ID: 1124381275

View in Genome Browser
Species Human (GRCh38)
Location 15:29168816-29168838
Sequence CTCTGGGCAAGGACCCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 311}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124381267_1124381275 15 Left 1124381267 15:29168778-29168800 CCACATGGTGCCTGCTGTTTGCT 0: 1
1: 0
2: 0
3: 19
4: 282
Right 1124381275 15:29168816-29168838 CTCTGGGCAAGGACCCAGGAGGG 0: 1
1: 0
2: 3
3: 38
4: 311
1124381266_1124381275 16 Left 1124381266 15:29168777-29168799 CCCACATGGTGCCTGCTGTTTGC 0: 1
1: 0
2: 2
3: 28
4: 180
Right 1124381275 15:29168816-29168838 CTCTGGGCAAGGACCCAGGAGGG 0: 1
1: 0
2: 3
3: 38
4: 311
1124381265_1124381275 17 Left 1124381265 15:29168776-29168798 CCCCACATGGTGCCTGCTGTTTG 0: 1
1: 0
2: 2
3: 25
4: 237
Right 1124381275 15:29168816-29168838 CTCTGGGCAAGGACCCAGGAGGG 0: 1
1: 0
2: 3
3: 38
4: 311
1124381269_1124381275 5 Left 1124381269 15:29168788-29168810 CCTGCTGTTTGCTCAATGGCACT 0: 1
1: 0
2: 0
3: 8
4: 132
Right 1124381275 15:29168816-29168838 CTCTGGGCAAGGACCCAGGAGGG 0: 1
1: 0
2: 3
3: 38
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124381275 Original CRISPR CTCTGGGCAAGGACCCAGGA GGG Intronic
900270213 1:1783134-1783156 CTCTGGGCAGGGACCAAGATAGG + Intergenic
900288595 1:1914321-1914343 CCCTGAGCCAGAACCCAGGATGG + Intergenic
900552814 1:3265058-3265080 CTCTGACCCAGGGCCCAGGAGGG + Intronic
900913218 1:5616881-5616903 CTCAGGGCTGGGCCCCAGGATGG + Intergenic
901742835 1:11353484-11353506 ATGTGGCCAAGGACACAGGATGG + Intergenic
902050467 1:13560372-13560394 CTCTGTGCACAGACCAAGGAAGG + Intergenic
902713000 1:18253400-18253422 GACTGGGCCAGGTCCCAGGATGG + Intronic
903015011 1:20355920-20355942 CTCTGGGGAGGAACCCAGGCAGG + Intergenic
903228065 1:21904920-21904942 CTGTGGGCAGTGACCCAGGAGGG - Intronic
904333796 1:29784347-29784369 CTCTGGGCAAGGGCCCTGCACGG + Intergenic
904571732 1:31471117-31471139 CTCTGTGCACAGACCGAGGAAGG - Intergenic
905025855 1:34848818-34848840 CTGTAGGCGAGGAGCCAGGAAGG + Intronic
906148137 1:43572048-43572070 AGGTGGGCAAGGACCAAGGACGG - Intronic
906942864 1:50271487-50271509 CTCTAAGCCTGGACCCAGGAGGG - Intergenic
906942964 1:50272072-50272094 CTCTGGGCTAGAACTCAGGCTGG - Intergenic
909356502 1:74715798-74715820 CTCTGTGCAAGGATTCAGGAGGG - Intronic
914994991 1:152535615-152535637 GTCTGGGGCAGGACCCAGGCAGG + Intronic
915229646 1:154435925-154435947 CTCTGGGGAGGTATCCAGGATGG - Intronic
917312438 1:173691161-173691183 CTCTGGGCATGGACCAAGGAAGG - Intergenic
917830274 1:178875784-178875806 CTCTGGGGAAGGAGCCAGTAGGG + Intronic
920092706 1:203465616-203465638 CTCTGGGCACCGACCTGGGAGGG + Intergenic
920316223 1:205077298-205077320 CTCTGGGCAAGAGCCCAAAATGG + Exonic
920502024 1:206491488-206491510 CTCTGGGAAAGGAGGAAGGACGG - Exonic
920560582 1:206935686-206935708 CTCTGGGAAGGGGCCCAGAATGG - Exonic
920646941 1:207810865-207810887 ATCTGGGCTAGGACTCAGGCAGG - Intergenic
920920467 1:210293569-210293591 CTCAGGAGCAGGACCCAGGAGGG - Intergenic
921269758 1:213457004-213457026 ATCTGGGCTAGGACTCAAGAAGG + Intergenic
922203514 1:223426761-223426783 CTCTGGCCAAGGACACATCATGG + Intergenic
922575136 1:226656148-226656170 CTCTTTGGAAGCACCCAGGAGGG - Intronic
922694330 1:227720577-227720599 CTCTGTGCACTGACCAAGGAAGG - Intergenic
