ID: 1124381579

View in Genome Browser
Species Human (GRCh38)
Location 15:29172198-29172220
Sequence CCTGAAGTCCAGTTGGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124381579 Original CRISPR CCTGAAGTCCAGTTGGTCCC TGG (reversed) Intronic
900648046 1:3717865-3717887 CCTGGGGTCCAGTTAGTGCCAGG + Intronic
902539954 1:17147319-17147341 CCTGAAGACCTGTTCCTCCCAGG - Intergenic
903892468 1:26578836-26578858 TCTGGAGTCCAGTGAGTCCCTGG - Intergenic
904375078 1:30075891-30075913 AATGAAGTCCAGGTGGTCTCAGG + Intergenic
910114483 1:83716938-83716960 GCTGAACTCCTGTTGGTCCTTGG - Intergenic
914912276 1:151797233-151797255 ACTGAAGTCCATTTACTCCCTGG + Intergenic
917031731 1:170700238-170700260 CAGGAAGTCCAGTAGGTCTCAGG + Intronic
924616468 1:245615823-245615845 ACTGAAGTCAAGTGAGTCCCAGG - Intronic
924862735 1:247942386-247942408 CCTGAATTCCAGTGGGTCCACGG + Intronic
1065419237 10:25523229-25523251 CCTGAAGTCCTGTGGATCCAGGG + Intronic
1065973448 10:30822893-30822915 CCTGAAATCCAGCTGTCCCCAGG + Intronic
1068750094 10:60582544-60582566 CCTGAAGTCCCATTGGGCCTTGG - Intronic
1069632006 10:69902798-69902820 CCAGAGGTCCACTTGGTCCAGGG - Exonic
1070263359 10:74879259-74879281 CCAGAAAACCACTTGGTCCCAGG - Intronic
1070565596 10:77601763-77601785 CTTGAAGTCCATGTGGTTCCTGG - Intronic
1070660293 10:78300803-78300825 CCTGAAGCTCAGCTGCTCCCTGG - Intergenic
1072459588 10:95606884-95606906 CCTCAAGTCCTACTGGTCCCCGG + Exonic
1077077695 11:708853-708875 CCTGAAGTCCAGAGGGAGCCCGG - Intronic
1081794383 11:45809567-45809589 CCTGAAGTCCAGATCGGTCCAGG - Intronic
1081896341 11:46590245-46590267 CCTGTAGTCCACTTGAACCCAGG + Intronic
1084769737 11:71334854-71334876 CCTGAAGTCCTATTGGGCTCAGG - Intergenic
1084955630 11:72689780-72689802 CCTGCAGCCCAGTTGGTTCCAGG - Intronic
1085202187 11:74708471-74708493 CCTCAAGGCCATTTGCTCCCAGG - Intronic
1086324452 11:85683505-85683527 GCTTAAGGCCAGTTGGTCACTGG - Intergenic
1093050267 12:14496286-14496308 GCTGAGGTCCTGTTGATCCCAGG - Exonic
1093580750 12:20782192-20782214 CCTAAATTCCAGGTAGTCCCCGG + Intergenic
1095943715 12:47741648-47741670 CCTGGCATCCAGCTGGTCCCCGG - Intronic
1102146914 12:110661203-110661225 CCTGAAGTCAAGGGGGGCCCTGG + Exonic
1102385323 12:112504164-112504186 CCTCAAGTCCTGGTGCTCCCTGG - Intronic
1102472709 12:113168523-113168545 CCTGCAGTCCTGCTGGTTCCCGG - Intronic
1103339439 12:120213679-120213701 CCTCCAGTCCAGTAGGTCCTGGG - Intronic
1104438740 12:128778054-128778076 GCTGCATTCCAGGTGGTCCCTGG + Intergenic
1113681154 13:112246046-112246068 CCTCAGGTCCAGTTGGACGCAGG - Intergenic
1113730885 13:112640807-112640829 CCGCAATTCCAGTTGTTCCCAGG - Intergenic
1113920793 13:113908253-113908275 GCTGAAGTCCAGGTGGTTTCTGG + Intergenic
1115747530 14:36452524-36452546 GCTGAAATCCAGATGGTGCCAGG - Intergenic
1118505084 14:66402437-66402459 CCTGTATTCCAGATGTTCCCAGG - Intergenic
1121121306 14:91377426-91377448 CCTGAACTCCACTTGCTCGCTGG - Intronic
1122063188 14:99150752-99150774 CCTGAATTTCAGATGTTCCCAGG - Intergenic
