ID: 1124390126

View in Genome Browser
Species Human (GRCh38)
Location 15:29247680-29247702
Sequence CAGGGTTGGGGGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1637
Summary {0: 1, 1: 0, 2: 16, 3: 167, 4: 1453}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124390126_1124390135 4 Left 1124390126 15:29247680-29247702 CCAGCTTCCCTCCCCCAACCCTG 0: 1
1: 0
2: 16
3: 167
4: 1453
Right 1124390135 15:29247707-29247729 ATAGCAGCCAACTTTGTTTCCGG 0: 1
1: 0
2: 1
3: 14
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124390126 Original CRISPR CAGGGTTGGGGGAGGGAAGC TGG (reversed) Intronic
900088261 1:908757-908779 AAGGGATGGGGGAGGGATGAGGG + Intergenic
900099788 1:956902-956924 CATGGTTGAGAGATGGAAGCAGG - Exonic
900418080 1:2544122-2544144 CAGGGGTAGGGCAGGGAGGCAGG - Intergenic
900488478 1:2934804-2934826 CAGGGCTGGGGGCTGGAGGCCGG - Intergenic
900601263 1:3503743-3503765 CACGTTTGGGGGTGGGGAGCGGG + Intronic
900623528 1:3598091-3598113 CAGAGATGGGGGAGGGTGGCTGG - Intronic
900647565 1:3715847-3715869 TCGGGGTAGGGGAGGGAAGCAGG - Intronic
900696764 1:4016980-4017002 GAGAGTTGGGGGAGGGGAGGAGG + Intergenic
900696773 1:4017004-4017026 GAGAGTTGGGGGAGGGGAGGAGG + Intergenic
900696782 1:4017028-4017050 GAGAGTTGGGGGAGGGGAGGAGG + Intergenic
900696791 1:4017052-4017074 GAGAGTTGGGGGAGGGGAGGAGG + Intergenic
900842588 1:5066470-5066492 CACGGTTGTGGGAGGGACCCAGG + Intergenic
901040313 1:6359462-6359484 AGGGGTTGGGGGAAGGAAGAGGG - Intronic
901055131 1:6445775-6445797 CGGGGGTGGCGGGGGGAAGCTGG - Exonic
901117872 1:6863318-6863340 CAGGGGTTGGGGAGGGAATGGGG - Intronic
901530656 1:9850597-9850619 CAGGGTTGGGTAGGGGAAGGGGG + Exonic
901560429 1:10066040-10066062 AAGGAGTGGGGGAGGGAAGGAGG - Intronic
901678102 1:10898504-10898526 CAAGGGTGGGGGCGGGGAGCCGG - Intergenic
901685148 1:10939589-10939611 CAGGGAAGGGGGATGGAGGCAGG + Intergenic
901926082 1:12567112-12567134 CAGGGTGGCAGGAGGGGAGCAGG - Intergenic
902078648 1:13806228-13806250 CAGGGATGGAGGCGGGATGCGGG - Intronic
902078660 1:13806261-13806283 CAGGGATGGAGGCGGGATGCGGG - Intronic
902164488 1:14559174-14559196 GAGCCTTGGGGGAGGGTAGCAGG + Intergenic
902257249 1:15197886-15197908 CACGGTTGTGGGAGGAAAGGTGG - Intronic
902450670 1:16494877-16494899 AAGGGTTGGGGGAAGGAGACAGG + Intergenic
902460385 1:16570999-16571021 TAGGGTGGGGGGAGGGAGGAGGG - Intronic
902479238 1:16702839-16702861 CGGGGGTGGCGGGGGGAAGCTGG + Intergenic
902525431 1:17054165-17054187 CCGGGTGGGCGGAGGGAAGGCGG + Exonic
902542939 1:17167199-17167221 GAGGGAGGGGGGAGGGAAGAGGG - Intergenic
902609392 1:17588289-17588311 CAGGGCTGGGGGAGGGAGGCGGG + Intronic
902652794 1:17847461-17847483 GAGGTGTGGGGAAGGGAAGCAGG - Intergenic
902728750 1:18354623-18354645 TAGGCTTGGGGGAGGGATGGGGG - Intronic
902768332 1:18631368-18631390 GAGGTTGGGGGGAGGGAAGGTGG - Exonic
902829332 1:19000076-19000098 AAGGGGAGGGGGAGGGGAGCGGG + Intergenic
902995814 1:20223804-20223826 CGGGGTTGGTGGGGGGAGGCGGG - Intergenic
903050906 1:20600293-20600315 CAGGGATCGGGCAGGGAAGCTGG + Intronic
903180161 1:21601353-21601375 CAGGGTTGGGGGGATGAAGAGGG - Intronic
903213942 1:21832979-21833001 CAGAGATGGGGAAAGGAAGCTGG + Intronic
903220863 1:21869006-21869028 CAGGGGTGGGGGTGGGAGGGCGG + Intronic
903301037 1:22379063-22379085 AGGGGTTGTGGGAGGGGAGCAGG - Intergenic
903377662 1:22876715-22876737 CAGGGTGGGCGGTGGGCAGCAGG + Intronic
903473036 1:23600613-23600635 GAGGGTTGGGTGTGGGAATCTGG - Intronic
903474773 1:23612031-23612053 GGGGGTAGGGGCAGGGAAGCAGG + Intronic
903524221 1:23980531-23980553 CAGGCTTGGGGGAGGGTAAGAGG - Intronic
903589158 1:24441127-24441149 CAGTGCTGGTGGAGTGAAGCCGG - Intronic
903891486 1:26573182-26573204 GGGGGTTGGGGGAGGGCTGCAGG - Intronic
903953551 1:27010416-27010438 CAGGGATGGGGGCGGGGAGAGGG - Intronic
904039921 1:27577762-27577784 CAGGTCAGGGGGAGGGGAGCAGG - Intronic
904043547 1:27597679-27597701 GGGGGTTTGGGGAGGGAAGAGGG + Intronic
904298865 1:29541378-29541400 CGGGGGTGGGGTGGGGAAGCGGG + Intergenic
904435431 1:30491914-30491936 CTGGGTCTGGGGAAGGAAGCTGG - Intergenic
904455710 1:30646901-30646923 CAGGGCTGTGGGAGGGGAGGTGG + Intergenic
904836124 1:33338098-33338120 CAGGAGTGGGGGATGGAGGCAGG - Intronic
904985099 1:34539216-34539238 CTGGGTGGGGGAAGGGAGGCTGG - Intergenic
905043380 1:34977832-34977854 CAGGGATGGGGGCGGGGAGGGGG - Intergenic
905178159 1:36150798-36150820 TGGGGTTGGGGGAGGAAAGCAGG + Intronic
905226584 1:36482892-36482914 CAGAGCTCGGGGAGAGAAGCTGG - Exonic
905296261 1:36956230-36956252 CAGGGCTGAGGGTGGGAAGCAGG + Intronic
905308657 1:37035021-37035043 ATGGGGTTGGGGAGGGAAGCCGG - Intergenic
905320605 1:37114242-37114264 GATGGTTGGTGGAGGGAAGAGGG - Intergenic
905324812 1:37144043-37144065 GAGGGTTGGGGGAGGGGGGCAGG - Intergenic
905428298 1:37901853-37901875 CAGAGTGGGAGTAGGGAAGCAGG - Intronic
905801932 1:40849798-40849820 CAGGGCTGGGGTGGGCAAGCGGG - Intergenic
905853186 1:41289417-41289439 CTGGGTTGGGGAAGGAAAGAAGG + Intergenic
905861613 1:41355629-41355651 CCTGGTGGGAGGAGGGAAGCTGG + Intergenic
905930501 1:41783514-41783536 CAGGGTGATGGGAGGGATGCGGG + Intronic
906146056 1:43561317-43561339 CAGGTTTGGAGCAGGGAAGGAGG - Intronic
906212489 1:44019877-44019899 CGGGGATGGGGGAGGGCTGCAGG + Intronic
906237681 1:44221708-44221730 CAAGGGTGGGGGTGGGAAGCAGG + Intronic
906282427 1:44563408-44563430 CAGGGCCAAGGGAGGGAAGCGGG - Intronic
906326594 1:44850041-44850063 CAGGGGTGGTGGAGGGAAGGTGG + Intergenic
906373067 1:45270667-45270689 CCGTGTTGGGGGAGGGACCCAGG + Intronic
906506064 1:46380478-46380500 GAGGGTTGGGAGAGGCAAGCTGG - Intergenic
906508493 1:46397271-46397293 CAGGGGTGTGGGATGGTAGCAGG + Intronic
906545065 1:46614724-46614746 CAGGATTGGGGAAGGGAGGGTGG + Intronic
907105480 1:51878725-51878747 CTGGGTTGGGGGAGGGGTTCAGG - Exonic
907119753 1:51998104-51998126 CAGGGTTGGGGTGGGGAGGGAGG - Intergenic
907248054 1:53120571-53120593 CAGGGTTGGGGAAGGGATGGTGG - Intronic
907301682 1:53490805-53490827 CAGGGTTGGGGGAGGGCAAGAGG - Intergenic
907461607 1:54608755-54608777 AAGGGTTGGGGGAGATCAGCTGG + Intronic
908630745 1:66104079-66104101 GAGGGTGGGGGGAGGGAGGAGGG - Intronic
908888881 1:68819923-68819945 TAGGGTTGGGGGTGGGAATGAGG + Intergenic
909036619 1:70600831-70600853 CAAGGCTGGGGGAGGGGTGCCGG - Intergenic
909165102 1:72212434-72212456 CAAGGTTGGTGGTGGGCAGCAGG + Intronic
909596696 1:77413818-77413840 CAGGGTTGGGGCAGGGAGGAGGG - Intronic
910288415 1:85578235-85578257 GTGGGATGGGGGTGGGAAGCTGG - Intronic
910439515 1:87238316-87238338 CAGCATGGGGGCAGGGAAGCTGG + Intergenic
910444049 1:87282714-87282736 AAGAGTTGGGGGAGGGGAGCTGG - Intergenic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
910981163 1:92961279-92961301 CAGGGAGGGAGGAGGGGAGCGGG + Intronic
911618292 1:100038410-100038432 CAGGGTGGGGGAAGGGAGGGAGG - Intronic
911724944 1:101233384-101233406 CTGGGTCAGGGGAGGGAAGAGGG + Intergenic
911820337 1:102411303-102411325 CAGGGGAGGGGGAGGGGAGGAGG + Intergenic
911852449 1:102836432-102836454 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
912170802 1:107097180-107097202 GAGGGTTGGGGGAGGGAGCAGGG - Intergenic
912345209 1:108957361-108957383 CCTGGTTGGGAGAGGGCAGCTGG - Intronic
912382359 1:109254396-109254418 CAGGGCTGGGGGAGGAGAGTTGG + Intronic
912431179 1:109629255-109629277 CTGGGTATGGGGAGGGCAGCCGG + Intronic
912542297 1:110426099-110426121 CTGGGTTGGGGGATGGCAGGGGG + Intergenic
912564297 1:110574959-110574981 CAGAGTTGGGGAAGGAAAGGAGG - Intergenic
912706422 1:111918389-111918411 TAGGGCTTGGGGAGAGAAGCAGG + Intronic
912776834 1:112510721-112510743 CAGTGTTGGGGAAGGCAAGGAGG + Intronic
912816082 1:112829751-112829773 TAGTTTTGGGAGAGGGAAGCTGG - Intergenic
912980358 1:114365603-114365625 TAGTGTTGGGAGACGGAAGCTGG + Intergenic
913605029 1:120457580-120457602 TAGGGTGGGGGGAGGGAGGAGGG + Intergenic
914083510 1:144431633-144431655 TAGGGTGGGGGGAGGGAGGAGGG - Intronic
914189532 1:145396909-145396931 TAGGGTGGGGGGAGGGAGGAGGG - Intronic
914211380 1:145582616-145582638 TAGGGTGGGGGGAGGGAGGAGGG - Intergenic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
914366231 1:146981130-146981152 TAGGGTGGGGGGAGGGAGGAGGG + Intronic
914486212 1:148112294-148112316 TAGGGTGGGGGGAGGGAGGAGGG - Intronic
914628297 1:149484347-149484369 TAGGGTGGGGGGAGGGAGGAGGG + Intergenic
914919288 1:151836972-151836994 CAGGCTTGGAGGAGGGAGGGAGG - Intergenic
914976651 1:152370576-152370598 CGGGGTGGGGGGAGGGAGGAGGG + Intergenic
915066805 1:153231658-153231680 CATGGTAGGGGCAGAGAAGCAGG - Intergenic
915128695 1:153682642-153682664 CAGGGCTGTGGGGGGGAAGTAGG - Intronic
915188081 1:154124378-154124400 TAGGTTTGGGAGAGGAAAGCAGG + Intronic
915340676 1:155175061-155175083 CAGAGATGGGGGATGGAGGCAGG + Intronic
915524713 1:156468546-156468568 CAGGGTAGGGGGTGGGAGGTGGG - Intronic
915558440 1:156673109-156673131 AAGGGTGAGGGGAGGGAAGTTGG + Exonic
915564820 1:156707451-156707473 CAGAGATGGTGGAAGGAAGCGGG + Intergenic
915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG + Intronic
915650580 1:157307589-157307611 CTGGGCTGGGGGAGGAAAGTGGG - Intergenic
915722467 1:157994562-157994584 TGGGGTTGGGGGAGGGAAGAGGG + Intronic
915939878 1:160112323-160112345 CAGGACTGGGGGAGAGAAGTGGG + Intergenic
916783767 1:168067022-168067044 CTGGGATGGGAGAGGGAAGGTGG + Intronic
917002040 1:170370986-170371008 CAGGGTGGGGGGAGGGAGGAGGG - Intergenic
917099641 1:171432240-171432262 TGGGGTTGGGGGAGGGATGGAGG - Intergenic
917115887 1:171603140-171603162 TAGTGTTGGGAGACGGAAGCTGG - Intergenic
917125326 1:171682546-171682568 GAGGGGAGGGGGAGGGAAGGTGG - Intergenic
917448304 1:175125529-175125551 AAGAGGTGGGGGAGGGAAGAGGG - Intronic