924152404 1:241142288-241142310 CACTAGGCAAGGCCCCAGTAGGG + Intronic
1063313959 10:4983841-4983863 CTCTTGGCCAGGACCAAGAAAGG + Intronic
1065128462 10:22596845-22596867 CTCTGGGCAGGGCCCCTGCAGGG - Intronic
1065622702 10:27599740-27599762 ATCTGCCAAAGGACCCAGGACGG - Intergenic
1065810504 10:29438618-29438640 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1067299662 10:44997001-44997023 CTCTGGGAAACTACCCAGCAGGG - Intergenic
1067714571 10:48679770-48679792 CTCTGTGCCAGGTCCCAGGTAGG - Intergenic
1068204421 10:53830773-53830795 CTCTGGCAAAGCACCCAGGAAGG + Intronic
1068676801 10:59777488-59777510 CACTGGGCAGTGCCCCAGGAGGG + Intergenic
1069661613 10:70127038-70127060 CTAGGGACCAGGACCCAGGAGGG + Intronic
1069720167 10:70544750-70544772 CTCTAGGCAGGTCCCCAGGAGGG - Intronic
1069984925 10:72276528-72276550 CACTGGACAAGGAACCAAGAGGG + Intergenic
1070455925 10:76615297-76615319 CTGTGGGCAATGCCCCAAGATGG + Intergenic
1070456506 10:76622493-76622515 CTGTGGGCAATGCCCCAAGATGG + Intergenic
1070813983 10:79312003-79312025 CACTGGGCAAGGACCTGAGATGG - Intronic
1071283805 10:84125952-84125974 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1071509393 10:86251614-86251636 GGCTGGGCACTGACCCAGGAAGG + Intronic
1071619857 10:87109243-87109265 TTGTGGGGAAGGACCCAGAATGG - Intronic
1071847296 10:89534417-89534439 CTCTGAGCAAAGAACCAGGTAGG + Intronic
1072324142 10:94280053-94280075 CACTTAGCAAGGACCGAGGAAGG + Intronic
1074525000 10:114255374-114255396 ATCTGGCCAAAGTCCCAGGAGGG + Intronic
1074617484 10:115083943-115083965 CTCTGCACAAGGACCCAGTGGGG - Intergenic
1075322544 10:121503757-121503779 CTCTTGGCCATGTCCCAGGATGG - Intronic
1075762929 10:124870363-124870385 CTCTGTGCAAGGAGCGGGGAAGG + Intergenic
1079010711 11:16826132-16826154 CACTGGGCAAGGGCCCAGAAAGG - Exonic
1083261635 11:61526250-61526272 CCCTGGGCAAGGTCCCTGGGAGG - Intronic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1083763559 11:64831722-64831744 CTGTGGGCAAGGACCCCAGCTGG + Intronic
1084105014 11:66975429-66975451 CCCTGGGGGAGGCCCCAGGAGGG + Exonic
1084317430 11:68353709-68353731 CTCTGAGGAAGGACCCTGGTGGG - Intronic
1084443585 11:69190326-69190348 CTCATGGTAGGGACCCAGGAAGG - Intergenic
1085712360 11:78841658-78841680 CTGTGGGAAAGGAGCCAGGGGGG - Intronic
1085713177 11:78848626-78848648 CACTGGTCAAAGACCCATGAGGG - Intronic
1086400382 11:86456629-86456651 CTCTGGGGAAGGACGGAGCAGGG + Intronic
1087004292 11:93453919-93453941 CTCTTGGCAAGGACCGAGAAAGG + Intergenic
1088359839 11:108978496-108978518 CCTTTGACAAGGACCCAGGATGG + Intergenic
1089134563 11:116238805-116238827 CTCTGGGCAGGGCCACAGCATGG + Intergenic
1089218669 11:116852383-116852405 CTCTGGGCTGGGAGTCAGGAAGG - Intronic
1090085062 11:123643215-123643237 GTCTGGGCCAGGCCACAGGAAGG + Intronic
1090341911 11:126030969-126030991 CTTTGGGCAAGAACCTATGAGGG + Intronic
1090644867 11:128759079-128759101 CTCAGGGAAAGGACCTGGGATGG + Intronic
1091656172 12:2348295-2348317 CTCAGGGCCAGCACTCAGGACGG - Intronic
1091983891 12:4891812-4891834 CTCTGGGCAGGGAGCAGGGAGGG + Intergenic
1093965039 12:25315433-25315455 CTCTGGGTAGGTACCCAGTAGGG - Intergenic
1094719996 12:33053117-33053139 CTGAGGGCAAGGGGCCAGGAGGG - Intergenic
1095088468 12:38083568-38083590 ATCTTGCCAGGGACCCAGGAGGG + Intergenic
