ID: 1124385901 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:29207944-29207966 |
Sequence | GGTGGGGTGACCCCCACTGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 166 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 13, 4: 152} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1124385901_1124385911 | 14 | Left | 1124385901 | 15:29207944-29207966 | CCATCAGTGGGGGTCACCCCACC | 0: 1 1: 0 2: 0 3: 13 4: 152 |
||
Right | 1124385911 | 15:29207981-29208003 | AGGGACACAAACCCCCACGCTGG | 0: 1 1: 0 2: 0 3: 3 4: 118 |
||||
1124385901_1124385904 | -6 | Left | 1124385901 | 15:29207944-29207966 | CCATCAGTGGGGGTCACCCCACC | 0: 1 1: 0 2: 0 3: 13 4: 152 |
||
Right | 1124385904 | 15:29207961-29207983 | CCCACCTTCCCTGCCAAGCTAGG | 0: 1 1: 0 2: 2 3: 32 4: 328 |
||||
1124385901_1124385906 | -5 | Left | 1124385901 | 15:29207944-29207966 | CCATCAGTGGGGGTCACCCCACC | 0: 1 1: 0 2: 0 3: 13 4: 152 |
||
Right | 1124385906 | 15:29207962-29207984 | CCACCTTCCCTGCCAAGCTAGGG | 0: 1 1: 0 2: 2 3: 20 4: 236 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1124385901 | Original CRISPR | GGTGGGGTGACCCCCACTGA TGG (reversed) | Intronic | ||