4: 327
1124377769_1124377772 -4 Left 1124377769 15:29139627-29139649 CCTCTCCGCAGGTGCAAGTGAGC 0: 1
1: 0
2: 0
3: 10
4: 174
Right 1124377772 15:29139646-29139668 GAGCAGAGGCTGCCACACACTGG 0: 1
1: 1
2: 0
3: 33
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124377772 Original CRISPR GAGCAGAGGCTGCCACACAC TGG Intronic
900265768 1:1756366-1756388 AAGAAGAGGCTGTCACACAGTGG + Intronic
900347148 1:2215269-2215291 GAGCAGGATCTGCCCCACACTGG - Intergenic
900524139 1:3120273-3120295 GAGGGGAGGCTGCCAGACAGGGG - Intronic
901067868 1:6502931-6502953 GAGCTGGGGCAGGCACACACGGG + Intronic
902670833 1:17972343-17972365 GAGCATAAGCTGCCACGCACAGG + Intergenic
902696031 1:18141505-18141527 GGGGAGAGGCTGACACACAGAGG + Intronic
902775511 1:18672069-18672091 GAGCAGAGTATGGCACATACAGG + Intronic
902989900 1:20179850-20179872 TAGCAGAAGCTGACACACAAGGG - Intergenic
903762875 1:25711614-25711636 GAGCAGGGCCTGGCACACAGTGG - Intronic
904370914 1:30046873-30046895 GAGCAGAGCCTGCCAGTCACGGG + Intergenic
905653624 1:39672226-39672248 CAGCAGCGGCAGCGACACACGGG - Intergenic
906189366 1:43885901-43885923 GAGCAGAGGATGCCAGAGGCTGG + Intronic
906545811 1:46618686-46618708 GAGCAGAGGCTGTCAACCCCAGG + Intergenic
906990385 1:50731159-50731181 GACCAGAGGGTCCCTCACACAGG - Intronic
907189291 1:52634744-52634766 GAGCAGAGGCTGCTGCCCTCTGG + Intronic
907263274 1:53238143-53238165 GAACAGAGCCTGGCACACAGTGG + Intronic
910102944 1:83598219-83598241 GAACAGAGGCTGCTATACTCAGG - Intergenic
910221578 1:84893578-84893600 GAGTAGAGCCTGCCTCCCACGGG - Intergenic
914995610 1:152541022-152541044 CTGCAGAGCCTGCCACACACAGG + Intronic
915118595 1:153615106-153615128 GAGCAGAGGCTACCTAGCACTGG + Intronic
915286834 1:154858581-154858603 GAGCAGGGCTTGCCACACAGTGG + Intronic
916879005 1:169000698-169000720 GAACAGTGGCTCCCAAACACTGG + Intergenic
918071855 1:181139262-181139284 GAACAGAGGATTCCACACAAAGG + Intergenic
918087760 1:181259925-181259947 GAGCTGAAGCTGCCATCCACAGG + Intergenic
918093462 1:181316617-181316639 GGGCAGAGCCTGGCACACAGTGG - Intergenic
919185624 1:194144603-194144625 GAGCACTGGCTGCCAGGCACTGG + Intergenic
919990922 1:202708515-202708537 GAGCAGAGGCAGCCACCCTGAGG + Intronic
920182134 1:204138490-204138512 GAGCAGAGGCTGGCACTGGCAGG - Intronic
920673620 1:208023803-208023825 GAGCAGTGGCTGGCAGACAGTGG + Exonic
920877468 1:209849909-209849931 GAGCTGAAGCTGGCTCACACTGG + Intronic
920898948 1:210087340-210087362 GTGAGGAGGGTGCCACACACAGG - Intronic
921515308 1:216084102-216084124 GAGCAGAGACTTCCACCCAGGGG - Intronic
922462242 1:225822846-225822868 GAGCAGATGCTGCCAGACCACGG + Intronic
923203885 1:231739470-231739492 ATGCAGGGGCTGCCACACAGAGG - Intronic
923226344 1:231941975-231941997 GAGCAGAGCGTGCCAGACAGAGG + Intronic
924818645 1:247465991-247466013 CTGCAGAGGCAGCAACACACGGG - Intergenic
1062993354 10:1841510-1841532 GAGCAGAAGCAGCCACAGAAAGG + Intergenic
1063051654 10:2455902-2455924 GAGGAGAGGCAGGCACACTCAGG + Intergenic
1064582723 10:16810502-16810524 GAACAGCCGTTGCCACACACTGG - Intronic
1066690888 10:38026869-38026891 GATTAGAGGTTGCCACAGACTGG - Intronic
1067046691 10:42989170-42989192 GAACAGAGCCTCCAACACACTGG + Intergenic
