ID: 1124387574

View in Genome Browser
Species Human (GRCh38)
Location 15:29223296-29223318
Sequence CAGAACCAGGAGGACTTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 193}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124387574_1124387581 3 Left 1124387574 15:29223296-29223318 CCAGACAAGTCCTCCTGGTTCTG 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1124387581 15:29223322-29223344 TGGAGAGAGTTTGTCTGGCTTGG 0: 1
1: 0
2: 2
3: 21
4: 235
1124387574_1124387580 -2 Left 1124387574 15:29223296-29223318 CCAGACAAGTCCTCCTGGTTCTG 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1124387580 15:29223317-29223339 TGGGCTGGAGAGAGTTTGTCTGG 0: 1
1: 0
2: 0
3: 18
4: 211
1124387574_1124387582 10 Left 1124387574 15:29223296-29223318 CCAGACAAGTCCTCCTGGTTCTG 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1124387582 15:29223329-29223351 AGTTTGTCTGGCTTGGCTCCCGG 0: 1
1: 0
2: 0
3: 15
4: 168
1124387574_1124387583 20 Left 1124387574 15:29223296-29223318 CCAGACAAGTCCTCCTGGTTCTG 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1124387583 15:29223339-29223361 GCTTGGCTCCCGGCAGCCTCTGG 0: 1
1: 0
2: 5
3: 61
4: 677
1124387574_1124387584 21 Left 1124387574 15:29223296-29223318 CCAGACAAGTCCTCCTGGTTCTG 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1124387584 15:29223340-29223362 CTTGGCTCCCGGCAGCCTCTGGG 0: 1
1: 0
2: 9
3: 75
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124387574 Original CRISPR CAGAACCAGGAGGACTTGTC TGG (reversed) Intronic
902747273 1:18482255-18482277 CAGATCCAGGCGGACCTGTGGGG - Exonic
903600569 1:24535580-24535602 CAGAATCAGGAGGACTTACATGG - Exonic
903799301 1:25954757-25954779 AAGAAACAGGAGGACTTGGCAGG + Intergenic
905137000 1:35807973-35807995 CAGAGCCCGGTGGACGTGTCGGG - Intergenic
905765241 1:40595241-40595263 AAGTACCAGGAGGACCTGGCAGG - Intergenic
905923882 1:41736419-41736441 CAAAGCCAGGAAGCCTTGTCAGG - Intronic
906147954 1:43571018-43571040 CAGAACCACATGGACTTGTCTGG + Intronic
906610720 1:47200136-47200158 CAGCACCCGGAGGACATCTCAGG + Intergenic
908314416 1:62918938-62918960 CAAAACTAAGAGGCCTTGTCAGG - Intergenic
908787481 1:67749545-67749567 CAGTACCAGGAGGAAGGGTCTGG + Intronic
912272836 1:108228283-108228305 CAGAAGCAGCTGGACATGTCAGG + Intronic
912295384 1:108466039-108466061 CAGAAGCAGCTGGACATGTCAGG - Intronic
912580508 1:110717035-110717057 CAGAAACAGGAGACCTTGCCAGG - Intergenic
914913874 1:151806392-151806414 CAGATCCTGGAGGACTTTCCTGG - Intronic
915100184 1:153493550-153493572 CAGAGCAAGCAGGACTTGACAGG - Intergenic
916450557 1:164916530-164916552 CAGAAACAGGAAGACCTGTCAGG + Intergenic
916556453 1:165898049-165898071 CAGAAGCATGAGGGGTTGTCAGG - Intronic