918110350 1:181450235-181450257 CAATGTTGGGGGAGGGCACCTGG - Intronic
918403905 1:184192795-184192817 CAGGGTTGGGGGTGGGAGGGTGG + Intergenic
918427917 1:184429005-184429027 CTGGGTTGGGGGATGGAGCCAGG - Intronic
918944147 1:191039652-191039674 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
919753124 1:201050564-201050586 CAGGGTTAGGGTGGGGGAGCTGG + Intronic
919780835 1:201219831-201219853 GAGGGATGGGGGAGGAAAGCCGG + Intronic
919935197 1:202246272-202246294 GAGGGATGGGGGAGGGAGGGAGG - Intronic
920031794 1:203042008-203042030 AAGGGTTGTGGGAGGGCAGAAGG - Intronic
920106393 1:203556331-203556353 CAGGGTTGGGGGATGGGGGGTGG + Intergenic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920217647 1:204372738-204372760 TGGGGTTGGGGGTGGGAAGGAGG - Intronic
920442463 1:205990023-205990045 TAGGGTGTGGGGAGGGAAGCTGG - Intronic
920450231 1:206055208-206055230 TAGTGTTGGGAGACGGAAGCTGG - Intronic
920536748 1:206742470-206742492 CAGGGAAGGGGCAGGAAAGCAGG - Intergenic
920687964 1:208124217-208124239 GAGGGTGGAGGGAGGGAAGGGGG + Intronic
920691617 1:208151182-208151204 CAGAGTTGGGGGTGTGTAGCTGG + Intronic
920726378 1:208439094-208439116 AGGGGTTGGGGGAGGGACGGGGG + Intergenic
920855045 1:209655175-209655197 CAGGGATGGGGCAGGGAAGTTGG - Intergenic
921074701 1:211690929-211690951 TAGTGTTGGGGGACGGAAGCTGG - Intergenic
921305105 1:213788533-213788555 CAGGGTATGGGGAGGGAGTCAGG - Intergenic
922355031 1:224767243-224767265 CAAGGCTGGGGGAGGCAAGAGGG + Intergenic
922378553 1:224996592-224996614 CTGAGTTAGGGTAGGGAAGCTGG + Intronic
922440468 1:225652384-225652406 AAGGCTTGGGGGAGGGAGCCAGG + Intronic
922586833 1:226739405-226739427 GAGGCTTGGGGGAGGAAAGCAGG + Intergenic
922680703 1:227593030-227593052 TAGTGTTGGGAGACGGAAGCTGG + Intronic
922690215 1:227683073-227683095 TAGTGTTGGGAGATGGAAGCTGG - Intergenic
922773536 1:228203779-228203801 CAGAGGCTGGGGAGGGAAGCGGG + Exonic
922885766 1:229019349-229019371 CATTGATGGGGGAGAGAAGCTGG + Intergenic
923043856 1:230339830-230339852 CGGGGCTGGGGGATGGAAGTGGG + Intronic
923747421 1:236715298-236715320 CAGGGTGGGGGGAGGGGGGAGGG - Intronic
923835581 1:237607424-237607446 TGGGGTTGGGGGAGGGAGGGAGG + Intronic
923965648 1:239135601-239135623 GAGGGATGGAGGAGTGAAGCAGG - Intergenic
924141374 1:241027261-241027283 CAGGGAGTGGGGAGGGAAACTGG + Intronic
924184532 1:241474422-241474444 CAGGGTTGGTGGTGGGAAGGAGG - Intergenic
924306461 1:242694021-242694043 GAAGGTTGGGGAAAGGAAGCGGG - Intergenic
924310323 1:242734675-242734697 TAGGGTTGGGGGAAGGAGGTGGG + Intergenic
924729507 1:246698560-246698582 GAAGGCTGTGGGAGGGAAGCTGG - Intergenic
1062835228 10:631053-631075 CAGGGTTGGGGCAGAGGAGATGG - Intronic
1062963731 10:1592312-1592334 GTGGCTTGGGCGAGGGAAGCTGG - Intronic
1062963782 10:1592501-1592523 GTGGCTTGGGCGAGGGAAGCTGG - Intronic
1062963832 10:1592690-1592712 GTGGCTTGGGCGAGGGAAGCTGG - Intronic
1062963863 10:1592816-1592838 GTGGCTTGGGCGAGGGAAGCTGG - Intronic
1062963880 10:1592879-1592901 GTGGCTTGGGTGAGGGAAGCTGG - Intronic
1062963897 10:1592942-1592964 GTGGCTTGGGCGAGGGAAGCTGG - Intronic
1062963914 10:1593005-1593027 GTGGCTTGGGTGAGGGAAGCTGG - Intronic
1062963980 10:1593257-1593279 GTGGCTTGGGTGAGGGAAGCTGG - Intronic
1063332448 10:5175116-5175138 CGGGGTTGGGGGAGGGGGGAGGG - Intergenic
1063401652 10:5752087-5752109 AAGGGTAGGGGGAGGGCAGCTGG - Intronic
1063571180 10:7215754-7215776 CAGGGAAGGAGGAGGGAAGCAGG - Intronic
1063595983 10:7435988-7436010 GGGGGGTGGGGGAGGGCAGCAGG + Intergenic
1063614643 10:7591315-7591337 CAGGGTGGGTTTAGGGAAGCTGG - Intronic
1063906844 10:10788920-10788942 CAGGGGTGGGTGTGGCAAGCAGG - Intergenic
1064022943 10:11823814-11823836 CCGGGTTGGGGGACGGACGGTGG - Intronic
1064756546 10:18576626-18576648 TAGTGTTGGGGGATGGAAGCTGG - Intronic
1064886435 10:20118365-20118387 CTGGGCTGGGGGAGAGAAGGAGG + Intronic
1064961622 10:20971587-20971609 TAGGGTTGGGGGAGGGGGGAGGG - Intronic
1065252544 10:23831082-23831104 CAAGGCTGGGGTGGGGAAGCTGG - Intronic
1065464910 10:26009227-26009249 TGGGGTTGGGGGAGGGAGGAGGG + Intronic
1065500983 10:26382096-26382118 CAGTGTTGGGGGAAGGGACCTGG + Intergenic
1065550758 10:26866683-26866705 CAGGGGTTGGGGAGGCAGGCAGG - Intergenic
1065802353 10:29364117-29364139 TAGTGTTGGGAGACGGAAGCTGG + Intergenic
1065926337 10:30436460-30436482 AAGGGGAGAGGGAGGGAAGCAGG - Intronic
1065974522 10:30830703-30830725 GATGGCTGGGGGAGGGAGGCAGG + Intronic
1066236517 10:33490154-33490176 CAGGGTGGAGGGAGGGACGGAGG + Intergenic
1066293241 10:34033012-34033034 TGGGGTTGGTGGAGGGAGGCAGG + Intergenic
1066425021 10:35300240-35300262 TAGGGATGAGGGAGGGCAGCTGG - Intronic
1066826792 10:39602619-39602641 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1067090560 10:43264132-43264154 CAGGGTTTGGGAAGGTCAGCTGG - Intronic
1067202986 10:44190346-44190368 CAGGGTTGGGGGAGGGTGGAGGG + Intergenic
1067539904 10:47143804-47143826 TGGGGCTGGGGGAGGGAAGGAGG + Intergenic
1067553731 10:47253518-47253540 CAGGGTTGGAGGGATGAAGCAGG + Intergenic
1067710352 10:48645833-48645855 GAGGGTCGGGAGAGGGAAGGAGG + Intronic
1067800266 10:49353786-49353808 GAGGGTGTGGGGAGGGATGCTGG - Intergenic
1067854874 10:49783571-49783593 GAGGGGAGGGGGAGGGAAGGGGG + Intergenic
1068017573 10:51536791-51536813 CAGGGTGGGGGGAGGGGTGAGGG - Intronic
1068585426 10:58792841-58792863 CAGGGGAGGGGGAGGGAAGGGGG - Intronic
1068710684 10:60130207-60130229 CAGAGCTGGGGGAGGGGAGTGGG - Intronic
1069709192 10:70478369-70478391 CAGAGGGGGGCGAGGGAAGCCGG + Intergenic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1069797652 10:71063554-71063576 CAGGGCTTGGGGCGGGAGGCAGG + Intergenic
1069824458 10:71246563-71246585 CTGGGTTGAGGGAAGGAAGAAGG + Intronic
1069832059 10:71287533-71287555 CGGGTTTGGGGGAGGGCAGAGGG + Intronic
1069875737 10:71561875-71561897 CAGGGGTGGGGCAGAGAAGTGGG + Intronic
1069883152 10:71606739-71606761 CAGGGGTGAGGGTGGGAAGGTGG + Intronic
1069886959 10:71629809-71629831 AAGGGTTGGGGGAGAGAAATGGG + Intronic
1069913930 10:71775655-71775677 CTGGGCTTGGGGAGGGAAGGTGG - Intronic
1069939309 10:71943552-71943574 TAGTGTTGGGAGACGGAAGCTGG - Intergenic
1069992394 10:72323518-72323540 CAGGGCAGGGGGAGGCAACCAGG + Intergenic
1070220898 10:74442989-74443011 TGTGGTTGGGGGAGGGAAGAAGG + Intronic
1070501653 10:77078322-77078344 CAGCTTTAGGGGAGGGAAGGTGG - Intronic
1070693294 10:78543328-78543350 CGGGGTTGGGGGCAGAAAGCAGG + Intergenic
1070710263 10:78676326-78676348 CAGGGTTGGGGGTGGGATTCTGG - Intergenic
1070768664 10:79070140-79070162 CGGGGTCGGGGGGGGGAGGCGGG + Intronic
1071075151 10:81740904-81740926 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1071283023 10:84120056-84120078 TAGTGTTGGGAGATGGAAGCTGG + Intergenic
1072066049 10:91872685-91872707 GAGGGGAGGGGGAGGGAAGGGGG + Intergenic
1072203775 10:93184116-93184138 GAGGGTTGGGGGTGGGAGGAAGG - Intergenic
1072422045 10:95297351-95297373 CAAGGTAGTGGGAGGGAAGCGGG + Intergenic
1072689120 10:97559132-97559154 TAGTGTTGGGAGACGGAAGCTGG + Intronic
1072727674 10:97824492-97824514 CAGGGGTGGGTAAGGGAGGCTGG - Intergenic
1072740295 10:97905084-97905106 ATGGGTTGGGGGAGGGAGACTGG + Intronic
1072800208 10:98387536-98387558 TAAGGTTGGGGTAGGGAAGTGGG - Intronic
1073066031 10:100759669-100759691 CAGGGCTGAGGCAGGGCAGCAGG + Intronic
1073073861 10:100811130-100811152 GAGAGGTGGGGGAGGGAAGATGG + Intronic
1073465460 10:103692481-103692503 CAGAGTTGGGGCAGGGAAGAAGG + Intronic
1073539379 10:104305915-104305937 CAGGACTGGGGCAGGGAAGTGGG + Intergenic
1073724083 10:106209804-106209826 CATAGTTGGGGGTGGGAAGAAGG - Intergenic
1073977732 10:109119510-109119532 GAGGGAAGGGGGAGGGAAGGGGG + Intergenic
1073977738 10:109119521-109119543 GAGGGAAGGGGGAGGGAAGGGGG + Intergenic
1074100824 10:110353886-110353908 TAAGGTTGGGAGAGGGAAGGAGG + Intergenic
1074139026 10:110655254-110655276 CGGGGGTGGGGGACGGAAACAGG - Intronic
1074162404 10:110845586-110845608 ATGGGTAGGGGGAGGGAAGGTGG - Intergenic
1074210908 10:111334145-111334167 TAAGGTTGGGAGAGTGAAGCGGG - Intergenic
1074725079 10:116299976-116299998 CAGCTTTGGGGTAGTGAAGCCGG + Intergenic
1074744128 10:116514642-116514664 CTGTGATGGGGGAGGGAAGTGGG + Intergenic
1074752283 10:116598174-116598196 CATGGTGGGGTGAGGGGAGCAGG + Intronic
1075068055 10:119302941-119302963 CAGGGATGGAGAAGGGGAGCAGG - Intronic
1075463972 10:122637636-122637658 TAGGGTTGGGGGTGAGAGGCAGG + Intronic
1075519459 10:123135294-123135316 CAGGCCTGGCGGCGGGAAGCGGG + Intergenic
1075657961 10:124174311-124174333 CAGGGTTGGGAGGGCGGAGCAGG + Intergenic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076184055 10:128432696-128432718 CAGGGGTGGGGCAGGGATGTTGG + Intergenic
1076564276 10:131387368-131387390 CAGGGATGGCCGAGGGGAGCCGG - Intergenic
1076564336 10:131387799-131387821 AGGGGTTGGGGGAGGGAGGGAGG - Intergenic
1076582385 10:131520371-131520393 CAGGGTTGGGGGCAGGACGAGGG - Intergenic
1076616552 10:131759045-131759067 CAGGGCTGGGGGAGGGTGGGCGG - Intergenic
1076779657 10:132717239-132717261 CGGGGGTGGGGGAGGGAGGCGGG - Intronic
1077009001 11:371824-371846 CAGGTGTGAGGGAGGAAAGCCGG - Intronic
1077011019 11:379356-379378 CAGGGTTGCGGGCGGGGTGCAGG + Intronic
1077041680 11:527420-527442 CAGGGGCTGGGGAGGGGAGCTGG - Intergenic
1077214054 11:1387918-1387940 GAGGGTTGGGAGAGGGATGCAGG + Intergenic
1077216565 11:1397592-1397614 CAGGGTTCGGGGAGGAAGCCAGG - Intronic
1077290251 11:1786171-1786193 CAGGGTTGGGGGTGGGGAAGAGG - Intergenic
1077351776 11:2096472-2096494 CAGGGTGGGGGGCGGGCTGCTGG + Intergenic
1077358085 11:2127797-2127819 CAGGGCTGGGGGAGGGGCACAGG + Intergenic
1077368745 11:2171888-2171910 CAGGGGTGGGGGATGTAAGGAGG - Intergenic