1067184567 10:44015781-44015803 GAGGAGAGGCTGTCACTCCCTGG - Intergenic
1067253495 10:44610469-44610491 GAGCAGAGGATGCCAGAGGCTGG - Intergenic
1067497386 10:46773321-46773343 GAGCAGGTGCTGCCTCGCACAGG - Intergenic
1067560219 10:47300183-47300205 GCGCGCACGCTGCCACACACGGG + Intergenic
1067955596 10:50787732-50787754 CAGCAGAGGCTGCCGAACAGCGG + Intronic
1069286246 10:66719532-66719554 GTGCAGAAGCTGCTACACAGTGG - Intronic
1069860243 10:71466411-71466433 GGGCAGGGGCTCACACACACAGG - Intronic
1070173508 10:73950901-73950923 CTGCAGATGCTGCCAAACACAGG + Intergenic
1070212893 10:74345364-74345386 AAGCAGAGGTTGCCACTCACTGG + Intronic
1070721228 10:78758512-78758534 GAGCAGCCCCTGCCCCACACGGG - Intergenic
1073070195 10:100788433-100788455 GACCAGAGGCTGCCACTGCCTGG + Intronic
1073349766 10:102811290-102811312 GAGCAGAGGCTGCCATGAAAGGG + Intronic
1074539708 10:114354229-114354251 GAGCAAAAGCCGCCACACAAAGG + Intronic
1075567028 10:123512331-123512353 GTGGGGAGGCTGCCACAGACTGG - Intergenic
1075596025 10:123729725-123729747 GAGGTGAGGCTGCCTCACAGAGG - Intronic
1075682258 10:124341421-124341443 GACCAGAGGCTGCAACACTGTGG + Intergenic
1076087561 10:127648620-127648642 TATCAGAGGCTGCCGGACACGGG - Intergenic
1076348244 10:129795352-129795374 GAGCACAGGCAGACACACTCTGG - Intergenic
1076906741 10:133366329-133366351 CGGCAGAGGCGGCCAGACACGGG + Intronic
1077177972 11:1199188-1199210 GAGTAGTGGCTGCCACAAAGAGG + Intronic
1077192599 11:1261707-1261729 GAGCGCGGGGTGCCACACACAGG - Exonic
1079442039 11:20524547-20524569 GAGCAGTGGCTCCCACACCTGGG - Intergenic
1079459601 11:20668785-20668807 GGGCAGATGCTGCCACATAGGGG - Intergenic
1080208949 11:29762772-29762794 CACCAGAGGCTACTACACACTGG - Intergenic
1080359903 11:31500720-31500742 GAGCAGAGGTTGCCAAACTAGGG + Intronic
1080679233 11:34458624-34458646 GAGCAGAGGCTGCATAACCCTGG + Intronic
1081684047 11:45028944-45028966 GAACAGTGGCTGCCACACAAGGG - Intergenic
1082174575 11:49046427-49046449 GAGCAGAAGCTGCCTAACCCTGG + Intergenic
1083344314 11:61978932-61978954 GAGCTGAGGCTGGCACACAGGGG - Intergenic
1083619273 11:64040916-64040938 AAGCAGAGCCTGCCACACCTGGG - Intronic
1084751781 11:71208856-71208878 GAGCAGAGGTTGCTAAACTCTGG + Intronic
1085526137 11:77165366-77165388 CAGAGGAGGCTGCCACTCACAGG - Intronic
1085739522 11:79067027-79067049 GAGCAGAGGCTGAAAGGCACTGG - Intronic
1085765790 11:79280491-79280513 AAGCAGTGGATGCCACACATGGG + Intronic
1086691205 11:89789661-89789683 GAGCAGAAGCTGCCTAACCCTGG - Intergenic
1086714598 11:90049994-90050016 GAGCAGAAGCTGCCTAACCCTGG + Intergenic
1088536841 11:110870739-110870761 GAGCAGAGGATTTCACACATAGG + Intergenic
1091292061 11:134446289-134446311 GAGACGATGCTGCCAAACACAGG + Intergenic
1093098734 12:15001969-15001991 AAGCAGAGGCTTCCCCACTCGGG + Intergenic
1094066648 12:26368755-26368777 GAGCAGTGGCTGGCACATAGTGG - Intronic
1095428364 12:42104456-42104478 GAGCAGAGGTTACCTAACACTGG + Intronic
1098586047 12:72155685-72155707 CAGCAGAGGCTGCAAAACAATGG + Intronic
1102034123 12:109761268-109761290 GAGCAGAAGCTGCCTCACCAAGG + Intronic
1102784740 12:115595247-115595269 TGGCAGAGGCTGCCATGCACAGG + Intergenic
1102970289 12:117161079-117161101 GAGCAGCAGCTACCACAGACTGG + Intronic