918978629 1:191525509-191525531 CAGAACACGGAGGACTGGTAAGG + Intergenic
920250855 1:204621353-204621375 AAGAACAAGTAGGAGTTGTCTGG - Exonic
923915815 1:238503431-238503453 TAGAACCTGGAGGACTTGTCAGG + Intergenic
924513108 1:244744260-244744282 CATATCCAAGAGTACTTGTCAGG - Intergenic
1062934201 10:1374056-1374078 CAGAGGCAGGAGGACATGCCAGG - Intronic
1067193189 10:44089839-44089861 CAGGATCAGGAAGACATGTCCGG + Intergenic
1068515176 10:58017195-58017217 TAGTACCAGGAGGAATTGGCAGG - Intergenic
1071910711 10:90229706-90229728 CAGAGCCTGGTGGACTTGCCGGG + Intergenic
1074941659 10:118241827-118241849 TACAACCCGGAGGACTTGCCTGG + Intergenic
1078754174 11:14193259-14193281 CAGAACCAGGAAGTGTTGGCAGG + Intronic
1083013919 11:59431797-59431819 CAGAACTAGGAGGAATTTTGAGG + Intergenic
1083112902 11:60429438-60429460 CTAAACCAGGACTACTTGTCAGG + Intergenic
1084033399 11:66493932-66493954 CCGCACCAGGAGGAATTGTTTGG + Intronic
1084562180 11:69911280-69911302 CAGATCCAGGCGGACCTGCCCGG - Intergenic
1087787048 11:102366718-102366740 CAGAATCAGGAAGACTTGTTAGG - Intronic
1087970225 11:104471800-104471822 CAGAACAAGGAGGATTTTTAAGG + Intergenic
1089609410 11:119661106-119661128 CAGAACCAGGAGGATCTGCTGGG + Exonic
1092264503 12:6970515-6970537 CAGAACTTGAAGGACTTGGCGGG - Exonic
1093619180 12:21266565-21266587 CAGAACCAGAATGACTTCTGTGG - Exonic
1096592002 12:52666461-52666483 AAGAATCTGGAGGACTTGTAAGG + Intergenic
1098901999 12:76120038-76120060 CAGTACCAGGAGGACCAGTGAGG - Intergenic
1101552252 12:105773761-105773783 CAAAAGCAGGGGGACTTGGCAGG + Intergenic
1104757466 12:131278059-131278081 CAGGAACCGGAGGACCTGTCTGG + Intergenic
1104760554 12:131295413-131295435 CTGACCCAGGAGGACTTGAGCGG + Intergenic
1104819221 12:131665372-131665394 CTGACCCAGGAGGACTTGAGCGG - Intergenic
1105539191 13:21299861-21299883 TAGAAACAGTAGGGCTTGTCAGG + Intergenic
1105799051 13:23887761-23887783 TAGAAACAGTAGGGCTTGTCAGG - Intronic
1105891695 13:24686805-24686827 CACAACCAGCAGGACTTGCGGGG + Intronic
1108264094 13:48687184-48687206 CAGAACCAGGTGTAATTCTCAGG - Intronic
1108817165 13:54305758-54305780 CAGAACCAGGTAGACTTGCCAGG + Intergenic
1110495367 13:76161798-76161820 ACTAACCAGGAGGACTTGTCAGG + Intergenic
1113243052 13:108361433-108361455 CAGAGCAAAGAGGAATTGTCAGG - Intergenic
1113838547 13:113345963-113345985 CAGACCCAGGAGGACTTTTGTGG + Intronic
1113838652 13:113346435-113346457 CAGACCCAGGAGGACCTCTGTGG + Intronic
1113838680 13:113346555-113346577 CAGACCCAGGAGGACCTCTGTGG + Intronic
1113838828 13:113347179-113347201 CAGACCCAGGAGGACCTCTGTGG + Intronic
1113838835 13:113347209-113347231 CAGACCCAGGAGGACCTCTGTGG + Intronic
1113838916 13:113347565-113347587 CAGACCCAGGAGGACCTCTGTGG + Intronic