1077476319 11:2792113-2792135 CAGGGGTGGCGGAGGGACCCGGG - Intronic
1077616189 11:3675786-3675808 CAGGGTAGGAGTAGGGAAGCTGG + Exonic
1077726826 11:4683124-4683146 GAAAGTGGGGGGAGGGAAGCAGG - Intronic
1077772109 11:5230969-5230991 GAGGGTTGAGGGTGGGAAGAGGG - Intergenic
1077918687 11:6627096-6627118 CAGGGTTGGGGTACTGAAGCTGG + Exonic
1078379041 11:10823054-10823076 CAGTGTTGGGAGAGGGAAAGAGG + Intronic
1078452809 11:11453028-11453050 CAGGGCTGGGTGAGGGCAGGGGG - Intronic
1078642375 11:13108638-13108660 CAGGGCTTGTGGAGGGAAGAGGG + Intergenic
1079138595 11:17792417-17792439 CAGGGATGGGGGTGGGAGGAAGG + Intronic
1079613960 11:22467674-22467696 AAGGGCAGGGGCAGGGAAGCTGG + Intergenic
1080692386 11:34569308-34569330 CAGGGTAGGGGGAGGGGAATGGG - Intergenic
1081282868 11:41231615-41231637 TGGGGTGGGGGGAGGGAAGAGGG + Intronic
1081631436 11:44692627-44692649 CAGGGTGGGAAGGGGGAAGCAGG + Intergenic
1081671604 11:44945637-44945659 CAGGACTTGGGGAGGGATGCAGG + Intronic
1081747078 11:45480868-45480890 CTGGTTTGGGGAGGGGAAGCAGG + Intergenic
1081773761 11:45664715-45664737 CAGGGCTGGGAGCAGGAAGCAGG + Intronic
1081871365 11:46384053-46384075 CAGGGCTGGGGAAGGGAACCTGG + Intergenic
1081950858 11:47041212-47041234 CAGGGTTGGGGAAGAGAAGCTGG + Intronic
1081960227 11:47130635-47130657 CAGTGTGGGGGAAGGGAAGAAGG - Intronic
1082076850 11:47981204-47981226 CAGGATCGGGGGAGAGAGGCGGG + Intronic
1082785262 11:57313184-57313206 CAGTGATGGGGGAGGGAGGCGGG + Exonic
1082798329 11:57394869-57394891 CAGGGTGTGGGGAGGGATGCAGG - Intronic
1082928830 11:58578963-58578985 AAGGGGTGGGGGAGGGAACCTGG + Intergenic
1083051840 11:59784335-59784357 CAGGATTGAGGGAGGGAAAAAGG - Intronic
1083083053 11:60113471-60113493 CAGGGATGGGGGATGGAAAAGGG + Intergenic
1083497103 11:63065446-63065468 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1083681064 11:64352107-64352129 CTAGGATGGAGGAGGGAAGCAGG - Intronic
1083715898 11:64576844-64576866 CTGGGTTGGGGGAGGCAAGCAGG - Intergenic
1083765600 11:64840066-64840088 CAGGGGTTGGGCAGGGCAGCGGG + Intronic
1083798951 11:65035213-65035235 CGGGGTGGGAGGAGGGAACCAGG + Intronic
1083923672 11:65793523-65793545 CTGGGGTGGGGGTGGGAGGCAGG + Intronic
1083939204 11:65886242-65886264 AAGGTTTGGGGTAGGGAAGGTGG + Intronic
1084174510 11:67416331-67416353 CAGGGTGGGGGTGGGGGAGCTGG - Intronic
1084182705 11:67454707-67454729 CAGGGCTGGGGGAGGGGGTCTGG - Intronic
1084290370 11:68161724-68161746 CAGGGATGGAGAAGGGAACCAGG - Intronic
1084326081 11:68401003-68401025 CAGGGCTGGGGGAGGGACATCGG - Intronic
1084362422 11:68677616-68677638 GAGGGGTGGGGGCGGGAAGTAGG - Intergenic
1084421847 11:69064272-69064294 TAGGGAGGGGGGAGGGAAGTGGG - Intronic
1084425475 11:69081703-69081725 CTGGGTTGGGAGAGGAAGGCGGG + Intronic
1084737157 11:71112969-71112991 CTGGCGTGGTGGAGGGAAGCGGG - Intronic
1084932872 11:72570985-72571007 CAGGGTTGGGGCAGGAATGAAGG - Intergenic
1084940880 11:72612659-72612681 ATGGGTTGGGGGAGGGATGGTGG + Intronic
1084945715 11:72637283-72637305 TAGGGCTGGGGGAGGGGAGGCGG - Intronic
1084953202 11:72678014-72678036 CAGGGGAGGGGGAAGGAAGCAGG - Intergenic
1085041869 11:73331444-73331466 CAGGAGTGGGGGAGGGGAGGTGG - Intronic
1085143619 11:74171861-74171883 CAGGGAAGGTGGAGGGAAGTGGG + Intronic
1085239841 11:75044154-75044176 TAGTGTTGGGAGATGGAAGCTGG - Intergenic
1085282863 11:75342243-75342265 CAGGGCTCGGAGAGGGAAGCAGG - Intronic
1085351006 11:75797811-75797833 CAAGGGTGGGGGAGGGTAGAGGG + Intronic
1085442151 11:76575038-76575060 CAGGGTTTGGGCAGGGAGACAGG + Intergenic
1085776817 11:79373970-79373992 CAAGGCTGGGGCAGGAAAGCAGG + Intronic
1086027286 11:82309162-82309184 CAAGGTCAGGGGAGGGAGGCAGG - Intergenic
1086130940 11:83401643-83401665 CAGGTTTGAGGAAGGCAAGCTGG + Intergenic
1086142257 11:83512214-83512236 CAGGATTGGGGGAGAGAAGAGGG - Intronic
1086370671 11:86152498-86152520 CAGGACTAGGGGAGGGAGGCAGG + Intergenic
1086405931 11:86499000-86499022 CATGATTCTGGGAGGGAAGCTGG + Intronic
1087091990 11:94283177-94283199 CTGGGTTAGGGGAGGGAATGTGG - Intergenic
1087129937 11:94660026-94660048 CAGGGTCAGGGGAGGGAGTCGGG - Intergenic
1087203716 11:95372303-95372325 CAGGGTTGGGGGAAGCAGACAGG + Intergenic
1087456739 11:98396353-98396375 TAGTGTTGGGAGATGGAAGCTGG + Intergenic
1087607194 11:100391072-100391094 GAGGGTTGGGGGTGGGAGGAGGG + Intergenic
1087684570 11:101248633-101248655 TAGTGTTGGGAGACGGAAGCTGG - Intergenic
1087909536 11:103737294-103737316 CAGAGTTGAGGTAGGAAAGCGGG + Intergenic
1088568309 11:111196499-111196521 CAGGGTTGTTGGAGGGAAAGAGG + Intergenic
1088646861 11:111924371-111924393 TGGGGCTGGGGGAGGGAATCTGG + Intronic
1088723182 11:112612404-112612426 CAGGGTTGGGGGTGGGAGGGGGG + Intergenic
1088853618 11:113726203-113726225 CAGTGTTAGGGGGGTGAAGCGGG - Intergenic
1089073134 11:115716691-115716713 CGGGGATGGGGGAGGGGAGGAGG - Intergenic
1089136822 11:116255824-116255846 CGGGGTCGGGGGAGGGGGGCAGG + Intergenic
1089260857 11:117223102-117223124 GAGTGTTGGGGCGGGGAAGCAGG + Intronic
1089369191 11:117942102-117942124 AGGGCTTGGGGGAGGGAAGCTGG - Intergenic
1089418977 11:118316700-118316722 CAGGGCTGGGGAAGTGAAGGAGG + Intergenic
1089496127 11:118909513-118909535 CGGGGAGGGGGGAGGGAGGCAGG + Intronic
1089591669 11:119546047-119546069 CAGGGTCTGGGGAGGAAAGTAGG + Intergenic
1089627306 11:119759589-119759611 CAGGGTTGGAGGAGGGTTGAGGG + Intergenic
1089683417 11:120132217-120132239 GAGGGTGCTGGGAGGGAAGCGGG - Intronic
1089713515 11:120335739-120335761 CAGGGCTGCGGGAGAGCAGCTGG - Intergenic
1090053505 11:123401658-123401680 CAGGGGTGGGGGAAGGAAGACGG + Intergenic
1090198779 11:124839419-124839441 CGGGGCTGGGGGCGGGGAGCAGG + Intergenic
1090400363 11:126444933-126444955 CAGGCCTGAGGGAGGGAAGAAGG - Intronic
1090420772 11:126573453-126573475 CTGGGGTGGGTGGGGGAAGCGGG - Intronic
1091232780 11:133999380-133999402 CAGGGTTGGAGGTGGGACCCAGG - Intergenic
1091267739 11:134283681-134283703 ACGGGTTGGGAGAGGGAAGCAGG - Intronic
1091285208 11:134405070-134405092 AAGGGCTGGGGCAGGCAAGCAGG + Intronic
1091337913 11:134786280-134786302 CAGGGTAGGGGGTGGGAAGCAGG - Intergenic
1091395138 12:149772-149794 CAGGGTTGGGGCTGGGCAGCAGG + Intronic
1091568624 12:1665129-1665151 CAGGGCTGGCACAGGGAAGCTGG - Intergenic
1091724002 12:2833293-2833315 CAGGGATGGAGCAGGGAAGCGGG - Intronic
1091772267 12:3160091-3160113 CAGGGCTGGGGGAGGAATGAGGG - Intronic
1091807344 12:3365984-3366006 CGGGGGCGGGGGAGGGAGGCTGG - Intergenic
1091936869 12:4441686-4441708 CATGGGTGGGGGAGGGAAACTGG - Intronic
1091948063 12:4566830-4566852 TAGGGCTGGGGGAGGTAAGTAGG - Intronic
1092065867 12:5589296-5589318 CTGGGATGGGGGAGGGGAGGAGG + Intronic
1092228440 12:6764142-6764164 CAGGGCTGGGGGTGGGAATGAGG - Intronic
1092256481 12:6928713-6928735 CGGGGTTGGCGGAGGAAAACGGG + Intronic
1092404574 12:8210011-8210033 CAAGGTTGGGGAAGGAAGGCCGG - Intergenic
1092502102 12:9058584-9058606 GAGGGTTGGGGGAGGCCAGTAGG - Intergenic
1094037206 12:26084067-26084089 TAGGGTTGGGGGAGGGGGGAGGG + Intergenic
1094093621 12:26678228-26678250 CAGGGATGGAGGAGGGAAGATGG - Intronic
1094386504 12:29900231-29900253 AAGAGTTGGGGGTGGGAAGAGGG - Intergenic
1095131011 12:38542504-38542526 GAGGGTGAGGGCAGGGAAGCTGG - Intergenic
1095351896 12:41223390-41223412 CTGGGTAGGGGGAGAGAAGGAGG - Intronic
1095943514 12:47740882-47740904 CAGAGCTGGGGGAGGAGAGCAGG - Intronic
1095969950 12:47894726-47894748 CAGGGTGGGGCGGGGGAGGCTGG + Intronic
1095976190 12:47942489-47942511 GAGGGGTGTGGGAGGGGAGCTGG - Intronic
1096148416 12:49294539-49294561 CAGGGGAGGGGGAGGGGGGCTGG + Exonic
1096218272 12:49810174-49810196 GGGGGTGGGGGGAGGGAAGGGGG + Intronic
1096250393 12:50028258-50028280 CAGGGGTGAGGGAGAGAAGCAGG + Intronic
1096448854 12:51720455-51720477 TAGGGTTGGGGGAGGGGGGAGGG + Intronic
1096548320 12:52356357-52356379 CAGGGGTGAAGGAGGGCAGCCGG + Intergenic
1096557243 12:52410920-52410942 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1096694593 12:53340535-53340557 CTGGGTGGGGGTAGGGATGCTGG - Intronic
1096742527 12:53704388-53704410 CAGGGTTGGGAGAGAGATTCTGG + Intergenic
1096750518 12:53756047-53756069 CTGGCTTGGTGGAGGGAACCAGG + Intergenic
1096777411 12:53972803-53972825 CAGGATTGGGGGAAGGAGGAGGG - Intergenic
1096796768 12:54082610-54082632 CCGGGCTGGGGGAGGGGAGGCGG + Intergenic
1096814890 12:54195834-54195856 CAGGGTGGGAGGGGGCAAGCAGG - Intergenic
1096979383 12:55719611-55719633 TAGGGTTGGGGGAGGGAACAGGG - Intronic
1097013714 12:55970834-55970856 CATGGTTGGGGGAAGGAAGGAGG + Intronic
1097123372 12:56753210-56753232 AAGGGTTGGGGGCGGGGAGTGGG + Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097233611 12:57526142-57526164 AAGGGTTGGGGGACAGGAGCAGG - Exonic
1097250325 12:57628939-57628961 GAGGGTTGGGAGAGGGGAACAGG + Intronic
1097261945 12:57725390-57725412 CTGGGTTGGCTGAGGGAGGCAGG + Intronic
1098674961 12:73278226-73278248 CAAGGTTGGGGGCTGGAAACTGG - Intergenic
1098880827 12:75915414-75915436 CAGGGTTGGGGGAGTGGGGGTGG + Intergenic
1099356800 12:81646893-81646915 GAAGGTGGGGGGAGGGAAGCAGG + Intronic
1099631514 12:85152317-85152339 CAGTGTTTGTGAAGGGAAGCGGG - Exonic
1099664999 12:85617224-85617246 TAGGGTAGAAGGAGGGAAGCTGG - Intergenic
1099677653 12:85782858-85782880 AAGGGTAGGGTGAGGGAAACAGG + Intergenic
1099918156 12:88922126-88922148 CAGGGATGGAAGAGGGAAGCAGG + Intergenic
1100321038 12:93493226-93493248 GGGGGTCGGGGGAGGGAGGCAGG - Intronic
1100321636 12:93498772-93498794 GGGGGTCGGGGGAGGGAGGCAGG + Intronic
1100337941 12:93650168-93650190 CAGGGTAGCGGGAGGGAGGGAGG - Intergenic
1100349377 12:93764315-93764337 CAGAGTTGCTGGAGGGAAGGGGG + Intronic
1101664112 12:106793930-106793952 TGGGGGTGGGGGAGGGAAGCAGG + Intronic