1103995888 12:124829767-124829789 GAGCAGAGCCTGCCATACAGTGG - Intronic
1104836312 12:131794232-131794254 GAGCAAAAGCAGCCAGACACAGG + Intronic
1105238760 13:18590283-18590305 GAGGAGAGGCTACCATAGACTGG - Intergenic
1105546288 13:21353069-21353091 CAGGAGAGGCTCCCACACACGGG - Intergenic
1106461456 13:29973984-29974006 GAGCAGGGCCTGCCACAGAGTGG + Intergenic
1108364405 13:49695557-49695579 AGGCTGAGGCTGCCATACACTGG - Intergenic
1108589562 13:51901264-51901286 GACCAGATGCAGCCACACTCAGG - Intergenic
1111889145 13:94059912-94059934 GGAAAGAGGCTGCCACAGACTGG - Intronic
1113346372 13:109482460-109482482 GAGCAGAGGCGGCCCCAGAGGGG + Intergenic
1114528463 14:23380603-23380625 GAGCAGACACTGCCACAGCCCGG + Intergenic
1121061295 14:90912570-90912592 GCACAGAGGCTGGCACACAGCGG + Intronic
1121611877 14:95286851-95286873 GAGCAGAGGCTGGCACACACAGG - Intronic
1121940403 14:98064768-98064790 GAGCAGAGGCTGCCCCAAGAGGG - Intergenic
1122069643 14:99197295-99197317 GAGCAGTGTCTGGCACACACTGG - Intronic
1122411815 14:101529473-101529495 GAGATGAGGCTGCCAGACATGGG - Intergenic
1123934952 15:25189624-25189646 GAGCCTTGGCTGCCACACAGAGG - Intergenic
1124259840 15:28178842-28178864 GAGCAAAGGCCGCCCCGCACAGG + Intronic
1124377772 15:29139646-29139668 GAGCAGAGGCTGCCACACACTGG + Intronic
1124686006 15:31782535-31782557 GAGCAGGGACAGCCACACCCAGG + Intronic
1125937418 15:43648948-43648970 AATCAGCGGCTGCCACACAGCGG + Intronic
1125950327 15:43746364-43746386 AATCAGCGGCTGCCACACAGCGG + Intergenic
1126254192 15:46605645-46605667 AAGCAGATGGTGACACACACAGG - Intergenic
1126552342 15:49946778-49946800 AAGCAGGGGCTGCCCCAGACTGG + Intronic
1127734921 15:61831240-61831262 GCCCAGCGGCTGCCCCACACTGG - Intergenic
1127814104 15:62591625-62591647 GGCCAGAGGCTGCCCCACAATGG - Intronic
1129270992 15:74419187-74419209 AAGGAGAGGCTGCCACACTAGGG - Intronic
1129676830 15:77636260-77636282 AAGGAGAGGGTGGCACACACAGG + Intronic
1131405132 15:92158216-92158238 GTGCAGAGGGTGAAACACACAGG - Intronic
1131575274 15:93583602-93583624 GAGAAGAGACTGCCACACTAGGG - Intergenic
1132507572 16:319290-319312 GAGCACAGGCTGGAACACAGTGG - Intronic
1132872838 16:2123333-2123355 GGGCAGACGCTTCCACACCCTGG - Intronic
1132872851 16:2123376-2123398 GGGCAGATGCTTCCACACCCAGG - Intronic
1134014176 16:10877278-10877300 GAGGAGGGGCTGCCAGACTCCGG + Exonic
1134065345 16:11224795-11224817 GAACAGTGGCTGGCACACAGCGG - Intergenic
1134133703 16:11666571-11666593 GAACAGTGCCTGCCACACAGTGG - Intergenic
1134551926 16:15142512-15142534 GGGCAGACGCTTCCACACCCTGG - Intergenic
1134551939 16:15142555-15142577 GGGCAGATGCTTCCACACCCAGG - Intergenic
1135252094 16:20909131-20909153 GACCAGAGGCCACAACACACTGG + Intronic
1137536616 16:49332060-49332082 GAGCAGAAGCTTCCACCCACGGG + Intergenic
1138319734 16:56101831-56101853 GAGGAAAGACTGCCACAAACAGG - Intergenic
1138629115 16:58279540-58279562 GAGGACACGCTGCCCCACACAGG + Intronic
1140218740 16:73028455-73028477 ATGCTGGGGCTGCCACACACCGG + Intronic
1140450386 16:75065893-75065915 CAGCAGCGGCTTCCACATACAGG - Intronic
1140756877 16:78075670-78075692 GTGCAGTGCCTGCCACACGCTGG - Intergenic
1140795680 16:78435316-78435338 CGGCAGAGGCTGCTGCACACTGG - Intronic
1141156333 16:81599729-81599751 GAGCAGGGGATGTCTCACACAGG - Intronic