1116141920 14:41007190-41007212 CAGAACCAAGAGGATCAGTCAGG - Intergenic
1116740065 14:48743389-48743411 CTGAAGCAGGAAGACTTGTAAGG + Intergenic
1117750249 14:58914481-58914503 CAGAAGCTGGTGCACTTGTCTGG - Intergenic
1117957237 14:61132015-61132037 CAGCAGCAGAAGGACTTGTCAGG + Intergenic
1118326807 14:64786792-64786814 CAGGGCCAGGAGGACTTGCTGGG - Exonic
1118590947 14:67400543-67400565 CAGCACTAGCAGGACTGGTCTGG + Intronic
1119074388 14:71621371-71621393 CTGAGCCAGGAGGAGTTATCAGG - Intronic
1119188264 14:72660437-72660459 CAGAACCAGGTGAGCATGTCAGG - Intronic
1119532842 14:75375022-75375044 CAGAACCAGGTGTATTAGTCAGG - Intergenic
1119735241 14:76977446-76977468 CAGACCCTGGAGGAGTGGTCTGG - Intergenic
1122644495 14:103184651-103184673 CAGAACTAGGTGAACTTGGCCGG + Intergenic
1124387574 15:29223296-29223318 CAGAACCAGGAGGACTTGTCTGG - Intronic
1126465255 15:48955849-48955871 CAGAACTGGGAGCTCTTGTCTGG + Intronic
1127973359 15:63979368-63979390 CAGCACTAGGAGGACATGCCTGG - Intronic
1128761390 15:70218350-70218372 CAGAGCCAGGAGTACTGGACAGG - Intergenic
1129180091 15:73868764-73868786 CAGCTCCAGGAGGCCTTCTCTGG - Intergenic
1129338520 15:74869215-74869237 CAGAACCATGAGCACCTTTCAGG + Intronic
1130869204 15:87956913-87956935 CAGAACAAGGTGGGCTTTTCTGG - Intronic
1131105481 15:89731315-89731337 GGGAACCAGGAGCACCTGTCTGG - Intronic
1132827871 16:1914005-1914027 AAGACGGAGGAGGACTTGTCCGG - Intronic
1134235554 16:12462711-12462733 CAAACCCAGGAAGACTTGGCAGG + Intronic
1136035106 16:27533223-27533245 CATAGCCGGGAGGTCTTGTCAGG - Intronic
1138553820 16:57760928-57760950 CTGAACCTGGTGGACTTGGCTGG - Exonic
1139852764 16:69960930-69960952 CAGAGCCAGGATGAAATGTCAGG + Exonic
1139881735 16:70183838-70183860 CAGAGCCAGGATGAAATGTCAGG + Exonic
1140114533 16:72030128-72030150 CAGAACCAAGAGGCCATGGCAGG - Intergenic
1140370773 16:74411668-74411690 CAGAGCCAGGATGAAATGTCAGG - Exonic
1140479901 16:75256875-75256897 CTGGTCCAGGAGGACCTGTCTGG - Intronic
1141116125 16:81311314-81311336 CAGCACCAGGAGGAGCTTTCTGG + Intergenic
1142150581 16:88510887-88510909 CAGGCCCAGCAGGACTTGTGAGG - Intronic
1146531498 17:33611141-33611163 CAGCACCAGGAGGGCTAGTTGGG - Intronic
1146836738 17:36117186-36117208 CTGACCCAGGAGGACATGGCAGG - Intergenic
1147127443 17:38381601-38381623 CAGAACCAGGATGAGATCTCAGG + Intronic
1147264504 17:39226417-39226439 CATCACAAGGAGGAATTGTCCGG - Intergenic
1147597291 17:41725236-41725258 CAGAACCAGGAGGAACCATCAGG - Intronic
1151283080 17:73090983-73091005 GAGAACCAGCAGCACTGGTCCGG + Intronic
1151954059 17:77372043-77372065 CAGACCCAGGATGAGCTGTCAGG + Intronic
1152528338 17:80902408-80902430 CAGAGCCAGGTGGTCTTGCCGGG + Intronic
1153104696 18:1512897-1512919 CTGAACTAAGAGGTCTTGTCAGG + Intergenic