1095990120 12:48028711-48028733 CACTGGGCAGGGACCCACAAGGG + Intergenic
1096977141 12:55706029-55706051 CTCTGGGAAAGGCCCCAGCTTGG + Intronic
1101244781 12:102875058-102875080 CTCTGGGAAAGCACGCTGGAGGG + Intronic
1101725566 12:107385654-107385676 GCCTGGGCAAGGACCTAGGTGGG - Intronic
1102245897 12:111355611-111355633 CTCTGTGCCAGGCCCCAGGGAGG + Intergenic
1102950508 12:117027795-117027817 CACAGGGCAAGGACTCAAGAGGG - Intronic
1103738440 12:123075751-123075773 CGCTGAGAAAGGACACAGGAGGG + Intronic
1106812034 13:33368217-33368239 CACTGGGCCAGGATCGAGGAGGG - Intergenic
1108589167 13:51896876-51896898 CACTGGGGTAGGACCCAGGCAGG + Intergenic
1109489526 13:63077631-63077653 CTCTGAAAAAGGACCCTGGAAGG - Intergenic
1110833129 13:80054260-80054282 CTCTGGGGGCTGACCCAGGAGGG + Intergenic
1110949378 13:81465182-81465204 CTCTGGGCGAGGAGCCAAGATGG - Intergenic
1111792058 13:92870264-92870286 CTCTGTGCAAGGAGGCAGAAAGG - Intronic
1112889587 13:104213084-104213106 CGCTGGTCATGGACTCAGGAAGG - Intergenic
1113190693 13:107742387-107742409 GTCCTGGGAAGGACCCAGGAGGG + Intronic
1113895486 13:113761398-113761420 GGCTGGGGAAGGAGCCAGGAAGG + Intronic
1114128283 14:19757097-19757119 CTCTGTGAAAGGGCTCAGGAAGG - Intronic
1114623473 14:24113775-24113797 CACTGGGAGAGGCCCCAGGAGGG + Intronic
1115290746 14:31769356-31769378 CTCTAGGTAAGGAGCTAGGAGGG - Intronic
1115649131 14:35390602-35390624 CTCCAGGCAAGGCCCCAGGAGGG + Intergenic
1117179897 14:53181153-53181175 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1119938923 14:78619672-78619694 CTCTTTGCAAGGCGCCAGGAAGG - Intronic
1121116761 14:91349090-91349112 TTACTGGCAAGGACCCAGGAGGG - Intronic
1122371038 14:101229190-101229212 CTCTGGGCAAGGGCAGGGGAGGG - Intergenic
1124381275 15:29168816-29168838 CTCTGGGCAAGGACCCAGGAGGG + Intronic
1124438469 15:29670323-29670345 CTCTGGGGCAGGACGCATGAAGG + Intergenic
1125728345 15:41879548-41879570 CTCTGGCCAAGGCTCCCGGATGG - Intronic
1126442904 15:48711200-48711222 CTGTGGGCAATGTCACAGGATGG + Intergenic
1127328253 15:57916067-57916089 CACTGGGTGAGGACCCAGGAAGG + Intergenic
1127369882 15:58329920-58329942 CTGTAGGCCAGGAGCCAGGATGG - Intronic
1127488656 15:59441668-59441690 CGCAGGGCAGGGACCAAGGAAGG - Intronic
1127801736 15:62483064-62483086 CTCTGAGCAAGAACAGAGGAAGG - Intronic
1128090027 15:64912943-64912965 TTCTGGACAAAGACCCAGCATGG + Intronic
1128220764 15:65966862-65966884 CTCTGGGAAAGAGCCCAGGGTGG - Intronic
1128757768 15:70195096-70195118 CTGTGGGAAAGGACCCATGAGGG - Intergenic
1129408931 15:75338285-75338307 CTCTGAGCCAGTCCCCAGGAAGG + Intronic
1129413193 15:75360993-75361015 CTCATGGCAAGGGCCCAGGGTGG + Intronic
1129462103 15:75704658-75704680 CTCGGGGCAGGGACACTGGAGGG - Intronic
1129674690 15:77626154-77626176 CTCTGGGCTAGGGCCTAGGAAGG + Intronic
1129733013 15:77942501-77942523 CTCTGAGCCAGTCCCCAGGAAGG - Intergenic
1130194420 15:81765851-81765873 CTCTTGGGAAGGACAGAGGAAGG + Intergenic
1130865412 15:87929495-87929517 CAGAGGGCAGGGACCCAGGAAGG - Intronic
1131277204 15:90992120-90992142 CTCTGAGCAAAGACCTAAGAAGG - Intronic
1131593613 15:93774293-93774315 TTCTGAGCAAGCACCTAGGATGG - Intergenic
1131623262 15:94089766-94089788 CCCTGGTCAATGACCCAGCAAGG - Intergenic
1132064809 15:98722051-98722073 CTCTGGCCAAGGAACTAGCAAGG - Intronic