1102046804 12:109834464-109834486 GGGGGGTGGGGGAGGGCAGCCGG + Intergenic
1102516115 12:113447999-113448021 CAGGGCTGAGGGAGGCAGGCAGG - Intergenic
1102518430 12:113465103-113465125 CAGGGTTTGGAGAGGGAAGAGGG - Intronic
1102745444 12:115245041-115245063 CAGGCTTCTGGGAGGGCAGCGGG + Intergenic
1102773569 12:115499515-115499537 GAGGGTGGGGGCAGGGAAGGGGG + Intergenic
1103133886 12:118491157-118491179 CAGGGTTGGAGGAGGGTGGGTGG + Intergenic
1103317297 12:120066454-120066476 CTGGGTTGGGGGAAAGAGGCAGG + Intronic
1103362223 12:120361330-120361352 CAGGGTTGGGTGGAGGAAGGTGG - Intronic
1103566067 12:121816267-121816289 CACGGTCGAGGGAGGGGAGCAGG - Intronic
1103566756 12:121819917-121819939 GAGGGTGGTGGGAGGGAGGCAGG + Intronic
1103703127 12:122858284-122858306 CAGGGCTGGGGATGGGAAGGAGG - Intronic
1103734427 12:123050202-123050224 CAGGTTTGGGAGAGACAAGCTGG + Intronic
1103747138 12:123132674-123132696 CAGGGGTTGGGGAGGGGAGATGG - Intronic
1103964539 12:124630425-124630447 CTGGGCTGGGTGAGAGAAGCAGG + Intergenic
1104036458 12:125100779-125100801 GAGTGTTGTGGGAGGGAGGCTGG - Intronic
1104092870 12:125530377-125530399 CTGGTTTGGGGGTGGGAAGTGGG + Intronic
1104667692 12:130659000-130659022 CATGGTGGAGGGAGGGAGGCTGG - Intronic
1104982835 12:132581860-132581882 CAGGCATGGGGGAGGGGCGCGGG - Intronic
1105063192 12:133172777-133172799 CTGGGATGTGAGAGGGAAGCAGG + Intronic
1105375666 13:19842196-19842218 GTGGGTTGGTGGAAGGAAGCTGG - Intronic
1105695657 13:22886162-22886184 TAGTGTTGGGAGATGGAAGCTGG - Intergenic
1106020448 13:25909796-25909818 CTGAGTTGGGGGAGGGCGGCGGG - Intronic
1106088333 13:26562741-26562763 GGGTGTTGAGGGAGGGAAGCTGG + Intronic
1106520658 13:30494798-30494820 AGGGGTTGGGGGAGGGAAAGGGG - Intronic
1106845665 13:33735635-33735657 AAGGGTTGGGGAAGGTCAGCGGG - Intergenic
1106904071 13:34386590-34386612 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
1107058635 13:36131732-36131754 CACCGTCGGGGGAGGGAAGGAGG + Intergenic
1107874445 13:44777713-44777735 CAGGGATGGGAGAGGGTAGGGGG + Intergenic
1107938132 13:45362115-45362137 CAGGGCTGGAGGTGGGAATCTGG - Intergenic
1107939496 13:45371487-45371509 CAGGGTTGGGAGTGGAAACCAGG - Intergenic
1107964838 13:45589067-45589089 AAGGGTTGGGGAAGGATAGCAGG - Intronic
1108061652 13:46539080-46539102 GAGGTTTGGGGGAAGGAAGGGGG - Intergenic
1108576933 13:51798976-51798998 CAAGCTTAGGGGAGGGAAGCGGG + Intronic
1109082243 13:57919322-57919344 TAGGGTTGGGGGAAGGGAGGAGG - Intergenic
1109407622 13:61921949-61921971 CAGGGTGGGGAGAGGAAAGAAGG - Intergenic
1109980725 13:69902755-69902777 TAGGGTTGGGGGAGGGGGGAGGG + Intronic
1109997415 13:70146764-70146786 TGGGGTCGGGGGAGGGAAGAGGG + Intergenic
1110325759 13:74213591-74213613 GAGGGAAGGGGGAGGGAAGGAGG - Intergenic
1110841285 13:80146532-80146554 GAGGTTTGGGGCAGGGGAGCAGG - Intergenic
1110878377 13:80539357-80539379 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1111244306 13:85515349-85515371 CAGGGTCAGTGGAGGAAAGCGGG + Intergenic
1111331468 13:86764739-86764761 CAGGCTTGGAGCAGGGAAGGAGG + Intergenic
1111365397 13:87236505-87236527 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1111375655 13:87376670-87376692 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1111457312 13:88502122-88502144 CAGGGTGGGGGGTGGGAGGAGGG - Intergenic
1112291031 13:98143786-98143808 CGGGGTCGGGGGAGGCGAGCGGG - Intronic
1113109108 13:106802862-106802884 CGGGGTTGCGGGAGGCAGGCTGG + Intergenic
1113230911 13:108214495-108214517 AAGGGTTGGGGGAGAGTAGGGGG - Intronic
1113362986 13:109648687-109648709 GAGGGTTGGGGGTGGGAGGAGGG - Intergenic
1113458357 13:110464823-110464845 CAGGGATGGGGTGGGGAGGCTGG - Intronic
1113676786 13:112213242-112213264 CAGGGTGGGAGCAGGGCAGCAGG + Intergenic
1113741381 13:112714470-112714492 CAGGGTTCGGGGAGTGAGGAGGG - Intronic
1113764718 13:112874197-112874219 CTGGTTTGGGGGAGAGCAGCAGG + Intronic
1113791675 13:113032390-113032412 TAGCTGTGGGGGAGGGAAGCAGG - Intronic
1113901715 13:113801544-113801566 CAGGGCTGGGGGAGGAAATCAGG - Intronic
1113957343 13:114105892-114105914 CAGCGTGGGGGAAAGGAAGCGGG + Intronic
1114182927 14:20380837-20380859 CAGGGTTGGGGCAGGGGTGTGGG - Intronic
1114258171 14:21019816-21019838 CAGGATTTGGGGAAGGAAGAAGG - Intronic
1114311104 14:21468051-21468073 GGGGGATGGGGGAGGGAAGATGG + Intronic
1114458427 14:22872134-22872156 CAGGGCTGGGGGCGGGGAGGCGG - Exonic
1114522265 14:23347032-23347054 CAGGGGTGGGGTGGGGGAGCGGG + Intronic
1114554745 14:23555673-23555695 TGGGGTGGGGGGAGGGAAGGGGG - Intronic
1114557707 14:23571319-23571341 CAGGGTTGGCGGGAGGAGGCAGG + Exonic
1115136564 14:30116295-30116317 CAGGGTTGGTGGGGGGAAGGAGG - Intronic
1115399412 14:32939792-32939814 CTGGGGAGGGGGAGGGAAGGCGG + Intronic
1115432874 14:33341543-33341565 AAGGGATGCGGGAGGGAAGTGGG + Intronic
1115498227 14:34027321-34027343 AAGGGGAGGGGGAGGGAAGGGGG + Intronic
1115498261 14:34027391-34027413 AAGGGGAGGGGGAGGGAAGGGGG + Intronic
1116430083 14:44836127-44836149 CCGGGGTGGGGGAGGGCAGAGGG - Intergenic
1116514392 14:45787851-45787873 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
1116550220 14:46227784-46227806 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
1116790501 14:49335148-49335170 CAGGGTTGAAGCTGGGAAGCAGG - Intergenic
1116802071 14:49453602-49453624 CAAGCTTGGGGGTGGGGAGCTGG - Intergenic
1116905189 14:50396960-50396982 CCGGGCCGGGGGTGGGAAGCTGG - Intronic
1117030176 14:51660759-51660781 GAGTGCTGGGGGAGGGAGGCAGG + Intronic
1117047027 14:51823583-51823605 CAGGGCTGGGGGTGGGAGCCAGG - Intergenic
1117179431 14:53177226-53177248 TAGTGTTGGGAGATGGAAGCTGG + Intergenic
1117202651 14:53408365-53408387 CAGGAGTGGGGGAGGGAGGCAGG - Intergenic
1117202659 14:53408384-53408406 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1117202666 14:53408403-53408425 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1117202673 14:53408422-53408444 CAGGAGTGGGGGAGGGAGGCAGG - Intergenic
1117256233 14:53980903-53980925 TAGGGGTGGGAGAGAGAAGCAGG - Intergenic
1117920575 14:60722903-60722925 GCGGGATGGGGGTGGGAAGCTGG + Intronic
1118293686 14:64549569-64549591 CAGGGTTGAGGTGGGGAAGCAGG - Intergenic
1118379777 14:65208172-65208194 GTGGGTTGGGGGTGGGGAGCCGG + Intergenic
1118391991 14:65303578-65303600 GAGGGTTAGGGGTGGGAGGCGGG + Intergenic
1118515195 14:66520849-66520871 GAGGGTAGGGGGTGGGAAGAGGG - Intronic
1118607636 14:67515225-67515247 CGGGCTTGGGGGCGGGGAGCAGG - Exonic
1118718390 14:68576390-68576412 CTGGGTTGGGGGTGGCAGGCAGG - Intronic
1119265348 14:73260838-73260860 CTGGCCTGGGGGAGGGGAGCAGG + Intronic
1119522370 14:75295367-75295389 CAGGGATGGGGGTGGGAGGATGG - Intergenic
1119536920 14:75410152-75410174 CAGGGGTGGGAGTAGGAAGCAGG - Intergenic
1119771465 14:77222661-77222683 AAGGGCTGGTGGAGGGAAGCAGG - Intronic
1119859104 14:77923882-77923904 CAGGGAGAGGGGAGGGGAGCAGG + Intronic
1119866808 14:77981140-77981162 CTGGGCTGGGGGAGGGCAGCAGG - Intergenic
1119959420 14:78837616-78837638 CAGGCATGGGGGTGGGGAGCAGG - Intronic
1120780224 14:88479849-88479871 CAGGGTAGGGGTAGGGAGACGGG + Exonic
1121081911 14:91115124-91115146 CAGTGCTGGAGGAGGGCAGCAGG + Intronic
1121122167 14:91382980-91383002 CAGAGTTGGAGGATGGAAGGAGG - Intronic
1121123627 14:91392270-91392292 CAGGGTTGGGGGTGGCATGTAGG - Intronic
1121299445 14:92858814-92858836 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1121472656 14:94167284-94167306 CAGGGTTTGGGGTGGGAAGGAGG + Intronic
1121827825 14:97025296-97025318 CAGGGTTTGAAGAGGGAAGATGG - Intergenic
1122064251 14:99160428-99160450 CTGGGGAGGGGGTGGGAAGCAGG + Intergenic
1122078056 14:99248168-99248190 GAGGGTTGGGAGAGGAGAGCAGG - Intronic
1122246284 14:100405511-100405533 CAGGGGATGGGGAGGGAGGCTGG + Intronic
1122279180 14:100611061-100611083 GAGGGCTGGGAGAGGGAGGCTGG - Intergenic
1122293953 14:100694483-100694505 GAGGGATGGGGCGGGGAAGCGGG + Intergenic
1122297150 14:100712086-100712108 CTGGGTTGTGGGAGGGGAGCAGG + Intergenic
1122692440 14:103537685-103537707 CTGGGTGGGTGGAGGGCAGCAGG + Intergenic
1122741172 14:103872307-103872329 CAGGGAGGGGCGGGGGAAGCTGG - Intergenic
1122796936 14:104210717-104210739 CAGGGCTGGGGGAGGGATTGAGG + Intergenic
1122816611 14:104317111-104317133 CAGGATGGCGGGAGGGAAGCAGG - Intergenic
1122817164 14:104319452-104319474 CAGGGTGGGGAGAGGGTAACAGG + Intergenic
1122823710 14:104359639-104359661 CAGGGCTGGGGGCCGGAGGCAGG - Intergenic
1122863471 14:104593129-104593151 CAGGGTTGGGGGAGACAAGCTGG + Exonic
1122967224 14:105137025-105137047 GGGGGTTGGGGGAAGGGAGCGGG - Intergenic
1123223227 14:106875710-106875732 CAGGGTGGGGGCAGGGCTGCAGG - Intergenic
1123989088 15:25670018-25670040 CAGGGCTGGGGGAGGGAACGAGG + Intergenic
1124127079 15:26945807-26945829 CAGGGGTGGGGGCGGGTGGCAGG - Intronic
1124208584 15:27743849-27743871 CCTGGCTGCGGGAGGGAAGCTGG - Intergenic
1124390126 15:29247680-29247702 CAGGGTTGGGGGAGGGAAGCTGG - Intronic
1124580889 15:30954011-30954033 CAGGGGTGGGGCAGGGAAGCAGG - Intronic
1124637594 15:31374855-31374877 GGGGGGTGGGGGAGGGAAGCGGG + Exonic
1124914090 15:33951412-33951434 AAGGGGTGGGGGAGGGAGGAGGG + Intronic
1124956328 15:34362903-34362925 CTGGGTTGGGGAAGGGGAGTGGG - Intronic
1125090907 15:35791598-35791620 TAGGGTTGGGGGAGTGGAGTTGG + Intergenic
1125091094 15:35793757-35793779 CAGGGTTGGGGGATTGGGGCAGG - Intergenic
1125119515 15:36137857-36137879 GAGGGTTGGGGGTGGGAGGAGGG - Intergenic
1125167120 15:36720418-36720440 TAGGGTCGGGGGAGGGAGGAGGG - Intronic
1125178691 15:36856700-36856722 GAGGGGAGGGGGAGGGAAGGGGG - Intergenic
1125516241 15:40322987-40323009 CAGGGTTGGCGGGGTGAGGCGGG + Intergenic
1125604202 15:40930764-40930786 CGGGCTTGGGGGTGGGAGGCAGG + Intronic