1142577821 17:921151-921173 GAGCAGCGGCTGGCACACAGGGG + Intronic
1143041210 17:4038502-4038524 GAGCAGAAGAAGCCAGACACAGG + Intronic
1143269507 17:5665471-5665493 CAGCTGAGGATGCCACTCACAGG - Intergenic
1143363539 17:6390386-6390408 GCACAGAAGCTGCCACACACAGG - Intergenic
1143456431 17:7070901-7070923 GAGCAGGGTCTGCCACCCAGGGG - Intergenic
1144209704 17:13003775-13003797 GAGCAGAGCTTGCCAGATACAGG - Intronic
1144359549 17:14478896-14478918 TCACAGAGGCTGACACACACTGG - Intergenic
1144888742 17:18481467-18481489 AATCACAGGCTGCCACAAACAGG + Intronic
1145143465 17:20462831-20462853 AATCACAGGCTGCCACAAACAGG - Intronic
1149036525 17:52140620-52140642 GAGCAGGGGCTGACAAACAGTGG - Intronic
1150646814 17:66983754-66983776 TTGCAGGGGCTGCCACCCACTGG + Intronic
1151403019 17:73868543-73868565 CAGAAGTGGCTGCCACTCACTGG - Intergenic
1152374518 17:79912290-79912312 ACACAGAGACTGCCACACACAGG - Intergenic
1152647312 17:81475379-81475401 AAGCAGAGGCCAACACACACAGG + Intergenic
1152830243 17:82492773-82492795 GAGCAGTGGCTGCCAACCATGGG + Intergenic
1156848921 18:41702755-41702777 GAGCTGGAGTTGCCACACACTGG - Intergenic
1157484920 18:48080019-48080041 GAGCAGACGTTACCACACTCTGG + Intronic
1157587831 18:48816615-48816637 GTGCAGAGCCTGTCACACAATGG + Intronic
1160689303 19:453816-453838 GAGCAGAGCCAGACACGCACAGG + Intronic
1160862753 19:1244647-1244669 GAGCTGTGGCTGCCACCCATGGG + Exonic
1161119061 19:2515184-2515206 AAGAAGAGGCTGGCACACCCGGG + Intronic
1162041809 19:7975300-7975322 GAGCTGAGGCTGGCACTGACTGG + Intronic
1163582105 19:18145101-18145123 GGCCGCAGGCTGCCACACACGGG - Exonic
1164805141 19:31110531-31110553 GGGGAGAGGCTGCCTCCCACAGG - Intergenic
1165760777 19:38320103-38320125 GGGCGGGGGCAGCCACACACGGG - Exonic
1166624964 19:44343393-44343415 CAGCAGATGTGGCCACACACCGG + Intronic
1166937485 19:46343206-46343228 GAGCAGTGCCTTCCACAAACGGG - Exonic
1167374329 19:49103049-49103071 CTGCAGAGGCTGGCACACAGGGG - Intronic
1167452205 19:49577919-49577941 GAGTAGTGGCTGCCAAAGACTGG + Intronic
1168638872 19:58017438-58017460 GAGCAGGGGCTGCCTCAGGCAGG + Intergenic
925710998 2:6740016-6740038 GACCAGAGGCAGCGAGACACCGG - Intergenic
926085800 2:10019732-10019754 GAGCTGAGGCTGCAAGACCCCGG - Intergenic
926133403 2:10319619-10319641 AAACAGAGGCTCCCAAACACAGG - Intronic
926616585 2:15002577-15002599 GAGCAGGGGGTGGCACTCACTGG + Intergenic
927422557 2:22948509-22948531 GGCCAAAGGCTGTCACACACGGG + Intergenic
928216667 2:29367193-29367215 GCACAGAGCCTGGCACACACTGG - Intronic
928298239 2:30104030-30104052 AAGCAGAGAATGCCACACATAGG + Intergenic
928401179 2:30979796-30979818 GAGCCGAGGGTGGCAGACACAGG - Intronic
932302449 2:70676770-70676792 GAGCAGAGGCTGCCCCTGACTGG - Intronic
932309972 2:70731914-70731936 GTGCAGAGCCTGCCACTCATTGG - Intronic
933811491 2:86035522-86035544 GCTCAGCTGCTGCCACACACAGG + Intronic
934588913 2:95529064-95529086 GAGCAGAAGCTGCCTGACACTGG - Intergenic
934864589 2:97794847-97794869 GAACAGTGGCTGGCACACAGTGG + Intronic
936067461 2:109343306-109343328 GAGCAGAAGCAGCCAGAAACTGG - Intronic
936291530 2:111228040-111228062 GAGCAGAGGAGGCCACATATGGG - Intergenic
936639236 2:114293544-114293566 GAGGAGAAGCAGCCACACAAAGG + Intergenic