1153349591 18:4064022-4064044 TAGATCCAGGAGGACATGCCAGG - Intronic
1157619536 18:49008409-49008431 CAGGTCCAGGAGGACTCGTGTGG + Intergenic
1157713620 18:49866985-49867007 AAGAACAAGCAGGACTTGCCGGG + Intronic
1160414293 18:78697300-78697322 CAGACCCAGGTGGAGTTGACAGG - Intergenic
1162192064 19:8954764-8954786 TAGACCCAGGAGGACTTGTTTGG + Exonic
1162192893 19:8960935-8960957 CAGACTCAGGAGGACTTGCTTGG + Exonic
1162415312 19:10532743-10532765 GTGATCCAGGAGGACTTCTCTGG - Intergenic
1162969838 19:14174038-14174060 CACATCCAGAAGGACTTGTAGGG - Intronic
1163861001 19:19742806-19742828 CAGGGACAGGAGGACTTGGCAGG + Intergenic
1164630680 19:29759719-29759741 CAGAACCAGGAGGAGACCTCTGG - Intergenic
925328431 2:3040226-3040248 GAGAACCAGGAAGACTGGGCAGG + Intergenic
925492864 2:4414331-4414353 CAGAAACAGAATGACTTCTCTGG + Intergenic
926555621 2:14354493-14354515 CAGAACCAAGAGGCCATGGCAGG - Intergenic
932602980 2:73142923-73142945 CAGAAGCAGCAGGACTGGGCAGG - Intronic
936027823 2:109046938-109046960 CAGAACCAAGAGGACTGGTGAGG - Intergenic
940235514 2:151507384-151507406 CAGAAGCAGGAGGGTTTTTCTGG + Intronic
942184478 2:173411705-173411727 CAGCACCAGAAGAACTTGTCAGG - Intergenic
944015243 2:195027925-195027947 AAGTACCAGCAGGCCTTGTCAGG + Intergenic
946331567 2:219012248-219012270 GACAACCAAGAGGGCTTGTCAGG - Intronic
947649884 2:231777464-231777486 TAGAAACATGAGGACTTGGCTGG - Intronic
1169271408 20:4202259-4202281 CAGAAACAGGATGTCCTGTCTGG + Intergenic
1169703874 20:8480610-8480632 TAGTACCTGGAGGACTTGACAGG - Intronic
1170837305 20:19895341-19895363 GAGAACCAGGGTGAATTGTCCGG + Intronic
1170841919 20:19930637-19930659 CAGAAGCAGAAGGCCTTGTGAGG - Intronic
1171386971 20:24776993-24777015 GAGAACCAGGACGCCCTGTCGGG + Intergenic
1173161080 20:40653062-40653084 CAGAGCCAGGAGGCATTGTGGGG + Intergenic
1173556916 20:43972902-43972924 CAGGACCCGGAGGGCATGTCTGG + Intronic
1176261173 20:64181531-64181553 CAGTGACAGGAGGACTTGTTTGG - Intronic
1177652874 21:23980664-23980686 CAGAACTAGGAAGAAGTGTCGGG + Intergenic
1178005494 21:28215389-28215411 CAGAACCAGGAGAACTGATATGG + Intergenic
1178100187 21:29259765-29259787 CAGGACCAGGAAGACTAGACAGG - Intronic
1178942914 21:36922649-36922671 CAGCACCAGGAGGATTTTGCGGG - Intronic
1180038785 21:45265170-45265192 CAGAAGCAGGAGTGTTTGTCAGG - Exonic
1180951033 22:19720713-19720735 GAGTACCAGGGGGACTTGTCTGG + Intronic
1183167798 22:36160758-36160780 CAGAGCCTGGAGAACGTGTCTGG - Exonic
1183514675 22:38257946-38257968 CTGAGCCAGGGGGCCTTGTCTGG - Intronic
1184236519 22:43186149-43186171 CAGCACCTGGAGGAGATGTCGGG + Intronic
1184384032 22:44164097-44164119 GGGAACCAGGAGGACTTCGCTGG + Intronic
1184775866 22:46622370-46622392 CGCAACCAGGAGGACTCGCCGGG + Intronic