1125922223 15:43531792-43531814 CTGGTCTGGGGGAGGGAAGAGGG + Intergenic
1126467910 15:48977242-48977264 GAGGGTGGAGGGTGGGAAGCTGG - Intergenic
1126857335 15:52851673-52851695 AAGGGTTGGGGGAGGCAACTTGG - Intergenic
1127761707 15:62146184-62146206 CAGGGTGAGGGTAGGGAAGGAGG - Intergenic
1127812132 15:62573582-62573604 CAGGGAGAGAGGAGGGAAGCTGG - Intronic
1128259286 15:66221296-66221318 CAGGAGTGTGGGAGGGAGGCAGG - Intronic
1128368815 15:67024185-67024207 CAGGCTTGGGGGAGGGGTGGTGG + Intergenic
1128499961 15:68221214-68221236 GAGGGTTGGGGGAGGGGGGAGGG - Intronic
1128529452 15:68433741-68433763 CAGGGTCAGGGTAGGGAAGGAGG + Intergenic
1128647495 15:69388128-69388150 CAGGGAGGGAGGAGGGAGGCAGG - Intronic
1128765378 15:70248111-70248133 CAGTGTTGGGGGTGGGCAGTGGG - Intergenic
1128781123 15:70359343-70359365 AGGGGTTGGGGGTGGGAAGGTGG + Intergenic
1128794552 15:70455770-70455792 GGGGGGTGGGGGAGGGAAGTAGG - Intergenic
1129160911 15:73747255-73747277 CAGGGATGGGGGCAGGAAGGGGG - Intronic
1129227125 15:74176503-74176525 CAGGATTGGGGGAATGGAGCTGG + Exonic
1129482406 15:75838323-75838345 TAGGGTTGGGGGAGAGAATTGGG - Intergenic
1129598514 15:76983264-76983286 AGGGGTGGGGGGAGGGAGGCAGG + Intergenic
1129698369 15:77753533-77753555 GGGGGTAGGGGGAGGGAAGTAGG + Intronic
1129825706 15:78633873-78633895 CAGTGCTGGGGCAGGGGAGCAGG + Intronic
1129826332 15:78637443-78637465 CAGTGCCGGGGCAGGGAAGCAGG + Intronic
1129836332 15:78709630-78709652 CAGGGTCGGGGTCGGGAGGCTGG - Intronic
1129877590 15:78986236-78986258 TGGGGATGGGGGTGGGAAGCTGG + Intronic
1129910941 15:79225764-79225786 CAGGGTTGGGGGCGTGGGGCAGG + Intergenic
1130200773 15:81824541-81824563 TGGGGTTGGGGGAGGGGAGAGGG + Intergenic
1130510855 15:84588071-84588093 CAGGGTCGGGGTGGGGAGGCGGG + Intergenic
1130970254 15:88726633-88726655 GGGGCATGGGGGAGGGAAGCAGG + Intergenic
1131081370 15:89539101-89539123 GAGGGAGGGGGGAGGGAAGGAGG + Intergenic
1131230531 15:90655666-90655688 TTGGGTTGGGACAGGGAAGCTGG - Intergenic
1131462166 15:92625149-92625171 CAGAGTTTGGGGAGGGAGGGAGG - Intronic
1132255765 15:100374176-100374198 CAGGATTGGGTGGGGGAAGGAGG - Intergenic
1132284971 15:100656431-100656453 CAGGGATGGGGCTGGGAGGCTGG - Intergenic
1132385458 15:101397126-101397148 CAGGGTTTCGGCAGGGCAGCAGG + Intronic
1132544457 16:527029-527051 AGGGCCTGGGGGAGGGAAGCCGG - Intergenic
1132664596 16:1075863-1075885 CAGGGTAGGGGGAGAGAGGGAGG - Intergenic
1132664613 16:1075915-1075937 CAGGGTGGGGGGAGAGAGGGAGG - Intergenic
1132672119 16:1106288-1106310 CACGGAAGGAGGAGGGAAGCGGG - Intergenic
1132752653 16:1465887-1465909 CAGGGCAGGGGCAGGGCAGCGGG + Intronic
1132833486 16:1941223-1941245 CAGGGGTGGGGGAGGGACGGGGG - Intronic
1132868366 16:2104721-2104743 CAGGGCTGGGGGTGGGAGCCAGG - Intronic
1132943317 16:2519200-2519222 CAGGGCTGTGGGAGGAAGGCGGG - Exonic
1132978410 16:2721552-2721574 CCGGGTCGGGGGTGGGAGGCGGG + Intergenic
1133020097 16:2963462-2963484 CGGGGGAGGGGGAGGGGAGCAGG - Intergenic
1133087253 16:3374606-3374628 CAGAATTGGGGGAAAGAAGCAGG + Intronic
1133128786 16:3663639-3663661 GAGGGCTGGGGGAGCCAAGCGGG + Exonic
1133219940 16:4315720-4315742 GAGGGGTGAGGGAGGGAAGTGGG - Intronic
1133335693 16:5005387-5005409 CTGGGTTGGGGGAGGGGAGATGG + Intronic
1133442323 16:5831174-5831196 CAGTGTTGGAGGTGGGAACCTGG + Intergenic
1133528567 16:6630965-6630987 TAGATTTGGGGGAGGGAAGGAGG + Intronic
1133839540 16:9394891-9394913 GAGGGAGGGGAGAGGGAAGCAGG - Intergenic
1133998193 16:10763131-10763153 CAGGGGTGGTAGAGGGAGGCCGG + Intronic
1134058072 16:11182593-11182615 CAGGCTGGGCCGAGGGAAGCAGG + Intergenic
1134182761 16:12061102-12061124 CAGGGCTTGAGGAGGGGAGCTGG - Intronic
1134213430 16:12297125-12297147 CAGGGTTAGGGGTCGGAGGCTGG + Intronic
1134635030 16:15785661-15785683 CAGGTTTGTGGGTGGGAAGATGG - Intronic
1134710957 16:16326764-16326786 CAGGGCTGGGGGTGGGAGCCAGG + Intergenic
1134948626 16:18341845-18341867 CAGGGCTGGGGGTGGGAGCCAGG - Intergenic
1135191408 16:20357735-20357757 CAGGGATGGGGGTGGGAAGGTGG + Intergenic
1135597755 16:23756306-23756328 CAAGGTGGGGGGAAGGAAGGTGG + Intronic
1135671141 16:24376623-24376645 CATGGTGGGGAGAGGGAAGAAGG - Intergenic
1135870063 16:26141500-26141522 CAGGGTAGGGGGAGGTAATATGG + Intergenic
1135986557 16:27188707-27188729 AAGGGAAGGGGAAGGGAAGCGGG + Intergenic
1136036494 16:27544458-27544480 CTGGGCTGGGGGAGGGGAGGAGG + Intronic
1136042066 16:27587327-27587349 TGGGGTTGGGGTAGGGAGGCAGG + Intronic
1136089126 16:27905855-27905877 CAGGGGTGGGAGTGGGAAGGTGG - Intronic
1136412665 16:30086166-30086188 CAGGGCTGGGGGAAGGGAGCGGG + Exonic
1136482629 16:30552083-30552105 GAGGGTTAGGGGAGGGAACTAGG + Intronic
1136540122 16:30924088-30924110 CGGGGTGGGGGGAGGGGAGCTGG + Intronic
1136899962 16:34024538-34024560 TGGGGTTGGGGGAGGGGAGAGGG + Intergenic
1137345382 16:47653208-47653230 CAGGGTGGAGGAAGGGAACCAGG + Intronic
1137415953 16:48279652-48279674 CTGGGGTGGGGGAGGGGATCTGG + Intronic
1137788622 16:51155703-51155725 TAGGGTTGGGGGAGGGGTGCGGG + Intergenic
1137907613 16:52339380-52339402 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
1137914685 16:52416209-52416231 CATGATTGGGGGAGGGAAAGAGG + Intergenic
1138396103 16:56705825-56705847 CAAGGTTGGGGGAGGGAGGAAGG - Intronic
1138430124 16:56963148-56963170 CAGGCTGGGGGTAGGGAGGCGGG + Intronic
1138464899 16:57182383-57182405 TAGGGTGGGGGGAGGGAGGATGG - Intronic
1138505174 16:57474944-57474966 CCAGGTTGGGGCAGGGCAGCAGG + Exonic
1138554618 16:57764252-57764274 GAGGGTGGTGGGAGGGAGGCTGG + Intronic
1138637406 16:58352143-58352165 AAGGGCAGGGGGAGGGAAGAGGG - Intronic
1138701949 16:58873280-58873302 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1139018379 16:62717843-62717865 CAGGGTGGGGTGAGGGTGGCAGG + Intergenic
1139469689 16:67171473-67171495 CCTGGCTGGTGGAGGGAAGCTGG + Intronic
1139492674 16:67294850-67294872 TGGGGTTGAGGGAGTGAAGCAGG - Intronic
1139547523 16:67656657-67656679 CAGGATTGGGGTGGGGAATCAGG - Intronic
1139588419 16:67919167-67919189 CAGAGTGGAGGCAGGGAAGCGGG + Intronic
1139916699 16:70432803-70432825 CAGGTGTGTGGGACGGAAGCTGG + Intronic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140194330 16:72844462-72844484 GATGGTTGGGCGAGGGAGGCAGG - Intronic
1140697418 16:77548677-77548699 AAGAGTTGGGGGAGGGGAGGAGG + Intergenic
1141312923 16:82933091-82933113 CAGGGTTGGGGGAGTGATATTGG + Intronic
1141643578 16:85355541-85355563 CAGGGCTGAGGGCGGGGAGCAGG + Intergenic
1141764110 16:86047320-86047342 GAGGGTTGAGGGAGGGAAGCTGG + Intergenic
1141979669 16:87542109-87542131 ACAGGTTGGGGGTGGGAAGCTGG + Intergenic
1142000166 16:87659882-87659904 CCAGGCTGGGGGAGGGAACCTGG - Intronic
1142137014 16:88456074-88456096 CCGGGTTGGGGCCGGGGAGCCGG + Intronic
1142200581 16:88759421-88759443 CAGGCCAGGGGGAGGGCAGCTGG - Intronic
1142373159 16:89694120-89694142 CTGGGCTGGGGGAGAGGAGCCGG + Intronic
1142414225 16:89932693-89932715 CAGGGCTGGGATAGGGAGGCTGG - Intronic
1142809893 17:2390738-2390760 CAGGAGTGGGTGTGGGAAGCTGG - Intronic
1143078828 17:4366576-4366598 GCGGGTTGAAGGAGGGAAGCGGG - Intronic
1143114790 17:4576385-4576407 CAGGGTTAGTGGAGGTAAGGAGG + Intergenic
1143447595 17:7018455-7018477 CATGGTTGGGAGAGGGGGGCCGG + Intergenic
1143478849 17:7217463-7217485 CTGGGGTGGGGGAGGGGAACTGG + Intronic
1143592709 17:7895189-7895211 CAGGGATGGGGGAAGGGATCAGG - Intronic
1143634424 17:8156275-8156297 CGGGGATGGGGGAGAGATGCGGG - Intronic
1143763832 17:9124420-9124442 CAGGCCTGTGGGTGGGAAGCCGG + Intronic
1143965735 17:10755538-10755560 CAGGGTTGCGGGATGGGAGGTGG - Intergenic
1144091486 17:11861167-11861189 TGGGGTTGGGGGAGGGAGGAGGG - Intronic
1144208043 17:12993087-12993109 CAGGGGTGGGGGACAGGAGCTGG + Intronic
1144222526 17:13112970-13112992 CAGGGCTAAGGGAGTGAAGCTGG + Intergenic
1144665307 17:17098416-17098438 GAGGGTCGGGGGAGAGAAGTGGG - Intronic
1144734520 17:17547603-17547625 CAGGGCTGGGGGAGCCATGCAGG - Intronic
1145001779 17:19310343-19310365 CAGGGTGGGCGCAGGGATGCAGG + Intronic
1145875186 17:28313919-28313941 TAGAGATGGGGGAGGTAAGCAGG + Intergenic
1146764225 17:35504708-35504730 TAGTGTTGGGAGATGGAAGCTGG - Intronic
1146913793 17:36665264-36665286 CAGAGGTGGGGAAGGGAAGGGGG - Intergenic
1147159233 17:38560935-38560957 CAGGGCTGGAGGAGGTAACCAGG - Intronic
1147160146 17:38564754-38564776 TGGGGGTGGGGGCGGGAAGCAGG + Intronic
1147388001 17:40092898-40092920 CGGTGATGGGGGAGGGAGGCAGG + Exonic
1147563768 17:41524360-41524382 CCGGGTAGGTAGAGGGAAGCAGG - Exonic
1147629139 17:41918804-41918826 CCGGGTTGGGGGACGGAGGCAGG + Intronic
1147742081 17:42675499-42675521 GAGGGGGGAGGGAGGGAAGCAGG - Intronic
1147904976 17:43816726-43816748 CAGCATTAGTGGAGGGAAGCGGG + Intronic
1147981933 17:44280157-44280179 CAGGGTCAGGGGAAGGAAGAGGG - Intergenic
1148050944 17:44769695-44769717 CTGGGTGGGGGGAGGGCAGAGGG - Intronic
1148110583 17:45143005-45143027 CAGGCCTGGGGCAGGGAAGGTGG - Intronic
1148122619 17:45221882-45221904 CAGGGTTGGGGGAGGAAGTCAGG - Exonic
1148146171 17:45366464-45366486 CAGGGGTGGGGGTGGGGAGCCGG - Intergenic
1148157632 17:45432691-45432713 GGGGGTTGGGGGTGGGAAGTGGG - Intronic
1148246115 17:46031994-46032016 CATGGTTGGGGGATGGAACCAGG - Intronic
1148323208 17:46769754-46769776 AAGGGTTTGGGGAGGGTAGCCGG + Intronic
1148492805 17:48034044-48034066 GAGAGATGGGGCAGGGAAGCAGG - Intronic
1148577773 17:48723496-48723518 CTAGGTTGGGGAAGGAAAGCTGG + Intronic
1148803341 17:50247880-50247902 CAGGCTTGGTGGTGGGCAGCTGG - Intergenic
1148860940 17:50604067-50604089 CAAGGTTGGGGGTGGGGAGCAGG + Intronic
1148887822 17:50786463-50786485 CAGGGTAGGAGGAGGGAGGATGG + Intergenic