1132558856 16:584457-584479 TACTGGGCCAGGACCCACGAGGG - Intergenic
1133481816 16:6178140-6178162 ATATGGGCAAGGACACAGGCTGG - Intronic
1135842949 16:25893395-25893417 CTGTGGACAAAGTCCCAGGAAGG + Intronic
1136098168 16:27973906-27973928 CGCAGGGCCAGGACCCAGGCTGG - Intronic
1137219291 16:46430810-46430832 GTCTGGGCTAGGATCCAAGAAGG + Intergenic
1137236690 16:46623661-46623683 CTAGGGGCAAGGCCCCAGGGTGG + Intergenic
1137875934 16:51996752-51996774 CTCTGGGAAATGAACCAGTAGGG + Intergenic
1138548095 16:57731262-57731284 CTCTGGCTGAGGCCCCAGGAGGG - Exonic
1139293979 16:65883983-65884005 CTCTAGGCAAGGAGAGAGGAAGG + Intergenic
1139967212 16:70752453-70752475 CTCTGGGTCAGGGCCCAGGATGG - Intronic
1141264054 16:82479914-82479936 CTCTGGGGAAAGTCTCAGGATGG - Intergenic
1141980945 16:87550367-87550389 ATCTGGGCAGTGGCCCAGGAAGG - Intergenic
1142162971 16:88568774-88568796 CTCTGGGGCAGAGCCCAGGAAGG + Intergenic
1142639790 17:1279357-1279379 CTCTGGGCAGGGTCTCTGGATGG - Intergenic
1142808191 17:2382652-2382674 CACTGAGCATGCACCCAGGAAGG + Intergenic
1143422931 17:6809990-6810012 ATCTGGGCAAATACCAAGGAAGG + Intronic
1143577664 17:7804080-7804102 CTGTTGGCAATGACCCAGGCAGG + Intronic
1143862221 17:9899250-9899272 TTCTGGGTTAGGATCCAGGATGG + Intronic
1144493301 17:15732455-15732477 CTCTGGGCAGGTGCCGAGGAGGG + Intronic
1144799313 17:17914141-17914163 CTCTGGGCGTGGACAGAGGAGGG + Intronic
1144906960 17:18644197-18644219 CTCTGGGCAGGTGCCGAGGAGGG - Intronic
1145254478 17:21315157-21315179 ATCAGGGAAAGGACCCGGGATGG - Exonic
1145322117 17:21772803-21772825 ATCAGGGAAAGGACCCGGGATGG + Intergenic
1145869999 17:28266206-28266228 CTCTGGTGAAGGCCCCAAGATGG + Intergenic
1146884089 17:36459427-36459449 TTGTGGGCAGGGACCCAGCATGG - Intergenic
1147176534 17:38659325-38659347 CTCTGGGCAAGGACACAATAGGG - Intergenic
1147445768 17:40474485-40474507 CACTGAGCCAGGAACCAGGAGGG - Intergenic
1147548407 17:41420886-41420908 CTCTGGCCATGGAGCCAGCATGG - Exonic
1148816484 17:50331623-50331645 TTCTGGGCAAAGCACCAGGAGGG - Intergenic
1150132534 17:62677116-62677138 CTCTGGGGTTGGAGCCAGGAGGG - Intronic
1151508797 17:74545807-74545829 CACTGTGCAAGACCCCAGGAGGG + Exonic
1152011407 17:77720948-77720970 ATCTGGGCATTGACCCAGGTTGG + Intergenic
1152082479 17:78196869-78196891 CCCAGGGCAAGAACACAGGAGGG - Intronic
1152585817 17:81189029-81189051 CACTGGGGAAGGTCCCAGGCAGG - Intergenic
1152936269 17:83138977-83138999 CTCTGGGCTGGAACCCAGAATGG + Intergenic
1157309537 18:46541924-46541946 CTCTAGGCAAGGCCCCAGGCTGG - Exonic
1159914022 18:74173107-74173129 CTCTGCGCAGGGGCCCAGAAAGG + Intergenic
1161485240 19:4531896-4531918 CTCTGGGCCAGGACGAGGGATGG + Intronic
1162198969 19:9007609-9007631 CACTGTTCAGGGACCCAGGAAGG + Intergenic
1163402493 19:17102529-17102551 CACAGGGCCAGCACCCAGGATGG - Exonic
1163819467 19:19487727-19487749 CTGTGGGCCAGGCCCCAGGAGGG + Intronic
1163927582 19:20360635-20360657 CTCTGTGCACAGACCCAGGAAGG + Intergenic
1164610232 19:29626733-29626755 CTCAGGGCATGGGCCCAGGATGG + Intergenic
1165072960 19:33266099-33266121 CACTGAGCAAGGACCCAGATGGG - Intergenic
1165094353 19:33402361-33402383 GGCTGGGCAGGGACCCCGGATGG + Intronic
1165278219 19:34773011-34773033 CTGTCGCCAAGGCCCCAGGAAGG + Exonic