937869011 2:126774382-126774404 CAGCAGAGCCTGACACACAGCGG + Intergenic
942219777 2:173757889-173757911 GAGCAGAGGCCAGAACACACTGG + Intergenic
942373332 2:175309978-175310000 GAGGGGAGGCTGCCACCTACTGG - Intergenic
944214071 2:197236359-197236381 AAACTGAGGCTGCCACTCACAGG + Intronic
947501655 2:230675390-230675412 GAGCAGAGGCAGCCAAAACCAGG + Intergenic
947511604 2:230759641-230759663 GAGCAGCAGCTCCCACTCACAGG - Intronic
948602257 2:239114034-239114056 GACCCAAGCCTGCCACACACGGG - Intronic
948783095 2:240336998-240337020 GAGCAGAGGCTCCAGCAGACAGG + Intergenic
1168925791 20:1577904-1577926 GGGCAGAGCCTGGCACACAGTGG + Intronic
1168929669 20:1610923-1610945 GGGCAGAGCCTGGCACACAGTGG + Intronic
1169022031 20:2337248-2337270 CAGGAGAGGCTGTCACACGCAGG - Intronic
1169497830 20:6132136-6132158 GAGAAGAGACTGAGACACACAGG + Intergenic
1169877774 20:10316634-10316656 GAGTGGAGGCTGTCACACACTGG - Intergenic
1170249548 20:14265015-14265037 GAGCAAAGGCTACTAAACACAGG - Intronic
1170605098 20:17869854-17869876 GAGACGAGGGTCCCACACACGGG - Intergenic
1172631065 20:36378558-36378580 AGGCAGAGGCTGCCACATCCAGG + Intronic
1172945126 20:38681457-38681479 GTGCAGTGCCTGGCACACACAGG - Intergenic
1173943210 20:46929631-46929653 GAGCAGAGGCTCATAAACACTGG + Intronic
1175448129 20:59040487-59040509 GAACAGTGGCTGACACATACTGG + Intronic
1175646122 20:60673314-60673336 GTGCTGAGGCTGTCACTCACTGG - Intergenic
1176089518 20:63312714-63312736 GAGGAGGGGCAGCCACACCCAGG - Intronic
1176340673 21:5692476-5692498 CAGCAGAGGCTGACTGACACTGG - Intergenic
1176472927 21:7124629-7124651 CAGCAGAGGCTGACTGACACTGG - Intergenic
1176504154 21:7631980-7632002 CAGCAGAGGCTGACTGACACTGG + Intergenic
1176782753 21:13218550-13218572 GAGGAGAGGCTACCATAGACTGG - Intergenic
1177823553 21:26058457-26058479 TAGCAGAGGCTCCCACACTATGG + Intronic
1178924224 21:36761724-36761746 GAGCAGAGCCTCCTAGACACAGG - Intronic
1179717721 21:43298296-43298318 GTGCTGTGGCTGCCCCACACTGG + Intergenic
1179925365 21:44531236-44531258 GTGCTGTGGCTGCCACACAAAGG + Intronic
1180881250 22:19204933-19204955 GAGCAGAAGCTCCCTCACATAGG - Intronic
1180905349 22:19406753-19406775 GAGCAGAGGCTGCCCCAGGTGGG + Intronic
1181047504 22:20222630-20222652 CAGCCGAGCCTGGCACACACTGG - Intergenic
1181602745 22:23961795-23961817 GAGCAGCTGCTGCCAGACAGCGG + Intergenic
1181605769 22:23979512-23979534 GAGCAGCTGCTGCCAGACAGCGG - Intronic
1181630327 22:24147764-24147786 AAGCTGAGACCGCCACACACAGG - Intronic
1184086564 22:42269677-42269699 GAGGAGAGGCCGCCCCACACAGG + Intronic
1184243498 22:43223601-43223623 TAGCAGAGGCTGCCCCAAAGAGG - Intronic
1184427759 22:44423222-44423244 GTGCAGGGCCTGGCACACACTGG + Intergenic
1203239936 22_KI270733v1_random:6934-6956 CAGCAGAGGCTGACTGACACTGG - Intergenic
950472421 3:13194357-13194379 TAGGAGAGGCTGCCTCACACTGG - Intergenic
950635849 3:14314038-14314060 GAACAGATACTGACACACACAGG + Intergenic
953029873 3:39172256-39172278 GAGTAGAGGCTGCCAACCCCAGG + Intergenic
954447541 3:50554708-50554730 CAGCAGAGGCTGCAACATCCTGG + Intergenic
954465079 3:50649542-50649564 GGGCAGATGCTGGCACACACAGG - Intergenic
954779951 3:53051543-53051565 GACCAGAGGCTGGCACACCCAGG + Intronic