1148986046 17:51622220-51622242 AAGGGTTGGGGGAGGGAATGTGG + Intergenic
1149013031 17:51877142-51877164 AAAGCTTGGGGGAGGGAAGATGG - Intronic
1149269106 17:54957072-54957094 CAGGGTTTGGGGAAAAAAGCAGG + Intronic
1149424964 17:56546007-56546029 GAGGGTGGGGGGAGGGGAGGAGG + Intergenic
1149496088 17:57118467-57118489 CAGGGGTGGGGGAGGCAGGCTGG + Intronic
1149637218 17:58180747-58180769 CAGGGTGCAGGGAGGGAAGGGGG - Intergenic
1150122434 17:62615432-62615454 ATGGGGTGGGGGAGGGAAGAAGG + Intronic
1150219017 17:63485380-63485402 CAGGTTTGGGGGTGGGGAGGTGG - Intronic
1150370729 17:64635501-64635523 AGGGGATGGGGGAGGGAAGATGG - Intronic
1150433788 17:65139076-65139098 CTGGGGTGGAGGAGGGGAGCTGG - Intronic
1150649169 17:66998778-66998800 CAGGGTGGGGGTGAGGAAGCAGG - Intronic
1150806240 17:68321431-68321453 CAGGGTTGGGAGATGGGAACTGG - Intronic
1150976343 17:70091401-70091423 CTGTGTTGGAGGAGGGTAGCTGG - Intronic
1151106125 17:71618882-71618904 CGGGGTTGGGGGAGGGGGGAGGG + Intergenic
1151205207 17:72501694-72501716 AAGGGTTGGGGTAGGGACCCAGG - Intergenic
1151227166 17:72655978-72656000 CAGGGCTGCAGGAGGGGAGCTGG - Intronic
1151283377 17:73092693-73092715 CACGTGTGCGGGAGGGAAGCAGG - Intronic
1151328334 17:73392187-73392209 AGGGGGTGGGGGAGGGTAGCTGG + Intronic
1151362035 17:73594970-73594992 AAGGGCTGGGGGAGTGAAGCAGG - Intronic
1151469109 17:74306939-74306961 CAGGGTTGGGGCTGAGAATCTGG - Intronic
1151479583 17:74362203-74362225 TGGGGTTGGGGGAGGGAACTGGG - Intergenic
1151865555 17:76799748-76799770 CAAGGTTGGGGGTGGGAACAAGG - Intergenic
1152008032 17:77694721-77694743 CAGGGAGTGGGGAGGGAAGGAGG - Intergenic
1152016445 17:77754004-77754026 CAGGGCTGGGGGTGGGAGGCAGG - Intergenic
1152044727 17:77928440-77928462 CAGGGTGTGGGGAGGGTAGTGGG + Intergenic
1152193702 17:78903738-78903760 GAAGGATGGGCGAGGGAAGCTGG + Intronic
1152194707 17:78910583-78910605 AAGGGTTGGGGGAGGAGAGAGGG - Intronic
1152323149 17:79619794-79619816 CAGGGCTGGAGGAGGGGAGATGG - Intergenic
1152418092 17:80175896-80175918 CAGGGATGAGAGAGGGAAGCAGG + Intronic
1152432626 17:80257782-80257804 GAGGGCTGGGGCGGGGAAGCAGG + Intergenic
1152528431 17:80902843-80902865 CAGGGTTTCGGGAGGGAAGGCGG - Intronic
1152586721 17:81192642-81192664 CAGGGATGGGAGAGGTCAGCGGG + Intronic
1152594655 17:81232352-81232374 CAGGGTTGGGGGACCGTGGCTGG + Intronic
1152619997 17:81358357-81358379 GAGGCATGGGGGATGGAAGCTGG + Intergenic
1152657818 17:81528089-81528111 CGGGGTTGGAGGAGGGGGGCAGG + Intergenic
1152923847 17:83079002-83079024 CCGGGAGGAGGGAGGGAAGCCGG + Intergenic
1153185479 18:2481477-2481499 CAGGGCCGGGAGTGGGAAGCTGG + Intergenic
1153285102 18:3449791-3449813 CGGGGGTGGAGGAGGGAAGGAGG + Intronic
1153713272 18:7820938-7820960 CAGGGCTGGGGGAGGCAGGTGGG - Intronic
1153826316 18:8878346-8878368 TAGTGTTGGGAGATGGAAGCTGG + Intergenic
1154014079 18:10601047-10601069 TAGTGTTGGGAGATGGAAGCTGG + Intergenic
1154255467 18:12777673-12777695 CAGGAATGGTGCAGGGAAGCCGG - Intergenic
1155135451 18:22987229-22987251 GAGGGAAGGGGGAGGGAAGGAGG + Intronic
1155250810 18:23951599-23951621 CCCGGTTTGGGGAGGGAAGATGG + Intronic
1155630540 18:27887533-27887555 CAGGGAAGGAGGAGGGAGGCAGG - Intergenic
1156978201 18:43251866-43251888 CAGGGATGGAGGAGAGAAGTGGG + Intergenic
1156990887 18:43406231-43406253 CAGGCTCTGGGGAGGCAAGCAGG - Intergenic
1157008609 18:43618249-43618271 TGGGGTTGGGGGAGGGGAGAGGG + Intergenic
1157315036 18:46579823-46579845 CAGGGCTAGGGATGGGAAGCAGG - Intronic
1157384923 18:47252402-47252424 AAAGGGTGGGGCAGGGAAGCAGG + Intergenic
1157490004 18:48116575-48116597 CAGGGTAGCGGTAGGAAAGCCGG - Intronic
1157686080 18:49643954-49643976 CAGAGCTGGGGGAGGGAAAATGG - Intergenic
1158372582 18:56826050-56826072 TGGGGTTGGGGGAGGGCAGGTGG + Intronic
1158657968 18:59358579-59358601 CGGGGGTGGGGGGTGGAAGCGGG + Intronic
1159042780 18:63340899-63340921 CTGTGTTGTGGGAGGCAAGCAGG - Intronic
1159388652 18:67759550-67759572 CTGGGTTGGAGCAGGGAAGGGGG - Intergenic
1159871074 18:73760155-73760177 CAGGGTGGGGAGAGGTGAGCTGG - Intergenic
1159946341 18:74447092-74447114 CAGGCTGAGGGGCGGGAAGCTGG + Exonic
1160468871 18:79108187-79108209 CAGGGATGCTGGAGGGAAGGAGG + Intronic
1160529539 18:79555427-79555449 CAAGCTTGAGGGAGGGAAGCCGG - Intergenic
1160726755 19:620891-620913 CAGGGGAGGGGGAGGGGAGGAGG + Intronic
1160726774 19:620932-620954 CAGGGGAGGGGGAGGGGAGGAGG + Intronic
1160796423 19:947801-947823 CAGGGCCGGGGGAGTGGAGCCGG + Intronic
1160816155 19:1036691-1036713 CAGAGAGCGGGGAGGGAAGCCGG - Intronic
1160835428 19:1122604-1122626 CGGGGGTGGGGGGCGGAAGCGGG - Intronic
1160925133 19:1540694-1540716 CTGGGGTGGGGGGAGGAAGCAGG + Intergenic
1160982783 19:1823851-1823873 CAGGCTTGGGAGAGGGTGGCTGG + Intronic
1161137509 19:2628676-2628698 AGGGGCTGGGGGAGGGAAGAGGG - Intronic
1161199361 19:3005969-3005991 CTGGGGTCGGGGAGAGAAGCAGG + Intronic
1161207245 19:3047386-3047408 CAGGGTTTGGGGAGGGTCCCGGG - Intronic
1161208287 19:3053607-3053629 CAGGGGAGGAGGAGGGAAGCCGG + Exonic
1161473778 19:4473613-4473635 CAGGGTTGGAGGAGGCAGTCAGG + Intronic
1161588149 19:5116726-5116748 CAGGGTGGGGGCAGGGAATGCGG + Intronic
1161590506 19:5127212-5127234 CTGGCCTGAGGGAGGGAAGCGGG - Intronic
1161643082 19:5436381-5436403 GAGGGGAGGGGGAGGGAAGGGGG + Intergenic
1161657432 19:5524823-5524845 GAAGGTTGGGGGATGGAAGGCGG - Intergenic
1161768253 19:6218340-6218362 CAGGGTACTGGGAGGGAGGCTGG + Intronic
1161977591 19:7615104-7615126 CAGGCTGGGTGGAGGGAAGATGG + Intronic
1162003621 19:7763722-7763744 CAGAGGTGGGGGTTGGAAGCTGG + Intronic
1162050421 19:8029201-8029223 CAGGGTGGGGGGCGGGGGGCAGG + Intronic
1162186957 19:8913148-8913170 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1162281955 19:9705885-9705907 TAGTGTTGGGAGACGGAAGCTGG - Intergenic
1162377983 19:10316317-10316339 CAGAGTCAAGGGAGGGAAGCTGG + Exonic
1162439943 19:10686696-10686718 CACGGCTGGGGCAGGAAAGCCGG - Intronic
1162799642 19:13103445-13103467 CAGGGGTGGGGTGGGGAAGTTGG + Intergenic
1162830664 19:13282325-13282347 AAGGGTTGGGGGAGGGAGCTGGG + Intronic
1162879679 19:13648887-13648909 GAGGGAGGGGGGAGGGAAGGAGG + Intergenic
1162930265 19:13953988-13954010 CAGCCTTCAGGGAGGGAAGCAGG + Intronic
1162967748 19:14164086-14164108 CTGGGTGGGGGGTGGGGAGCAGG - Intronic
1163118220 19:15200666-15200688 CAGGGTCGGGGAAGGGGCGCAGG - Intronic
1163206073 19:15803512-15803534 AAGGGAAGGGGGAGGGAAGGGGG + Intergenic
1163228262 19:15980019-15980041 CAGGGATGGGGCCGGGATGCGGG - Intergenic
1163458708 19:17423879-17423901 CAGAGTTGGGAGAGGGAAGTAGG - Intronic
1163530756 19:17847661-17847683 CGGGGTTGGGGGTGGGGAGGAGG - Intronic
1163677807 19:18664061-18664083 AAGGGCTGGGGGAGGGGAGGGGG - Intronic
1163718759 19:18887910-18887932 CAGGGCTGGGGGAGGGGAATGGG - Intronic
1163737136 19:18988359-18988381 CAGGGTTTGGGGGGTGAAGCTGG + Intergenic
1163752167 19:19084375-19084397 GCGGGTTTGGGGAGGGAAGGTGG - Intronic
1163934467 19:20429778-20429800 TAGTGTTGGGAGATGGAAGCTGG + Intergenic
1164121507 19:22269504-22269526 TAGTGTTGGGAGATGGAAGCTGG + Intergenic
1164145590 19:22510683-22510705 CATGGTTGGGGATGGGAAGGTGG - Intronic
1164345513 19:27251024-27251046 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1164667915 19:30053631-30053653 GAGGATGGGGAGAGGGAAGCAGG + Intergenic
1164722748 19:30444321-30444343 CAGGCTTGGGCGAGGGCACCGGG - Exonic
1164794385 19:31014507-31014529 AAGGGTCGGGGGAGGGAAGAAGG + Intergenic
1165020887 19:32923022-32923044 CAGGGCAGGCGGATGGAAGCTGG + Intronic
1165261250 19:34620516-34620538 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1165590348 19:36963981-36964003 AAGGGTGGGGGGAGGGACGGAGG + Intronic
1165850210 19:38845783-38845805 CTGGCTTGGGGGAGGGAATAAGG + Intronic
1165880337 19:39038204-39038226 TAGGGGTGTGGGTGGGAAGCTGG + Intergenic
1165906454 19:39197294-39197316 CGGGGTTGGGCGAGCGCAGCAGG - Exonic
1165926020 19:39326734-39326756 GAGGGGAGGGGGAGGGGAGCGGG + Intergenic
1165956164 19:39503331-39503353 GAGGGCTGGGAGAGGGAAGGGGG - Intronic
1165994345 19:39833582-39833604 CTGGGTGGGGGGCGGGACGCCGG - Exonic
1166343626 19:42152405-42152427 GAGGTTTGGGGGAGGGCAGCCGG - Intronic
1166772807 19:45294471-45294493 CAGGGTGAGGGGTGGGAAGTAGG + Intronic
1166785627 19:45365007-45365029 CAGGGCTGAGGGAGGGAGGCAGG - Intronic
1166908483 19:46133034-46133056 GAGGGATGGGGGAGGCAAGGAGG + Intergenic
1166976902 19:46610108-46610130 AAGGGTGGGGAGAGGGAAGATGG + Exonic
1166990536 19:46690078-46690100 CAGGGTTGCAGGAGGGAGGAGGG + Intronic
1167024327 19:46904129-46904151 CTGGGATGGGGGTGGGAAGTGGG + Intergenic
1167134664 19:47609489-47609511 CCGGGTCTGGGCAGGGAAGCCGG - Intronic
1167529172 19:50004281-50004303 CAGGGTGGGGAGAGGGCAGGAGG - Intronic
1167551317 19:50162915-50162937 CGGGGCTGGGCGAGGGATGCCGG - Intronic
1167575280 19:50314869-50314891 CAGGGTCGGGGGAGCGCGGCGGG + Intronic
1167784567 19:51626645-51626667 TAGGGCTGGGGGAAAGAAGCAGG + Intronic
1168069926 19:53943480-53943502 CGGGGTGGGGGGAGGGGGGCAGG + Exonic
1168100861 19:54140237-54140259 CGGGGTGGGGGGAGGTGAGCAGG - Intronic
1168130687 19:54316692-54316714 GAGGGCTGGGGGACGGCAGCAGG + Intergenic
1202658337 1_KI270708v1_random:45233-45255 AGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1202713277 1_KI270714v1_random:28745-28767 CGGGGGTGGCGGGGGGAAGCTGG + Intergenic
925188835 2:1867051-1867073 GAGGGTTGGGGGAGAGAGGGAGG + Intronic
925216958 2:2104789-2104811 CATGGTTGGGGGAGGGCAGGAGG + Intronic
925224102 2:2167602-2167624 GAGGTTTGGGAGCGGGAAGCGGG - Intronic
925337413 2:3108343-3108365 CAGGGGCGGGTGAGGGATGCTGG - Intergenic
926137453 2:10346844-10346866 GAGGGTGGGGGGAGGGAGCCAGG - Intronic
926224887 2:10960776-10960798 CAGGGCTGGGTGAGGGGAGGTGG + Intergenic