1122269813 14:100563800-100563822 CCTGAAATCCGTTTGTTCCCTGG - Intronic
1122378651 14:101286213-101286235 CCTGAAGTCCAGGAGGAGCCCGG + Intergenic
1124381579 15:29172198-29172220 CCTGAAGTCCAGTTGGTCCCTGG - Intronic
1126716726 15:51525673-51525695 CCTGAAGTCCTGGTGGCCACAGG + Intronic
1127292331 15:57581721-57581743 CCTGAAGTCCCGCAGCTCCCTGG + Intergenic
1130648663 15:85749899-85749921 CCTTAAGTCCAGCTGGGCCTTGG + Intergenic
1131383099 15:91980751-91980773 ACAGAAGTCCAGTTGTTCCTGGG - Intronic
1131731279 15:95283874-95283896 CGTGAAGTCCCCTTGGCCCCTGG - Intergenic
1132090989 15:98947899-98947921 CTTGAGGTCCAGTTGGGCCAAGG - Intronic
1138443632 16:57049942-57049964 GCTGAAGTCCAGTGATTCCCCGG + Intronic
1138512224 16:57515330-57515352 CCTGCAGTCCAGGTGGGCCCCGG - Exonic
1143220171 17:5255039-5255061 CCTGAAGGCCAGTTGGGTGCAGG - Intergenic
1144966379 17:19079175-19079197 CCTGGAGTCCAGCTGGGCACGGG + Intergenic
1144981539 17:19172882-19172904 CCTGGAGTCCAGCTGGGCACGGG - Intergenic
1144986685 17:19205357-19205379 CCTGGAGTCCAGCTGGGCACGGG + Intergenic
1145041047 17:19578961-19578983 CATGTAGACCAGTTGGTCCTCGG - Exonic
1145303147 17:21654496-21654518 CCTGAAGTCCAGTATCTACCTGG - Intergenic
1145346891 17:22047345-22047367 CCTGAAGTCCAGTATCTACCTGG + Intergenic
1148455825 17:47810928-47810950 CCACAAGACCAGTTGGTTCCAGG + Intronic
1152616293 17:81339462-81339484 CTTCATGTCCAGTTGGTCCCAGG - Intergenic
1153187825 18:2504652-2504674 CTTGAAGTCTAGTTTGTACCTGG + Intergenic
1158012855 18:52748661-52748683 CCTGATGTTCAATGGGTCCCAGG + Intronic
1162312715 19:9916592-9916614 CCTGGAGCCCAGTTGGTCTTAGG - Intronic
1163644125 19:18478721-18478743 TCTGAAGTCCAGTTGGGTCTGGG - Intronic
1166961110 19:46496217-46496239 CCTGAATTCCACCTGGCCCCTGG - Exonic
927492785 2:23531537-23531559 AGTGAAATCCCGTTGGTCCCAGG - Intronic
930027349 2:47037120-47037142 CCTCAGGTCCACTTTGTCCCCGG + Intronic
930090075 2:47525556-47525578 CTTGAAGTACAGATGGCCCCTGG - Intronic
933970967 2:87469376-87469398 CAGGAAGTCCTGTAGGTCCCGGG - Intergenic
934951407 2:98578249-98578271 CCTGATGTCCAGTGTGACCCTGG + Intronic
936322759 2:111480813-111480835 CAGGAAGTCCTGTAGGTCCCAGG + Intergenic
936959613 2:118059183-118059205 CATGAAGCACAGTTGGTCCATGG + Intergenic
937896694 2:126981531-126981553 CTTGAAGTCCTGGTAGTCCCCGG + Intergenic
938307731 2:130266407-130266429 CCTGAGGTCCAGATGGACCCTGG - Intergenic
938447607 2:131390434-131390456 CCTGAGGTCCAAATGGACCCTGG + Intergenic
939561877 2:143742111-143742133 TCCAAAGACCAGTTGGTCCCAGG - Intronic
943834375 2:192500526-192500548 CCTGAAGTCCAGTGGTCTCCAGG - Intergenic
945610463 2:211994926-211994948 CTTGAAGTTCAGTTGATCCTAGG - Intronic
947142445 2:227031972-227031994 CCTGATCTCCAGGTGGACCCGGG + Exonic
1173193865 20:40897526-40897548 CCTGCAGGCCAGGTGGTCCTGGG - Intergenic
1174384605 20:50179674-50179696 CCTGAAGTCCAGCTGGAGCCTGG + Intergenic
1174657303 20:52182299-52182321 CCTGGAGTCCTGTTTGTGCCTGG - Intronic