1166783316 19:45353333-45353355 CCCTGGGGAAGGACCCAGGGAGG + Exonic
925731825 2:6924532-6924554 AGCAGGGCAAAGACCCAGGACGG + Intronic
926696297 2:15771881-15771903 CCCAGGGCAAGGGCCCAGAAAGG - Intergenic
927208665 2:20625493-20625515 CTCAGGGCTAGGACTCAGGAGGG + Intronic
927459712 2:23287516-23287538 GTCTGGGAAAGGTGCCAGGAGGG - Intergenic
931852699 2:66268827-66268849 ATCTGGTCAAGGAAACAGGATGG + Intergenic
931984621 2:67729736-67729758 CTCAGGGCAAGGCCCAAGGATGG - Intergenic
932200080 2:69818443-69818465 ATGTGGGCAAGCAGCCAGGAGGG - Intronic
932374419 2:71223006-71223028 CTCTGGGGAAAGGCCCAGGTTGG - Intronic
932438809 2:71718887-71718909 CCCTTGGCAACGACCCAGCAAGG - Intergenic
933390247 2:81657869-81657891 CTCTGTGCACAGACCAAGGAAGG - Intergenic
933708650 2:85309333-85309355 CTGTGGGCATGGACCCAAGGGGG - Exonic
933812788 2:86043520-86043542 CTCAGGGATAGGAACCAGGATGG + Intronic
934548183 2:95236050-95236072 CTGTGGGCAAGGAGTCAGGCTGG + Intronic
934870320 2:97858854-97858876 CTCTGGACAAGGACTCAGCCCGG + Intronic
936072442 2:109380364-109380386 CCCTGTGCCAGGACCCAGAAGGG - Intronic
937247050 2:120500299-120500321 CACTGGGCATGGGGCCAGGAGGG - Intergenic
937379675 2:121365368-121365390 CTCTGGGAGAGGAGGCAGGAAGG - Intronic
942209469 2:173655879-173655901 CTCTGGGAAAGGAAACTGGATGG - Intergenic
942928436 2:181459768-181459790 ATCTTGGCAAGGTCTCAGGAGGG + Intronic
942944408 2:181657121-181657143 CGCAGGGCAGGGACCCAGGAGGG + Intronic
945719912 2:213407016-213407038 CTCTGTGCACAGACCAAGGAAGG + Intronic
946094676 2:217263188-217263210 CTATGGGCGAGGAGCCAGCATGG - Intergenic
947556769 2:231099919-231099941 CTCTGTGCACAGACCAAGGAAGG - Intronic
947714383 2:232332395-232332417 GTCTGGCCAAGGGCACAGGAGGG + Intronic
947733590 2:232443774-232443796 GTCTGGCCAAGGGCACAGGAGGG + Intergenic
947977323 2:234378047-234378069 CTCTGGGAAAGATCCTAGGAAGG - Intergenic
948429549 2:237911164-237911186 CCCTGGGCAAGGTCGCAGGCTGG - Intronic
949043031 2:241858118-241858140 ATCTGGGCAGAGACCCAGGCGGG + Intronic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1169708072 20:8529717-8529739 ATCTGGGGAAGGGCACAGGATGG - Intronic
1170554803 20:17506250-17506272 CTCTGGACAAGGGCCCAGGCTGG + Intronic
1171046461 20:21812597-21812619 CACTGGGCTAGGAGCCAGGCAGG - Intergenic
1171288693 20:23966867-23966889 CCCTGGGCCAGGACCCAGGAAGG + Intergenic
1172624383 20:36338873-36338895 TTCTGGGCAAGGAAACAGCATGG + Intronic
1172702502 20:36862197-36862219 CCCTGGGTAACGACTCAGGATGG + Intronic
1172778298 20:37420646-37420668 CTGTGGGCAAGGAACGAGGAGGG - Intergenic
1173793015 20:45840503-45840525 CCCTGGGACAGCACCCAGGAGGG - Intronic
1176137284 20:63529803-63529825 CTGCGGGGAAGGCCCCAGGAAGG - Intronic
1176290793 21:5043626-5043648 CACTGGGCCAGGACCCAAGATGG + Intergenic
1177174496 21:17689526-17689548 CTCTGGGCAAGAACTCGGGAGGG - Intergenic
1177774528 21:25553380-25553402 TTCTGAGCAAGGACCCATGAGGG + Intergenic
1178836757 21:36104961-36104983 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1179021357 21:37643747-37643769 ATCTGGGCAATTATCCAGGAAGG + Intronic
1179515346 21:41902768-41902790 CTCTGTGCCAGGAACCAGGGAGG - Intronic
1179625264 21:42645707-42645729 CTGAGGGCAAGGACCGAGGGAGG - Intergenic
1179866462 21:44220015-44220037 CACTGGGCCAGGACCCAAGATGG - Intergenic