926348835 2:11976637-11976659 CTGGGTTGGGGGTGGGGCGCTGG + Intergenic
926395141 2:12433728-12433750 CATGGTTGACGGAGGGAAGGAGG - Intergenic
926395287 2:12435025-12435047 CACTGATGGGAGAGGGAAGCAGG - Intergenic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
926697724 2:15782454-15782476 CAGGGGTGGGAGAGGGAGGATGG - Intergenic
926742802 2:16126193-16126215 CTGGGTTGGGTGTGGGAAGCAGG + Intergenic
926754321 2:16223392-16223414 TGGTGTTGGGGGAGGGAGGCTGG - Intergenic
927182096 2:20453971-20453993 GGGGGTCGGGGGAGGGAAGGAGG - Intergenic
927258242 2:21059682-21059704 GAGGGTTGGGGCAGGCAAGATGG - Intergenic
927506916 2:23620756-23620778 CAGAGGTGGGAGAGGGAGGCAGG + Intronic
927557890 2:24049029-24049051 CAGAGCTGGGGGAGGGAGGGAGG - Intronic
927631915 2:24781678-24781700 CAGAGATGGGGAAGAGAAGCAGG + Intergenic
927720036 2:25376661-25376683 CAGAGGTGGGTGAGGGATGCTGG + Intergenic
927920831 2:26970860-26970882 CCGGGCTGGGGGAGGGGAACCGG + Intronic
928069709 2:28202374-28202396 CAGGGGCATGGGAGGGAAGCAGG - Intronic
928145480 2:28771035-28771057 AAGGGTGGGGGGGGGGGAGCAGG - Intronic
928199764 2:29240097-29240119 CAGGGAGGAGGGAGGGAAGAAGG + Intronic
928535190 2:32233119-32233141 GAGGGGTGGGGGAGGGAGGAAGG + Intronic
928649945 2:33393432-33393454 CGGGGTTGGGGGAGGGGGGAGGG - Intronic
929122449 2:38494600-38494622 CAGGGTTGGCGTTGGGCAGCAGG + Intergenic
929562210 2:42963014-42963036 CAGGGAGGGAGGAGGGAAGAGGG - Intergenic
929601832 2:43209436-43209458 GAAGGTGGGGGGCGGGAAGCAGG + Intergenic
929713197 2:44285420-44285442 CAGAGATGTGGGAGGGCAGCCGG + Intronic
929791046 2:45023439-45023461 CAGGGCTGGTGGAGGGATGCTGG - Intergenic
929811028 2:45189552-45189574 CAGCAGTGGGGAAGGGAAGCCGG - Intergenic
930019654 2:46993872-46993894 CTGTGTTGGGGCAGGCAAGCAGG - Intronic
930063631 2:47311044-47311066 CAGGGTTGTGGCAGTGATGCAGG + Intergenic
930245052 2:48975283-48975305 AGGGGGTGGGGGAGGGAAACTGG - Intronic
930380680 2:50623923-50623945 TGGGGTTGGGGGAGGGGAGAGGG - Intronic
930452161 2:51555771-51555793 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
930610885 2:53542100-53542122 CAGGGTTGGGGGAGGTTGGGAGG - Intronic
931178587 2:59877467-59877489 CACTGTTTGGGGAGGGAAGGGGG - Intergenic
931682912 2:64767989-64768011 CAGGGCGGGGAGCGGGAAGCCGG - Intergenic
931704750 2:64938072-64938094 CAGGGCTGGGGCAGGCCAGCTGG + Intergenic
931867066 2:66425029-66425051 CAGGGATGGAGCAGGGAAGGAGG + Intergenic
932129790 2:69177601-69177623 CAGGGATTGGGGAGGGAGGCCGG - Intronic
932770857 2:74500051-74500073 CAGGGGTGGGGTGGGGAAGAGGG - Intronic
933194781 2:79376626-79376648 TGGGGTTGGGGGAGGGGAGAGGG - Intronic
933389364 2:81651395-81651417 TAGTGTTGGGAGATGGAAGCTGG + Intergenic
933669079 2:84989748-84989770 CAGGGGTGGGTGCAGGAAGCAGG + Intronic
934073984 2:88411702-88411724 CGGGTTTGGGCGGGGGAAGCAGG - Intergenic
934090967 2:88550066-88550088 CGGGGCTGGGGCAGGGAATCTGG - Intergenic
934656294 2:96118191-96118213 TAGGGTTGGGGGTGGGAAGGAGG - Intergenic
934708686 2:96501816-96501838 CTGGGCTGGGGGAGGGAGGCTGG + Intronic
934925922 2:98381725-98381747 CTGGGCTGGGGGAAGGAGGCTGG + Intronic
934978666 2:98823051-98823073 CAGGGATGGCGGTGGGAAACGGG + Exonic
935039772 2:99415064-99415086 CGGAGGTGGGGGAGGGAGGCAGG + Intronic
935048476 2:99503016-99503038 CAGGGTTGGGAGACAGAAGCTGG - Intergenic
936099444 2:109562367-109562389 GAGAGTTGGGGGAGGGGGGCAGG - Intronic
936278679 2:111120601-111120623 CCGGGTTGGGGTAGGTGAGCGGG + Intronic
936419538 2:112350082-112350104 CAGTGTTGGGAGACGGAGGCTGG + Intergenic
936493969 2:113001634-113001656 CAGGGTTGGGGCTGGGGAGGTGG - Intergenic
936528700 2:113259897-113259919 CTGCGTTTGGGGAGGGAAACAGG + Intronic
936839121 2:116748637-116748659 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
936931139 2:117790061-117790083 CAGGGATGGGGTAGGGAATGTGG - Intergenic
937126313 2:119476983-119477005 CAGGGGTAGGGGAGGGAAGGTGG + Intronic
937236984 2:120437028-120437050 CAGGGCTGGGGGAAGGCAGCAGG + Intergenic
937306790 2:120876638-120876660 CAGGGTTGGAGGAGGGACACAGG + Intronic
937389055 2:121466962-121466984 CAGGGTTTGGGGTGGGAGGAGGG - Intronic
937777000 2:125789770-125789792 TGGGGTGGGGTGAGGGAAGCTGG - Intergenic
937875590 2:126823160-126823182 CAGGGCTGGAGGTGGGAAGGCGG - Intergenic
937984531 2:127632614-127632636 CAGTGGTGGGGCAGGGGAGCTGG - Intronic
938303097 2:130229822-130229844 CATGGTTGAGAGATGGAAGCAGG + Intergenic
938423914 2:131168312-131168334 AAGGGCGGGGGGAGGGAAGGAGG - Intronic
938453574 2:131444407-131444429 CATGGTTGAGAGATGGAAGCAGG - Intergenic
938549695 2:132368846-132368868 TAGGGTTGGGGGAGGGGGGAGGG - Intergenic
938912621 2:135899133-135899155 AAGTGTTGGGAGAGAGAAGCAGG + Intergenic
939647545 2:144719635-144719657 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
939983229 2:148805673-148805695 GAGGGGTGGGGGAGGGGAGGGGG - Intergenic
940293535 2:152099404-152099426 CAGGACTTGGGGACGGAAGCTGG + Intergenic
940643895 2:156370404-156370426 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
940962391 2:159799882-159799904 CAGGGGTTGGGGTGGGAAGAAGG + Intronic
942076046 2:172358081-172358103 CAGGGTTTGGGGAGGAGAGCGGG + Intergenic
942609534 2:177728370-177728392 CAGGGTTGGGGGCGGGGGGAGGG + Intronic
942778119 2:179609199-179609221 TAGGGTTGGGGAGGGGAAGTGGG - Intronic
943394739 2:187320261-187320283 CAGGGTTTGGGGAAAGAATCTGG - Intergenic
943507908 2:188785133-188785155 GAGGGTTGGGGGTGGGAGGAGGG + Intronic
944148983 2:196537305-196537327 CAGGGTGGGAGGTGGGAAGATGG + Intronic
944197646 2:197072120-197072142 GAGGGTAGGGGGAGGAAAGGAGG + Intronic
944687217 2:202128116-202128138 CAGGGAGGGGGAAGGGAAGGAGG - Intronic
944700487 2:202241419-202241441 CAGTGTTGGGGGAGGGACTTGGG + Intergenic
945001930 2:205360994-205361016 CTGGGTTGGGGCAGTGAAGAAGG - Intronic
945005291 2:205398930-205398952 CAGGGTTGGGGGTATGAAGCCGG + Intronic
945192797 2:207207558-207207580 CAGTGTTGGGGGAGGTAGGTCGG - Intergenic
945604417 2:211910574-211910596 CAGGGTGGAGGGTGGGAAGATGG + Intronic
946205343 2:218102746-218102768 TGGGGTGGGGGGAGGGAAGAGGG - Intergenic
946239410 2:218344768-218344790 CAGGTTTGGTGGAGAGAAGCTGG - Intronic
946371740 2:219285431-219285453 CAGGGTTGGGGGTCTGCAGCTGG - Exonic
946396341 2:219445490-219445512 CCGGGTCGGGGGAGGGATCCTGG - Intronic
946396848 2:219447695-219447717 CAGGGCTGGGGGGAGGAGGCTGG + Intronic
946490747 2:220146728-220146750 CATGGCTGGGGGAGGTGAGCAGG - Intergenic
946588250 2:221215083-221215105 TAGGGTTGGGGGAAGGGAGAAGG - Intergenic
946605429 2:221399351-221399373 CAGGGTTGTAGGAGGGACTCTGG - Intergenic
946640822 2:221781962-221781984 CAGGGTTGGGGGTGGGGGGGGGG + Intergenic
946747438 2:222860758-222860780 CGCGGGTGGGGGAGGGGAGCGGG - Intergenic
946785721 2:223241672-223241694 GATGGTTGGGGGTGGGAAGAGGG - Intergenic
946803038 2:223441708-223441730 CAGAGTTGGGAGAGGGAATGGGG + Intergenic
947279961 2:228440665-228440687 TGGGGTTGGGGGAGGGTAGAGGG - Intergenic
947556491 2:231098047-231098069 TAGTGTTGGGAGACGGAAGCTGG + Intronic
947675371 2:231974240-231974262 AAGGGACAGGGGAGGGAAGCTGG + Intronic
947835250 2:233170410-233170432 CGGGGCTGGGGGCGGGCAGCTGG - Intronic
948190542 2:236054883-236054905 TGGGGCTGGGGGAGGGCAGCCGG - Intronic
948230942 2:236348990-236349012 CAGGATGGAGGGAGGGAAGGTGG - Intronic
948236560 2:236395124-236395146 CAGCGCTGGGGGTGGGAAGGGGG + Intronic
948368340 2:237472960-237472982 CAGGTGTGGGGGAGGGGACCTGG - Intergenic
948382919 2:237563666-237563688 CTGGCTTGGGGGAGGGCACCTGG + Intergenic
948552857 2:238786264-238786286 CAGGGCTGGGGGAGGAAACAGGG - Intergenic
948635077 2:239329541-239329563 TCCGGCTGGGGGAGGGAAGCTGG + Intronic
948635134 2:239329920-239329942 TCCGGCTGGGGGAGGGAAGCTGG - Intronic
948664148 2:239524030-239524052 CAGGGCTGGGGGTGGGCAGGGGG - Intergenic
948756493 2:240162577-240162599 CAGGGCGGGTGGAGGGAGGCGGG + Intergenic
948803126 2:240441778-240441800 GAGGCTTGGGCCAGGGAAGCGGG + Intronic
948898955 2:240946412-240946434 TTGGGTTGGGGGAGGGCATCTGG + Intronic
948995453 2:241576083-241576105 CAGGGGAGGGGGAGGAGAGCTGG - Intergenic
949036453 2:241817715-241817737 CAGGGTGGGGTCAGGGGAGCAGG - Intergenic
1168824301 20:799045-799067 TAGTGTTGGGAGATGGAAGCTGG - Intergenic
1168887135 20:1267361-1267383 CAGGGTTGGGGAAGGGAATATGG - Intronic
1168890660 20:1293767-1293789 CTGGCCTGGGGGAGGGAAGGGGG - Intronic
1169080671 20:2796273-2796295 CAGGGTTCATGGAGGGCAGCAGG + Exonic
1170177673 20:13490665-13490687 GAGGGGTGAGGGAGGGAAGGAGG - Intronic
1170303621 20:14913749-14913771 TAGGGTCGGGGTAGGGCAGCTGG - Intronic
1170698729 20:18684198-18684220 CAGGGGTGGGGTGGGGAGGCAGG - Intronic
1171021138 20:21585054-21585076 CAGGTTTGGGTGAGGAAAGGGGG - Intergenic
1171170548 20:23011696-23011718 CTGGGTTGTGGGAGGGAGGTGGG + Intergenic
1171412619 20:24957100-24957122 TAGGGTGGGGGCAGGTAAGCAGG + Intronic
1172178682 20:32987589-32987611 CAGGGTTTGGGGACAGGAGCTGG - Intronic
1172386992 20:34541029-34541051 CAGGGCTGGAGGAGGCAACCGGG - Intergenic
1172632290 20:36386475-36386497 GAGGGATGGGGGAGGGAGGGAGG + Intronic
1172658381 20:36550241-36550263 CAGGGTTGGAGGTGGGAATGAGG + Exonic
1173040359 20:39456332-39456354 CGGGGTTGGGGAGGGGAAGCAGG - Intergenic
1173226272 20:41164019-41164041 CAGGGCTGGGGGAGGGAAGATGG + Intronic
1173602755 20:44307730-44307752 CAGGGGTGGGGTAGGGGAGGAGG - Intronic
1173629207 20:44497739-44497761 GAGGTGTGGGGTAGGGAAGCAGG - Exonic
1173810294 20:45951263-45951285 CAGAGGTTGGAGAGGGAAGCAGG - Intronic
1173874914 20:46364297-46364319 CGGGGCTGGAGAAGGGAAGCGGG - Intronic
1174130536 20:48340828-48340850 CTGGGCTGCGGGAGGCAAGCTGG - Intergenic
1174376012 20:50127202-50127224 CAGGGGTGGGAGAAGGAAGTGGG - Intronic