954801447 3:53189289-53189311 GGGCAGGGGCTGGCAGACACTGG + Intronic
955095746 3:55796151-55796173 TAGCAGAGGAAGCCAGACACAGG + Intronic
955364072 3:58297053-58297075 CGGCTGAAGCTGCCACACACTGG - Intergenic
956160907 3:66351582-66351604 GATCTGAGGCTGCCACTCAGAGG - Intronic
959413838 3:106060198-106060220 GATCTGAGGCTTCCACACAGAGG + Intergenic
961324726 3:126103384-126103406 GAGCAGAAGCTGCGACAGTCAGG - Intergenic
961726493 3:128934210-128934232 GAGCAGCTGCTGGCTCACACTGG - Intronic
962808131 3:138941159-138941181 AAGTAGGGGCTGCCACACAGTGG + Intergenic
962868374 3:139466714-139466736 GATCACAGGCTGCCAGCCACTGG - Intronic
967316390 3:188154753-188154775 GCACAGGGTCTGCCACACACAGG - Intronic
968066328 3:195761672-195761694 GAGCAGAGGCTGCCAGGCCCTGG - Intronic
968480854 4:832501-832523 GAGCAGAGTCAGCCCCACAAAGG + Intergenic
968483468 4:847627-847649 GAGAAGATGCTGTCACACAAGGG + Intergenic
968620728 4:1602319-1602341 GGGCAGTGGGTGCAACACACAGG + Intergenic
968897399 4:3412819-3412841 GAGCATAGGGTGTCCCACACGGG - Intronic
970891352 4:21048603-21048625 GAACAGTGGCTGGTACACACTGG + Intronic
971009780 4:22420993-22421015 GATCAGAGGCTGCCACTTTCTGG + Exonic
971337634 4:25738730-25738752 GAGCAGAGTCTTGCACACAATGG - Intergenic
976824800 4:89249000-89249022 CAGCAGTGGGAGCCACACACTGG - Exonic
979860091 4:125682858-125682880 GAGCCGGGGCTGCCAAGCACGGG - Intergenic
980791973 4:137632090-137632112 TAGCAGTGGCACCCACACACTGG - Intergenic
980828432 4:138100117-138100139 TACCAGTGACTGCCACACACCGG - Intergenic
985361344 4:189178989-189179011 GGACAGAGCCTGCCACAGACCGG - Intergenic
985682766 5:1265195-1265217 GAGCAGAGGCTACCGGGCACAGG - Intronic
985748358 5:1660391-1660413 GGGCAGAAGCTGCCACCCTCAGG - Intergenic
985854823 5:2416658-2416680 GAACAGACACTGGCACACACTGG + Intergenic
986733582 5:10652438-10652460 GAGCAGAAGCTGCCTGACCCTGG - Intergenic
988300932 5:29425840-29425862 GAGCAGAGGTTGCCACAGAATGG + Intergenic
989141906 5:38209863-38209885 GGACAGATGCTGCCACAAACTGG + Intergenic
989184504 5:38610170-38610192 GGGCAGAGGCTGGGACAGACAGG + Intergenic
991399583 5:66239145-66239167 GAACAGTGTCTGCCACACATAGG - Intergenic
992699801 5:79330400-79330422 GAGCAGGCTCTGCCACACAAGGG - Intergenic
993511346 5:88774936-88774958 GAACAGAGGCAGGCACACAGTGG - Intronic
993546461 5:89218765-89218787 GAGCAGAGGATTCCAGACAGTGG - Intergenic
994107871 5:95966450-95966472 AAGCAGAGGCTGCCAGCCCCAGG - Intergenic
994730761 5:103488033-103488055 GAGCAGAGGCTCTCAGAAACAGG - Intergenic
995831283 5:116358640-116358662 GAGCAGATGCTGGGACACACTGG + Intronic
995942827 5:117605583-117605605 GAGCAGAGGTAGCCACATACAGG - Intergenic
997734886 5:136206001-136206023 CAGCACAGGCCGCCAAACACAGG - Intergenic
1001573233 5:172744480-172744502 GTGCAGAGGCTGGAGCACACAGG - Intergenic
1001987419 5:176086475-176086497 GAGCAGGGGCTGCCACTCAGAGG - Intronic
1002324111 5:178394294-178394316 GAACAGTGCCTGCCACACACTGG + Intronic
1003303432 6:4905361-4905383 GAGGAGAGGCAGGCACCCACAGG - Intronic
1004425485 6:15504236-15504258 GAACAGAGGCTGCCGCCCAGAGG - Intronic
1005829156 6:29656924-29656946 GAGCAGAGGCTGCCTGGTACAGG - Intergenic
1006236421 6:32637235-32637257 GAGTAGAGGCTGCATCACAAGGG + Intronic