1180078056 21:45473173-45473195 TGCTGGGCAAGGACACAGGAGGG - Intronic
1180106653 21:45623116-45623138 CCCTGAGCACGGGCCCAGGAGGG - Intergenic
1180131367 21:45829188-45829210 CTCTGGGCCAGGGCTCTGGATGG + Intronic
1180208702 21:46280022-46280044 CTCTTGGCAAGGCCGCAGGGAGG - Exonic
1180214405 21:46315342-46315364 CTCAGGGCCAGGCCCCAGCAAGG - Intronic
1181608746 22:23998785-23998807 CTGTGGGAGAGGACCCAGGTGGG - Intergenic
1182347775 22:29678814-29678836 CACTGGGCAGGGCCCCAGCATGG + Intronic
1183700715 22:39449459-39449481 CTCTGGGCAGGGAGCAGGGAGGG + Intergenic
1184067397 22:42128496-42128518 CTCTGGGCAAGGAGAGAGGGTGG - Intronic
1184194969 22:42921435-42921457 GTCTGGGCAATGCCCCAGGTGGG - Intronic
1184604123 22:45562568-45562590 GTCTGGGCAAGGGCCTGGGAAGG + Intronic
1185223323 22:49639949-49639971 CTCTGGGTAAGGACCCTAGAAGG - Intronic
950846896 3:16023506-16023528 CTCTGTGCACAGACCAAGGAAGG - Intergenic
951792765 3:26504588-26504610 CTCTGAGCAAGGACGGAGCAAGG - Intergenic
952520419 3:34151499-34151521 CGCTGGGCAGGGACCCAGGGAGG + Intergenic
953349805 3:42206973-42206995 CACTGGGAAAGAACCCAGGGAGG - Intronic
954200763 3:49021909-49021931 CTATGGGCAAGGGCCCGGGGCGG + Exonic
954324947 3:49858480-49858502 CCCAGGGTAAGGACCCAGTAAGG + Exonic
954390437 3:50265565-50265587 CCCAGAGCAAGGACCCAGGCAGG + Intergenic
954604412 3:51897649-51897671 CTCTGTGCACAGACCAAGGAAGG + Intronic
955400030 3:58585106-58585128 CTGCGGGTAAGGAGCCAGGAAGG - Intronic
958182059 3:90072550-90072572 CGCTGGTCATGGACTCAGGAAGG - Intergenic
960247043 3:115411375-115411397 CTGTGGGCAAGAACCAGGGAAGG + Intergenic
960720836 3:120623059-120623081 CTCTGTGCACAGACCAAGGAAGG - Intergenic
961465627 3:127079316-127079338 CTGTGTGCAAGGACTCTGGATGG + Intergenic
961563684 3:127748324-127748346 CTCTGGGGAATGATCAAGGATGG - Intronic
961749810 3:129088359-129088381 CTAGGGGCAAGGCCCCAGGGTGG + Exonic
962274570 3:134002290-134002312 CCCTGGGCCAGGAGGCAGGAGGG - Intronic
962324964 3:134425241-134425263 GAATGGGCAAGGCCCCAGGAAGG - Intergenic
967156055 3:186693402-186693424 TTCTGGGCACGCAGCCAGGAAGG - Intergenic
967398680 3:189035911-189035933 CTCTGGGTATAGACCCAGTAAGG - Intronic
967977731 3:195044776-195044798 CTCAGGGAAAGGAGCCAGGCTGG + Intergenic
967997202 3:195175641-195175663 CTCGCTGCAAGGATCCAGGAAGG - Intronic
968690525 4:1987621-1987643 CGCTGGGCATGGAGACAGGAAGG - Intronic
969131758 4:4995445-4995467 CCAGGGGAAAGGACCCAGGAGGG + Intergenic
969185269 4:5469750-5469772 CTCTGGCCAACAACACAGGAAGG + Intronic
969278882 4:6155830-6155852 GTCTAGGGCAGGACCCAGGAAGG - Intronic
970093015 4:12430877-12430899 CTCTGTGCACAGACCAAGGAAGG - Intergenic
970299744 4:14668570-14668592 CTCTGGGCAAGGCCCTATAAAGG - Intergenic
972308332 4:37853909-37853931 CTCAGGGCAAGGAACCGGGATGG + Intronic
972816072 4:42646663-42646685 CTCTGGTCCAGAACCCAGGCTGG + Intronic
973730958 4:53821844-53821866 CCCTGGGGAAGGAGCCAGCAAGG + Intronic
974436220 4:61860623-61860645 CTCTGGGGAAGGACCGCAGATGG - Intronic
976784990 4:88809215-88809237 CCCAGGGCAAGTACCCAGAATGG + Intronic
979228855 4:118323269-118323291 CTCAGGGCAAAGATCCAAGAAGG - Intronic
982073299 4:151714606-151714628 CTCTTGGCAAGGACCCAGATGGG + Intronic
985057592 4:186048932-186048954 CGCTGGTCATGGACTCAGGAAGG - Intergenic
