ID: 1124385901

View in Genome Browser
Species Human (GRCh38)
Location 15:29207944-29207966
Sequence GGTGGGGTGACCCCCACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124385901_1124385911 14 Left 1124385901 15:29207944-29207966 CCATCAGTGGGGGTCACCCCACC 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1124385911 15:29207981-29208003 AGGGACACAAACCCCCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 118
1124385901_1124385904 -6 Left 1124385901 15:29207944-29207966 CCATCAGTGGGGGTCACCCCACC 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1124385904 15:29207961-29207983 CCCACCTTCCCTGCCAAGCTAGG 0: 1
1: 0
2: 2
3: 32
4: 328
1124385901_1124385906 -5 Left 1124385901 15:29207944-29207966 CCATCAGTGGGGGTCACCCCACC 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1124385906 15:29207962-29207984 CCACCTTCCCTGCCAAGCTAGGG 0: 1
1: 0
2: 2
3: 20
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124385901 Original CRISPR GGTGGGGTGACCCCCACTGA TGG (reversed) Intronic