1006457418 6:34139892-34139914 GAGCAGAGGCTGGTGCACAGTGG - Intronic
1007118694 6:39362646-39362668 GAGCAGAGGTTGCCACCAAGAGG - Intronic
1012422882 6:99084189-99084211 CACCAAAAGCTGCCACACACAGG - Intergenic
1013367312 6:109446010-109446032 GAGGAGAGGCTGCCACGGCCTGG + Intronic
1015705990 6:136088286-136088308 GAGAAGAGGCAGCCCCACAAGGG + Intronic
1017905050 6:158752225-158752247 GTGCAGAGTCTGCCAGACTCAGG + Intronic
1018768072 6:166949755-166949777 GAGCAAAGCCTGCACCACACGGG + Intronic
1019590342 7:1827565-1827587 GAGGGGAGGATGCCACACCCGGG - Intronic
1019611461 7:1938946-1938968 GACCAGAGGCGCACACACACGGG + Intronic
1019705717 7:2496315-2496337 GAGCAGAGGTGGGCACACAGGGG - Intergenic
1019894871 7:3975941-3975963 GGGCTGAGGCTGCCACGCAGAGG + Intronic
1019894884 7:3975992-3976014 GGGCTGAGGCTGCCACGCAGAGG + Intronic
1019894911 7:3976094-3976116 GGGCTGAGGCTGCCACGCAGAGG + Intronic
1019894924 7:3976145-3976167 GGGCTGAGGCTGCCACGCAGAGG + Intronic
1019894937 7:3976196-3976218 GGGCTGAGGCTGCCACGCAGAGG + Intronic
1019894963 7:3976298-3976320 GGGCTGAGGCTGCCACGCAGAGG + Intronic
1019894977 7:3976349-3976371 GGGCTGAGGCTGCCACGCAGAGG + Intronic
1019895003 7:3976451-3976473 GGGCTGAGGCTGCCACGCAGAGG + Intronic
1019895016 7:3976502-3976524 GGGCTGAGGCTGCCACGCAGAGG + Intronic
1019895029 7:3976553-3976575 GGGCTGAGGCTGCCACGCAGAGG + Intronic
1019895073 7:3976722-3976744 GGGCTGAGGCTGCCACGCAGAGG + Intronic
1019895086 7:3976773-3976795 GGGCTGAGGCTGCCACGCAGAGG + Intronic
1019895099 7:3976824-3976846 GGGCTGAGGCTGCCACGCAGAGG + Intronic
1019895112 7:3976875-3976897 GGGCTGAGGCTGCCACGCAGAGG + Intronic
1019895125 7:3976926-3976948 GGGCTGAGGCTGCCACGCAGAGG + Intronic
1019895138 7:3976977-3976999 GGGCTGAGGCTGCCACGCAGAGG + Intronic
1019895167 7:3977087-3977109 GGGCTGAGGCTGCCACGCAGAGG + Intronic
1019895180 7:3977138-3977160 GGGCTGAGGCTGCCACGCAGAGG + Intronic
1019895222 7:3977307-3977329 GGGCTGAGGCTGCCACGCAGAGG + Intronic
1019895249 7:3977409-3977431 GGGCTGAGGCTGCCACACAGAGG + Intronic
1022533005 7:31078788-31078810 GGGGAGAGGGTGCCACACACGGG + Intronic
1022543322 7:31160179-31160201 GAGCAGAGGGTCCCTCACATGGG + Intergenic
1022920327 7:35006495-35006517 GAACAGAGATTTCCACACACTGG + Intronic
1024051436 7:45626256-45626278 GAGCAGAGGCTGGCACGCTGAGG - Intronic
1025246745 7:57323275-57323297 GAGCAGGGGCTGACACAGGCGGG + Intergenic
1026669828 7:72380270-72380292 GAGAAGACACTGCAACACACAGG + Intronic
1029477760 7:100795080-100795102 AAGCAGCGGCTGCCAGAGACTGG - Intronic
1029710082 7:102294709-102294731 GAGGGGAGGCTGCAAGACACAGG - Intronic
1031053681 7:116971137-116971159 GTGCAGAGGCTGTCACAGCCAGG + Intronic
1031127817 7:117794061-117794083 GAACAGTGGCTGGCACACAGTGG + Intronic
1031209794 7:118808391-118808413 GAGGAGAGGCAGGCACACTCGGG + Intergenic
1032000271 7:128260642-128260664 GAGCAGAGCCTCCCCCACGCAGG + Intergenic
1032081086 7:128858777-128858799 GGGCAGAGGCTGGGACACAAGGG + Exonic
1032520037 7:132536916-132536938 AAGCAGAGGCTGACACAGAGTGG - Intronic
1033364089 7:140658283-140658305 GGCCAGGGGCTGCCACACCCTGG + Intronic
1034346212 7:150386843-150386865 GAGCAGAGCCGGGCACACAGAGG - Intronic
1034497101 7:151429613-151429635 GAGGAGAGCCAGCCACAGACAGG - Intronic