985691165 5:1313478-1313500 CTTTGGGCACAGACCCAGGGGGG - Intergenic
986338222 5:6770229-6770251 CTCAGGCCACGGACCAAGGAAGG - Intergenic
986421736 5:7591713-7591735 CTCTGGGCAAAAACCCAGGAAGG + Intronic
987304547 5:16625194-16625216 CTCTGTGCTAGGAACCAGGGAGG + Intergenic
989615838 5:43335889-43335911 CTCTGTGCACAGACCAAGGAAGG - Intergenic
991492192 5:67194434-67194456 CTCTGGGTGAGGCCGCAGGATGG - Intronic
995750814 5:115451707-115451729 CTCTGGGCACAGACTCAGGTGGG + Intergenic
995781375 5:115779468-115779490 GTTTGGGCTAGGACCTAGGAGGG + Intergenic
996099928 5:119435780-119435802 CTCTGTGCACAGACCAAGGAAGG + Intergenic
998487280 5:142513782-142513804 CTCTGGCCAAGGGGACAGGAAGG - Intergenic
998552897 5:143094272-143094294 CTCTGTGCACAGACCAAGGAAGG - Intronic
998566250 5:143218372-143218394 CTATGTGCAAGGACCTAGCATGG + Intronic
998939059 5:147260961-147260983 CTCTGCGCACAGACCAAGGAAGG - Intronic
1001306382 5:170576956-170576978 CTGTGGGAAGGGACCCAGCAGGG + Intronic
1001579650 5:172789989-172790011 CTGTGGGCATCTACCCAGGAAGG + Intergenic
1001925440 5:175632914-175632936 GTGTGGGCATGGGCCCAGGAAGG - Intergenic
1001940992 5:175739274-175739296 CTCCAGGCATGGACCCAGCAGGG + Intergenic
1002418247 5:179132055-179132077 CCCTGGGAAAGGGCCCAGGTGGG + Intronic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1002988077 6:2210709-2210731 CTCTGGGCACGGCACCTGGAGGG + Intronic
1003135291 6:3430476-3430498 TTGTGGGCCAGGCCCCAGGAGGG + Intronic
1005353630 6:24961040-24961062 CTCTGGGCAAGGTGCCATGCTGG + Intronic
1005952886 6:30644446-30644468 CTCTGGGCATGGAGCAGGGAAGG - Intronic
1006981425 6:38151205-38151227 CTCTGGGTCAGGAACAAGGAGGG - Intronic
1007208148 6:40169553-40169575 CTCTGGGCATGTGCCTAGGAGGG + Intergenic
1007227743 6:40326833-40326855 TGCTGGGACAGGACCCAGGAAGG + Intergenic
1013295952 6:108758599-108758621 CTAAGGACAGGGACCCAGGATGG + Intergenic
1014145457 6:117993161-117993183 CTCTGGCCAGGCACCCATGAGGG - Intronic
1017557137 6:155583612-155583634 TTCTGGGCCAGGTCCCAGTAAGG + Intergenic
1018137032 6:160788923-160788945 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1018191715 6:161314886-161314908 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1019350618 7:552373-552395 CTCTGGAGAAGGACCCGGGCGGG - Intronic
1019652377 7:2167017-2167039 CACGGGGCTAGAACCCAGGAAGG + Intronic
1021194981 7:17665113-17665135 GGCTGGGCAGGGAGCCAGGAGGG - Intergenic
1021564978 7:22008133-22008155 CCCTCGGCAAGGACCCCTGAGGG - Intergenic
1022654247 7:32304325-32304347 CTCTGTGCCAGGGCCGAGGATGG - Intergenic
1023436732 7:40147593-40147615 CTCTGTGCACAGACCAAGGAAGG - Intronic
1023798578 7:43813949-43813971 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1024806829 7:53151633-53151655 GTCTGGGCTAGAATCCAGGAAGG + Intergenic
1026036914 7:66836605-66836627 CTCTGGGCAGGGACAAGGGAGGG - Intergenic
1028333503 7:89624846-89624868 CTCTGCGCACAGACCAAGGAAGG + Intergenic
1028793416 7:94878423-94878445 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1029019156 7:97346041-97346063 CTCTGGGCATGGCCATAGGATGG + Intergenic
1029594129 7:101527889-101527911 CTCTGGTCACAGAGCCAGGAGGG + Intronic
1029712693 7:102308297-102308319 CTCTGGGCCTGGCCCCAGCAGGG + Intronic
1033682170 7:143605151-143605173 CTCTGGGCTATGACCTATGATGG - Intergenic