1175302814 20:57954864-57954886 CCAGAAGTCAAGTTGGTACTGGG + Intergenic
1176411143 21:6450241-6450263 CCTGACCTCCAGGTGGGCCCAGG + Intergenic
1179030799 21:37718040-37718062 CCTAAAATCCAGTTCCTCCCAGG + Intronic
1179686636 21:43058563-43058585 CCTGACCTCCAGGTGGGCCCAGG + Intronic
1179948752 21:44697954-44697976 CCAGAAGTCCAGCTGCTGCCAGG + Exonic
1184064019 22:42105582-42105604 CCTGCAGACTATTTGGTCCCGGG + Intergenic
1184289149 22:43489088-43489110 CCCGAAGTCCACGTGGCCCCTGG - Intronic
949396076 3:3615892-3615914 CCTGAAGCCCAGTCTGTTCCTGG - Intergenic
949619599 3:5795479-5795501 CCTGTTTTCCAATTGGTCCCTGG + Intergenic
951212958 3:19995475-19995497 CCTGAAGTCAAGGTGTTCACAGG - Intronic
951299991 3:20984733-20984755 GCAGAACTCCAGATGGTCCCAGG - Intergenic
952206154 3:31182682-31182704 GCTGAAGTCCAGGTGACCCCTGG + Intergenic
952246339 3:31596887-31596909 CATGAAGTCTAGTAGGTCTCTGG + Intronic
954707162 3:52487212-52487234 CCGGAGGTCCAGGTGGTGCCGGG + Exonic
959377501 3:105604052-105604074 CCGTAGGTCCAGTTGGTCCCTGG - Intergenic
960009310 3:112816199-112816221 CCTGACCTCCACTTGATCCCAGG - Intronic
961307385 3:125968339-125968361 CCTGGAGACAAGTTGGGCCCTGG + Intergenic
967882776 3:194313701-194313723 TCTGATTTCCAGTTGGGCCCTGG + Intergenic
969167388 4:5328909-5328931 TCTGAAGTCCAGCTGGTGGCCGG + Intronic
973174437 4:47187355-47187377 GCTGAAATGCAGTTGGTTCCAGG - Intronic
975481829 4:74889476-74889498 CCTGAAGTCCATTTGGCACAAGG - Intergenic
976613773 4:87055427-87055449 CCAGAAGTACATTTGGTACCAGG + Intronic
977042015 4:92028006-92028028 TCTGATTTCCAGTGGGTCCCTGG - Intergenic
982678323 4:158400827-158400849 CCTGAACTCCAGTTCCTCACTGG - Intronic
983273635 4:165591822-165591844 ACTGAAGGCCAGCTGGTGCCAGG + Intergenic
983333297 4:166359271-166359293 CCTGCTGTTCAGTGGGTCCCAGG + Intergenic
983952698 4:173661363-173661385 AATGAAGTCCAGGTGGTCTCAGG + Intergenic
984854622 4:184184072-184184094 CATGATGTCCAGTTGGTGCATGG - Intronic
986519918 5:8604382-8604404 CGTGAAGTCCAGATGGACCATGG - Intergenic
986877859 5:12132619-12132641 CCTGTAGTCCAGATGCTTCCTGG - Intergenic
988778142 5:34495817-34495839 CCTGGGGTCCAGTTGTGCCCAGG + Intergenic
990943177 5:61224443-61224465 CCTGAATTCCAGATGTTCTCAGG - Intergenic
993496211 5:88611927-88611949 CCAGAATTCAAGTTGGTCTCTGG + Intergenic
993979535 5:94528522-94528544 CCAGAATTCCAGTGGGTGCCGGG + Intronic
994512486 5:100722720-100722742 ACTTAAGTCCCTTTGGTCCCTGG + Intergenic
995029478 5:107464194-107464216 GCTGAAGTGCTGCTGGTCCCGGG - Intronic
995469461 5:112485163-112485185 CCTGAAGTCCAGCTATTTCCAGG - Intergenic
996325636 5:122269687-122269709 CCTTAAGTCCATTTGTTCCAGGG - Intergenic
997425698 5:133801252-133801274 CCTGAAAAGCAGTTGGTCTCTGG - Intergenic
998216047 5:140239405-140239427 CCAGTAGTCCCCTTGGTCCCAGG - Intronic
998349730 5:141492643-141492665 CCAGAGGTCCGGATGGTCCCGGG + Intronic
1000841888 5:166230360-166230382 TCTGAAGTCAAATTGTTCCCAGG - Intergenic
1001021925 5:168190412-168190434 AATGATGTCCAGTGGGTCCCGGG - Exonic