1035133425 7:156676405-156676427 GCGCAGAGCCTGCGGCACACAGG - Exonic
1035249275 7:157586544-157586566 AAGGAGAGGCTGCCAGACACCGG + Intronic
1035293974 7:157857446-157857468 GCGCCGAGCCTGCCACACAGAGG - Intronic
1035331122 7:158098175-158098197 AGGCAGAGGCTGCCCCACGCTGG - Intronic
1035608808 8:947349-947371 CAGCAGGGGCTCCCTCACACAGG + Intergenic
1036221991 8:6929009-6929031 GAGCAGAGGCCCCCAGACTCAGG - Intergenic
1037581279 8:20247271-20247293 AAGAAGTGGCTGCCACACCCAGG - Exonic
1039385643 8:37133534-37133556 GAGCAGAGCCTGGAACACACAGG + Intergenic
1040903114 8:52437798-52437820 GGGCAGAGGCTGCCAGATAACGG - Intronic
1041144785 8:54862558-54862580 TAGCAGAGTATTCCACACACAGG + Intergenic
1044119202 8:88374008-88374030 GAGCAGAGGAAGCCACAGTCTGG - Intergenic
1044242477 8:89902797-89902819 GAGCAGCGGCAGCACCACACGGG - Exonic
1044730435 8:95224676-95224698 GAGCAGAGGCTACAACACAGAGG - Intergenic
1046628907 8:116604144-116604166 AAGCAGAGGCTGCATCACAGAGG + Intergenic
1049060234 8:140270864-140270886 GGGCAGAGGCTGGGCCACACAGG + Intronic
1049794612 8:144491116-144491138 GTGCAGAGGCTGCCAGAGCCTGG - Intronic
1050218048 9:3350914-3350936 GATCAGTGGCTGCCAGCCACTGG + Intronic
1051358704 9:16263162-16263184 GAGCAGGGGCTGAGACACACTGG + Intronic
1052819135 9:33125133-33125155 GAGCAGAGACTGCCACAAGATGG + Intronic
1053105647 9:35405736-35405758 GGACTGAGGCTGCCACAGACAGG + Intergenic
1055556889 9:77483347-77483369 GAGCAGTGGCTGCCGAACAGCGG + Intronic
1056627955 9:88269557-88269579 GAGCAGAGACTGCCACATGAAGG - Intergenic
1056687526 9:88778668-88778690 GGGCTGTGGCTGACACACACAGG + Intergenic
1057448323 9:95134743-95134765 GAGCCCAGGGTGCCAGACACTGG + Intronic
1057469236 9:95342888-95342910 GAGTAGAGTGTGCCTCACACAGG - Intergenic
1058505573 9:105662674-105662696 GAGCAAAGCCTGCAACAAACGGG + Exonic
1059470101 9:114498503-114498525 GAGCAGTGCTTACCACACACAGG - Intronic
1060997370 9:127882821-127882843 GAGGAGCGGCTGCCACTCATAGG + Intergenic
1061007389 9:127935851-127935873 CAGCAGAGCCACCCACACACAGG + Intronic
1061011307 9:127956210-127956232 GAACAGGGCCTGGCACACACTGG - Intronic
1061654191 9:132075951-132075973 GAGCTGAGGATCCCACCCACGGG + Intronic
1062379468 9:136280362-136280384 CTGCAGAGGCTCCCACACCCTGG + Intergenic
1203422394 Un_GL000195v1:5517-5539 CAGCAGAGGCTGACTGACACTGG + Intergenic
1186730916 X:12408552-12408574 GAGGAGGGGCTGCCACATACTGG + Intronic
1186776048 X:12865650-12865672 GAGCAGAGCCTGCCTCCCTCTGG - Intergenic
1188743904 X:33817874-33817896 CTGCATGGGCTGCCACACACTGG - Intergenic
1189707059 X:43769358-43769380 GCACCGAGACTGCCACACACTGG - Exonic
1192308845 X:69991923-69991945 GAGAAGTGCCTGCCACCCACTGG + Intronic
1192848034 X:74925637-74925659 CAGCAGAGGCGGCCCCACTCTGG - Intergenic
1193082696 X:77421598-77421620 GAGTAGTGGCTGCCACACTGGGG - Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1194127687 X:90040395-90040417 GGGCAGAGCCTGCCATCCACAGG - Intergenic
1197262593 X:124333952-124333974 GAGCAGCGGATGCCACTCCCAGG + Intronic
1197709189 X:129653964-129653986 GAGCAGAGGCAGCCTCCCCCAGG - Intronic
1198299227 X:135318013-135318035 GAGCATAGGCTACCACACCCAGG - Intronic
1202067890 Y:20959939-20959961 GAGCAAAGGCTGCCACCAGCTGG + Intergenic