1033702719 7:143856762-143856784 CTCTGGGCTATGACCTATGATGG + Intronic
1034536208 7:151727475-151727497 CCCTGGGCAGGGACTCTGGAAGG + Intronic
1035033990 7:155883644-155883666 CTCTGCTCAGGGACCCAGGGTGG - Intergenic
1035787400 8:2272412-2272434 CTCACTGGAAGGACCCAGGATGG - Intergenic
1035805407 8:2449304-2449326 CTCACTGGAAGGACCCAGGATGG + Intergenic
1036105155 8:5830296-5830318 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1036462186 8:8963297-8963319 CTCTTGGAAAGGAACCAGGCGGG + Intergenic
1038406215 8:27324918-27324940 CTCTGGGCGGGGCCCCTGGAAGG + Intronic
1038544028 8:28412025-28412047 CCCTGGGCAAGGGGCCGGGAGGG + Intronic
1039020053 8:33195342-33195364 CTCTGGCCAATAGCCCAGGAAGG - Intergenic
1040621212 8:49095258-49095280 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1042498643 8:69485039-69485061 CTCTGAGCAATGACTCAGGAAGG + Intronic
1042970499 8:74402688-74402710 CTTTGGGGAAGGAGCCAAGATGG - Intronic
1045495212 8:102702393-102702415 CTCTGTGCCAGCACCCAGCAAGG - Intergenic
1047340255 8:123974255-123974277 GTCTGGGAAAGGAGACAGGAAGG + Intronic
1048265474 8:132981718-132981740 CTCTGGGGTGGGACCCAGCAAGG + Intronic
1048358702 8:133675697-133675719 CTCTTGGCCAGGTCCCAAGAGGG + Intergenic
1049062276 8:140285791-140285813 CTCTGGGCATGGACCCAGCGGGG - Intronic
1049197592 8:141324225-141324247 CTCTGGGCTGGGCACCAGGACGG - Intergenic
1049461715 8:142732638-142732660 CTCTGTGCACAGACCAAGGAAGG - Intronic
1049610373 8:143552474-143552496 CTCAGGGCAGGGACCCCAGAAGG + Intergenic
1049826261 8:144670698-144670720 CTCAGGGCAAGCCTCCAGGAGGG - Intergenic
1052989413 9:34510377-34510399 TTCTGGGGAAGGAGGCAGGAAGG + Intronic
1054995939 9:71389472-71389494 CTCTGGGTAGATACCCAGGAGGG - Intronic
1055595634 9:77862235-77862257 CACTAGGCAATGCCCCAGGAGGG + Intronic
1056415010 9:86367284-86367306 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1057116491 9:92527791-92527813 CTTAGGCCAAGGACCCAGGATGG - Intronic
1057221187 9:93258874-93258896 CTGTGGGCAGGGACCCTGGTTGG + Intronic
1061076011 9:128341630-128341652 CTATGGGCAGGGACCAAGCAGGG + Intronic
1061280860 9:129597165-129597187 GTCTGGCCAAGGGGCCAGGAGGG + Intergenic
1061680116 9:132238841-132238863 CTGTGGGCAGGGAACCAGGGAGG - Intronic
1061773661 9:132946097-132946119 CACTGCTCAAGGGCCCAGGAGGG - Intronic
1062343811 9:136105578-136105600 CTCTGAGCCAGGTCCCTGGAAGG + Intergenic
1185799185 X:2994242-2994264 CTCAGTGCAGGGAGCCAGGATGG - Intergenic
1186400007 X:9249206-9249228 CTCTTGGCACCCACCCAGGAAGG + Intergenic
1189034150 X:37479030-37479052 CTCTGTGCACAGACCAAGGAAGG + Intronic
1189481658 X:41396657-41396679 CTTTGGGGAGGGACCCAGGAAGG - Intergenic
1191890251 X:65932222-65932244 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1197773268 X:130103974-130103996 CTCTGGGCATTGGCCCAGAATGG + Intronic
1198437431 X:136630784-136630806 TTCTGTGCCAGGACCCAGGATGG - Intergenic
1199637266 X:149825746-149825768 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1199637770 X:149829861-149829883 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1200585734 Y:5003066-5003088 CTGCGAGCCAGGACCCAGGAGGG - Intronic
1201611227 Y:15845200-15845222 CCCTGGTCAAGCTCCCAGGAAGG - Intergenic
1201900272 Y:19041390-19041412 CTCTGTGCACAGACCAAGGAAGG - Intergenic