950249861 3:11455623-11455645 GAAAACCAGGAGCACTTGTAAGG + Intronic
951643563 3:24862968-24862990 AAGTACCAGGAGGACTTGGATGG + Intergenic
953080036 3:39608379-39608401 CAGAAGCAGGATCACTAGTCTGG + Intergenic
953888704 3:46734769-46734791 CAAGCCCAGGAGGAGTTGTCTGG - Intronic
953911297 3:46894336-46894358 CAGAACCCTAAGGGCTTGTCAGG - Intronic
955196852 3:56812411-56812433 CTGAACAAGGTGGACTTGCCAGG + Intronic
955519428 3:59760769-59760791 CAGATCCAGGAGGCAGTGTCTGG - Intronic
956770423 3:72521326-72521348 CAAAAACAGGATGACTTCTCGGG - Intergenic
961108962 3:124267634-124267656 CATAGGCAGGAGGACTGGTCTGG - Intronic
961137496 3:124525590-124525612 CAGATTCACGAGGACTTGCCTGG + Intronic
961369775 3:126422352-126422374 CAGATCCAGGAGGGCTTCCCAGG - Intronic
962119842 3:132549854-132549876 CAGAAGCAGGAAGACCAGTCAGG - Intergenic
962201338 3:133403370-133403392 CAGGACCAGGAGGAGTTCTGTGG - Intronic
962374862 3:134851148-134851170 CAGGGCCAGCAGGCCTTGTCTGG + Intronic
963726464 3:148927364-148927386 CAGAACCAACAGGACTTGGATGG - Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
968432653 4:567818-567840 CAGACCCAGGAGGAGGAGTCAGG + Intergenic
968526466 4:1060325-1060347 CAGAACCTGAAGGACTCCTCAGG - Intronic
970318854 4:14855951-14855973 GAGAACCAGGAGCAGTTGTCAGG + Intergenic
971540374 4:27808590-27808612 CAGAAGCAAGAAGACTTGTTTGG + Intergenic
982255079 4:153443735-153443757 CAGATTCAGGAGTGCTTGTCTGG + Intergenic
985077290 4:186228403-186228425 CACAACAAGGACCACTTGTCAGG + Intronic
985829542 5:2218077-2218099 CAGAGTCAGGAGGACTTGGAAGG - Intergenic
986623959 5:9706300-9706322 CAGAACCAGGGGAACTGGCCTGG + Intronic
988986971 5:36629995-36630017 CAGAACCACCAGGACTTGAGCGG + Intronic
990181410 5:53164638-53164660 CAGTACCAGGAGGGGTGGTCAGG + Intergenic
993216303 5:85027120-85027142 CAGAACCAAGTGGACATGGCTGG + Intergenic
995133727 5:108658472-108658494 GAGAGTCAGGAGGAGTTGTCTGG + Intergenic
995497312 5:112760145-112760167 CACAAGCAGGAGGACTTCACTGG + Intronic
999205996 5:149848441-149848463 AAGAACCAGAAGGCCTGGTCTGG - Exonic
999564539 5:152842827-152842849 CAGAAACAGGTAGACTAGTCAGG + Intergenic
999953536 5:156675945-156675967 CAGAAACAAGACGCCTTGTCTGG + Intronic
999992735 5:157064132-157064154 GAGAAGCAGGAAGACCTGTCAGG + Intergenic
1001999788 5:176191260-176191282 CAGAGCCTGGAGGACATGCCAGG + Intergenic
1004884332 6:20037131-20037153 CAGAGTCAGGAGGATTTTTCTGG - Intergenic
1006327186 6:33363139-33363161 CTGAAGCAGGAGGACTTCCCAGG + Intergenic
1006436645 6:34029197-34029219 CAGACCCAGGAGGCCTAGCCTGG - Intronic
1006731614 6:36240280-36240302 CAGAAAGAGGAGGACTGGCCAGG - Intergenic
1007735969 6:43982368-43982390 CAGAACCAGCAAGCTTTGTCTGG - Intergenic