1001196136 5:169675217-169675239 CCTGGACTCCAGGTGGACCCTGG - Intronic
1003752802 6:9080180-9080202 CCTTAACTCCAGCTTGTCCCTGG + Intergenic
1004209176 6:13620308-13620330 CCAGTAGTCCTGTTGGTTCCTGG - Exonic
1006297507 6:33176468-33176490 CCTGAGGTCCAGAGGGACCCTGG + Exonic
1007129101 6:39452929-39452951 CCTCAATTCCAGTAGGTCCAAGG - Intronic
1009944743 6:70330226-70330248 CCTGAAGTCCAGTTTTTACTTGG + Intergenic
1011805149 6:91062894-91062916 ACAGAAGACCAGTAGGTCCCTGG - Intergenic
1014804988 6:125819450-125819472 CCTGAAAACCAGTTGGACCAGGG - Intronic
1016992890 6:149942123-149942145 CCTGCTGTCCGGCTGGTCCCGGG + Exonic
1017249182 6:152261356-152261378 TCTGACTTCCAGTTGTTCCCTGG + Intronic
1019534875 7:1523659-1523681 CCTGAAGTCCAGCCTGTTCCGGG + Intergenic
1024451571 7:49551519-49551541 CCTGAAGTCCAGTCTGAACCTGG + Intergenic
1024483032 7:49884521-49884543 CCTGAACTTCAGTGGATCCCAGG - Intronic
1025034705 7:55586987-55587009 CCTGAGGTTCAGATGGACCCTGG - Intergenic
1025281151 7:57627150-57627172 CCTGAAGTCCAGTATCTACCTGG - Intergenic
1025303578 7:57838357-57838379 CCTGAAGTCCAGTATCTACCTGG + Intergenic
1025739218 7:64182692-64182714 CCTGACGTCCACCTCGTCCCCGG + Intronic
1029931458 7:104375533-104375555 CATCAAGTCCAGTTTTTCCCAGG - Intronic
1034653460 7:152710965-152710987 CCTTAAGGTCAGTTGGACCCTGG - Intergenic
1034830346 7:154303278-154303300 CCTGAAATGCAGTTGACCCCTGG - Intronic
1034993401 7:155562289-155562311 CCTGAAGTCCAGCTCCACCCGGG - Intergenic
1035549086 8:506406-506428 GCTGAAGTCCAGTTCCTCCTGGG - Intronic
1035899040 8:3437549-3437571 CCTGCAGTCCAGTTTTTCCCTGG - Intronic
1035939849 8:3887000-3887022 ACTGAAGTCCATGTGGTACCAGG - Intronic
1037813543 8:22100401-22100423 CCAGAAGTCTGGGTGGTCCCTGG - Intronic
1041220686 8:55648353-55648375 CCTGCAGTCCAGGTGCTTCCTGG + Intergenic
1043666807 8:82825372-82825394 CCCAAAGTCCAGATGGGCCCAGG - Intergenic
1050240919 9:3633945-3633967 ACCAAAGGCCAGTTGGTCCCTGG - Intergenic
1054349915 9:64012198-64012220 CCTGATGTCCAGCTGGGGCCTGG - Intergenic
1057011238 9:91603625-91603647 CCACAAGTTCAGTGGGTCCCAGG + Intronic
1057948664 9:99352242-99352264 CTGGAATTCCATTTGGTCCCTGG - Intergenic
1058883905 9:109308339-109308361 CCTGAGGTACAGTTAGTACCGGG - Intronic
1060440649 9:123636117-123636139 CATGAATTCCAGCTGGGCCCTGG - Intronic
1061130824 9:128706796-128706818 CCTGGAGGCCAGTGGGTCCCCGG + Exonic
1062044384 9:134418312-134418334 CCTGAGGGCCAGCTGGACCCAGG - Intronic
1185457551 X:318459-318481 CCTGACGTCAAGTGGGGCCCGGG - Exonic
1186002904 X:5034071-5034093 CCTGAAGTCATCTTGGTCCATGG - Intergenic
1187144072 X:16621519-16621541 GCTGGAGCCCACTTGGTCCCTGG - Intronic
1190568413 X:51755475-51755497 CCGGAGGTCCAGTTTGTCCCAGG - Intergenic
1192898555 X:75470698-75470720 TCTGGTGTCCAGTGGGTCCCCGG + Intronic
1195156990 X:102133451-102133473 CTTGAATTTCAGTTGGTACCAGG + Intergenic
1200073693 X:153541054-153541076 CCTGGACTCCAGCGGGTCCCAGG - Intronic
1202082473 Y:21098609-21098631 CATTGATTCCAGTTGGTCCCTGG - Intergenic