1007943285 6:45802157-45802179 CAGCACCAGGAGGATGTGGCCGG + Intergenic
1008473033 6:51905413-51905435 CTTAAACAGAAGGACTTGTCTGG + Intronic
1008692577 6:53997049-53997071 CAGAAGCCGAAGGACGTGTCAGG - Intronic
1009161617 6:60289849-60289871 TGGAAGCAGGAGGACTAGTCTGG + Intergenic
1009497930 6:64374031-64374053 CAGAAGCAGGACCACTTGGCTGG + Intronic
1009847267 6:69150023-69150045 CACAACCACGGGGACTTCTCTGG + Intronic
1010151575 6:72738916-72738938 CAGAACCCGGAGGATTTTTAGGG + Intronic
1011474044 6:87735182-87735204 CAGAGCCTGGAGAACCTGTCTGG - Intergenic
1012240654 6:96867899-96867921 CAGACCCAGGAGGATGTATCAGG - Intergenic
1014839728 6:126204498-126204520 CAGAGCTAAGCGGACTTGTCAGG - Intergenic
1021300421 7:18965824-18965846 CAGAACCAGCATGTCTTTTCAGG - Intronic
1022572159 7:31465454-31465476 CAGAACCAAGAGGAAGTGTGTGG + Intergenic
1023270475 7:38456499-38456521 CAGACCCAGGAGGAATATTCAGG - Intronic
1023867242 7:44244123-44244145 CAGAGCCAGGGGGACTTGGTGGG - Intronic
1024669221 7:51577108-51577130 CAGAGCCAGGAAGACTTGCTGGG - Intergenic
1026533449 7:71220496-71220518 CAGAACCAGGTGGTCATGGCTGG - Intronic
1031976592 7:128097625-128097647 CAGAACCAGGAGGAAATTGCTGG - Intergenic
1035569311 8:661493-661515 CAGGAGCATGAGGAATTGTCAGG - Intronic
1038393035 8:27223035-27223057 CAGAAGCAGGAAGCCTAGTCAGG - Intergenic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1043618857 8:82162661-82162683 CAGCAGCAGCAGAACTTGTCAGG - Intergenic
1044607796 8:94062220-94062242 GAGAACCATAAGGACTTGACAGG + Intergenic
1047908736 8:129502351-129502373 CAGAACCTGAAGGACCTGTATGG + Intergenic
1050367322 9:4884555-4884577 GAGAACCAACAGGACTTCTCTGG + Intronic
1052185363 9:25587481-25587503 GAGAACCAGGAGGCCTAGTTGGG + Intergenic
1052881971 9:33606839-33606861 CAGAAACATGAGGACTTGGTTGG + Intergenic
1053494347 9:38539025-38539047 CAGAAACATGAGGACTTGGTTGG - Intergenic
1055900406 9:81227708-81227730 CAGAACCAGGATGATTTCCCAGG + Intergenic
1055998063 9:82183396-82183418 CAGAGTCAGGAGCACCTGTCAGG + Intergenic
1056041697 9:82674865-82674887 CACACCCAGGAGGACTGGACTGG - Intergenic
1058418766 9:104815722-104815744 CAGAATCAGGAGCAATTCTCTGG - Intronic
1203495930 Un_GL000224v1:151513-151535 CAGAACCAGCAGAACTTTTCTGG + Intergenic
1203508554 Un_KI270741v1:93436-93458 CAGAACCAGCAGAACTTTTCTGG + Intergenic
1187219132 X:17307413-17307435 CAGAGCCAGGTAGACTTGCCAGG - Intergenic
1188098392 X:26050738-26050760 TAGTACCAGGATGACTAGTCTGG - Intergenic
1189061195 X:37755284-37755306 CAGATGCAGGAGGATTTGTAGGG - Intronic
1193067404 X:77274803-77274825 CAAGACCAGTAGGCCTTGTCTGG - Intergenic
1194916774 X:99717613-99717635 CAGAATCATGAGGACTGGCCTGG - Intergenic
1199320831 X:146436648-146436670 CAGAATCAGGAGGTCTTGTTTGG + Intergenic