1174411153 20:50337268-50337290 CAGGGTTGGGGGTGGGAGATGGG + Intergenic
1174418724 20:50385409-50385431 GAGGGTGGGGGGAGGGGGGCGGG - Intergenic
1174468826 20:50739867-50739889 AAGGGTGGGGGGAGGGGAGAAGG + Intronic
1174556396 20:51398430-51398452 CAGGGTTGGGCGGGAGAAGGGGG - Intronic
1174863731 20:54115677-54115699 CAGGATTTGGTCAGGGAAGCAGG - Intergenic
1175048457 20:56129559-56129581 CAGGGTTAGGGGAAGAAAGCAGG + Intergenic
1175084216 20:56445335-56445357 CTGGGCTGAGGCAGGGAAGCAGG - Intronic
1175239565 20:57536997-57537019 CTGGGTGGGGTGAGGGAAGAGGG - Intergenic
1175386376 20:58597975-58597997 AGGGGATCGGGGAGGGAAGCAGG + Intergenic
1175441451 20:58995242-58995264 CAAGGGTGGGGGAGGGAGGGAGG - Exonic
1175550391 20:59813725-59813747 CAGGGCTGGGTGAGGGTGGCAGG + Intronic
1175681812 20:60994783-60994805 GTGGGATGGGGGAGGGAGGCAGG - Intergenic
1175802688 20:61810173-61810195 CAGAGATGGGTGAGGGAGGCCGG + Intronic
1175828720 20:61950851-61950873 CAGGGCTGGGGAAGGGGAGAGGG - Intergenic
1175828792 20:61951022-61951044 CAGGGCTGGGGAAGGGGAGAGGG - Intergenic
1175828828 20:61951115-61951137 CAGGGCTGGGGGAGGGGAGAGGG - Intergenic
1175828847 20:61951150-61951172 CAGGGCTGGGGGAGGGGAGAGGG - Intergenic
1175830595 20:61963317-61963339 CGGGATTGAGAGAGGGAAGCAGG - Intronic
1175901303 20:62360928-62360950 CCTGGGTGGGGCAGGGAAGCCGG - Intronic
1175901327 20:62361011-62361033 CTGGGCTGGGGGAGGGGAGATGG - Intronic
1175958562 20:62623599-62623621 AGGGGCTGGGGGAGGGGAGCTGG + Intergenic
1176062873 20:63179898-63179920 CTGGGGTGGGGGTGGGAAGATGG - Intergenic
1176089780 20:63313652-63313674 CAGGGTAGGGGCTGGGCAGCTGG + Intronic
1176135935 20:63521976-63521998 CAGGGTGGGGGGTGGGAGGTGGG - Exonic
1176136181 20:63522981-63523003 CAGTGGTGGGGGAGGGACTCTGG + Intergenic
1176301582 21:5101409-5101431 CAGGGATGGGGCAGGGACGCAGG + Intergenic
1176390599 21:6161151-6161173 AAGGGTGGGGGGAGGAAAGCTGG + Intergenic
1177764870 21:25446027-25446049 CAGGGTAGAGGGTGGGAAGAAGG + Intergenic
1178358893 21:31931875-31931897 CAGGGTTGTGGGATGGGAGAAGG - Intronic
1178793669 21:35723466-35723488 AGGGGTTGGGGGGGGGAAGAAGG - Intronic
1178837165 21:36108413-36108435 TAGTGTTGGGAGATGGAAGCTGG - Intergenic
1179054192 21:37916250-37916272 CAGGGACGGGGGAGGGAGACTGG + Exonic
1179175609 21:39005745-39005767 GAGGGATGGGGGCAGGAAGCGGG - Intergenic
1179374822 21:40841235-40841257 CAAGGTGGCAGGAGGGAAGCAGG - Intronic
1179447835 21:41445647-41445669 CAGCCTTGGGGGAGTGAAGAAGG - Intronic
1179506854 21:41846888-41846910 AGGGGTCGGGGGTGGGAAGCGGG + Intronic
1179540757 21:42082116-42082138 CAGGGCTGGGTGAGGAGAGCGGG + Intronic
1179674957 21:42974847-42974869 CGCGGGTGGGGGAGGGGAGCGGG + Intronic
1179731888 21:43372693-43372715 CGGGGTCTGGGGAGGGAACCAGG + Intergenic
1179732868 21:43377088-43377110 AAGGGTGGGGGGAGGAAAGCTGG - Intergenic
1179855449 21:44160490-44160512 CAGGGATGGGGCAGGGACGCAGG - Intergenic
1179912743 21:44459082-44459104 CAGCGTGGCGTGAGGGAAGCAGG - Exonic
1179960984 21:44766855-44766877 CGGGGTTTGGGGGAGGAAGCTGG + Intergenic
1180054340 21:45349339-45349361 TAGGGCTGGGGGAGGGGACCTGG + Intergenic
1180162748 21:46005653-46005675 CTGGGCTGGAGGAGGGCAGCAGG + Intergenic
1180202411 21:46232559-46232581 CAGGGGTTGGGGAGGGAATGGGG + Intergenic
1180755307 22:18156948-18156970 CTGGGTTGGGGGAGGGTACACGG + Intronic
1181034087 22:20161616-20161638 GGGGGCTGGGGGAGGGAAGGGGG + Intergenic
1181237351 22:21455704-21455726 CAGGGTTGGGAAAGGCAGGCAGG + Intergenic
1181318190 22:21984822-21984844 CAGGGTGGTGGCAGGGAGGCAGG - Intergenic
1181527871 22:23500465-23500487 CTGGGTGGGGAGAGGGAAGTGGG + Intergenic
1181528299 22:23502340-23502362 GAGGGATGGGGGATGGAAGGAGG - Intergenic
1181532340 22:23523950-23523972 TAGGGTTGGGGGTGGGATGGGGG - Intergenic
1181534159 22:23533134-23533156 AGGGGATGGGGGAGAGAAGCTGG + Intergenic
1181871828 22:25905495-25905517 CAGGGTTGGGGGAGAGATCGGGG + Intronic
1182089417 22:27583939-27583961 CAGGGTTGCTGGAGCGACGCTGG - Intergenic
1182169753 22:28215132-28215154 TGGGGTTGGGGGAGGGGAGAGGG + Intronic
1182250656 22:28997398-28997420 CAGGGTTGGGGGGTGGGAGTGGG + Intronic
1182254802 22:29030733-29030755 CAGGGCTGGTGGAGGGGAGGAGG + Intronic
1182421497 22:30250752-30250774 CGGGGTTGGGGGGGGGATGCGGG + Intergenic
1182477306 22:30583179-30583201 GAGGGCTGGGGAAGGGAAGAAGG + Intronic
1182504736 22:30773607-30773629 GAGGAATGGGGGAGGGAAGGAGG + Intronic
1182592678 22:31394192-31394214 CTGGCTTGGGGGAGGGAGGGGGG - Intergenic
1182742284 22:32576799-32576821 GAGGGGTGGGGGTTGGAAGCGGG - Intronic
1182885641 22:33771768-33771790 CAGGTTTGGAGGAGGAAATCAGG - Intronic
1183105149 22:35610219-35610241 CAGGGTTGGGGGCAGGAGCCTGG - Intronic
1183123473 22:35751398-35751420 GAGGGTTGGGGGATGGCGGCAGG + Intronic
1183262729 22:36806310-36806332 TAGGGATGGGGGTGGGAAGGAGG + Intronic
1183341128 22:37282438-37282460 CAGGGCTGGGCGGGGCAAGCAGG + Exonic
1183360163 22:37379232-37379254 CTGGGCTGCGGGAGGGAAGCAGG - Intronic
1183361302 22:37384668-37384690 AGGGGTTGGGAGTGGGAAGCGGG - Intronic
1183361318 22:37384709-37384731 AGGGGTTGGGAGTGGGAAGCGGG - Intronic
1183483659 22:38078064-38078086 CAGGGTGGTGGGAGGGAGTCTGG - Intergenic
1183498076 22:38161797-38161819 CAGGCTGAGGGGAGGGAAGGAGG + Intronic
1183818579 22:40325031-40325053 TAGGGTGGGGGGATGGATGCCGG + Exonic
1183854700 22:40623462-40623484 CGGGGTTGGGGGAGGGGGGAGGG - Intronic
1183958942 22:41399348-41399370 CAGGGTTGGGGGTGGGGAGAAGG - Intergenic
1184193256 22:42908992-42909014 CAGGGTTGGGGGAATGCAGGAGG + Intronic
1184271986 22:43389547-43389569 TAGGGTTGGAGGAGGGAATCTGG + Intergenic
1184301241 22:43562500-43562522 CTGGGTTGGGGGTGGGAGGGAGG + Intronic
1184629810 22:45767694-45767716 GAGGGTTGGAGGAAGGAAGAAGG + Intronic
1184642373 22:45879438-45879460 GAGGGAAGGGGGAGGGAAGGAGG - Intergenic
1184642397 22:45879488-45879510 TAGGGAGGAGGGAGGGAAGCAGG - Intergenic
1185050883 22:48553418-48553440 TAGGATGGAGGGAGGGAAGCAGG + Intronic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
1185324351 22:50218398-50218420 CAGGGCTGGCGGAGGGCAGAAGG + Exonic
1185412888 22:50695183-50695205 CCTGGTTGGGGAAGGGAAGAAGG + Intergenic
949413942 3:3797218-3797240 CAGGGATGGGGGAAGGAATTTGG - Intronic
949529231 3:4937536-4937558 CAGGGAAGGGGAAGGGAAGTAGG - Intergenic
949610887 3:5702400-5702422 TAGTGTTGGGAGATGGAAGCTGG + Intergenic
949710112 3:6862325-6862347 CTGGCTTGGGGGTGGGAAGCTGG - Intronic
949889571 3:8723788-8723810 TAGGGTTGGGGAAAAGAAGCAGG - Intronic
950221294 3:11198293-11198315 GGGGGATGGGGGATGGAAGCTGG - Intronic
950459938 3:13115253-13115275 GAGGAACGGGGGAGGGAAGCGGG - Intergenic
950478958 3:13232964-13232986 CGGGGCTGGGGGAGGGAGGATGG + Intergenic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
950634779 3:14307226-14307248 CAGGGCTGGGGTGGGGATGCAGG + Intergenic
950841765 3:15974788-15974810 CGGGGCTGGAGGGGGGAAGCAGG - Intergenic
950846035 3:16017052-16017074 TAGTGTTGGGAGACGGAAGCTGG + Intergenic
951177334 3:19617310-19617332 CAGGCTTGGGGGAGGGTAGCGGG - Intergenic
951857612 3:27215055-27215077 CAGGGGTTGGAGCGGGAAGCCGG - Intronic
952518362 3:34128842-34128864 GAGGGTTGGGGGTGGGACCCTGG + Intergenic
952735787 3:36690356-36690378 GAGGTTTGGGGGACGGAAGCGGG + Intergenic
952858778 3:37795002-37795024 CAGGTGTGGGGGAGGGAGGAGGG - Intronic
952903959 3:38127634-38127656 CCAGGTTGGGGGTGGGAAGTAGG - Intronic
953023265 3:39129526-39129548 CAGGTGAGGGGGAGGCAAGCAGG - Intronic
953029856 3:39172089-39172111 CTGGGTTGGGGCAGGGATGGAGG + Intergenic
953369034 3:42371736-42371758 GAGGTTTGGTGTAGGGAAGCAGG + Intergenic
953406907 3:42664212-42664234 GGGGGTTGGGGGTGGGCAGCAGG - Intronic
953417100 3:42728917-42728939 TAGGATTGGGTGAGGCAAGCAGG - Intronic
953473347 3:43185036-43185058 CAGGGATGGAACAGGGAAGCGGG + Intergenic
953609094 3:44432774-44432796 CAGGGATGTAAGAGGGAAGCTGG - Intergenic
954217245 3:49131498-49131520 CTGGGCTGGGGGCTGGAAGCTGG - Intronic
954333251 3:49901942-49901964 CGGGGGTGGGGGAGGGGAGGGGG + Intronic
954381265 3:50220541-50220563 CAGGGTCGGGGGATGGCTGCAGG - Exonic
954613609 3:51958706-51958728 CAGGGGTGGGGAGAGGAAGCTGG - Intronic
954615259 3:51966254-51966276 CAGGGTGGGGGGCTGGGAGCAGG - Intronic
954629531 3:52040510-52040532 CAGGGTTGGGGGGTGGGAGTGGG - Intergenic
954630987 3:52047501-52047523 CAGGCCTGGGCGAGGGCAGCAGG + Intergenic
954666550 3:52256766-52256788 GAGGGTAGCGGGAGGGTAGCAGG - Exonic
955353779 3:58213728-58213750 CAGGGTGCAGGGAGGGATGCAGG + Intronic
955650678 3:61190931-61190953 TGGGGTGGGGGGAGGGAAGAGGG + Intronic
955675535 3:61444356-61444378 CAGGGTGGAGGGAGGGAGGGAGG - Intergenic
955747294 3:62152836-62152858 AAGTGTTGGGGGTGGGAAGTGGG - Intronic
955769113 3:62371986-62372008 CAGGGTTCGGCGAGGGGGGCCGG - Intronic
955932903 3:64075831-64075853 AAGGGTAGGGGGAGGGAGGTGGG - Intergenic
956071265 3:65454381-65454403 TGGGGTTGGGGGAGGGGAGAGGG + Intronic
956096520 3:65722038-65722060 TAGGATTGGAGGAGGGAAGGAGG - Intronic
956438646 3:69258977-69258999 CAGGGTTGGGGGATGGTTTCGGG + Intronic
956513672 3:70022273-70022295 CCGGGTGGGGGGAGGGAGGAGGG + Intergenic
956826045 3:72997282-72997304 CTGGGCTGGGGGAGGGGAGCCGG + Intronic
957194052 3:77045042-77045064 CAATGTTGGGGGAGGGAGGCGGG + Intronic
958427357 3:93994386-93994408 CAAGGTTGGGGGTGGGAGGTGGG - Intronic
958607357 3:96376155-96376177 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
958798804 3:98733113-98733135 CAGGGTTGGGGGTGGGGACACGG + Intronic
959095523 3:101951359-101951381 CAGGGCAGGGGTAGGGGAGCGGG + Intergenic
959095540 3:101951401-101951423 CAGGGGTAGGGGAGTGGAGCAGG + Intergenic
959401621 3:105909297-105909319 CAGGGTTTGGGGAGGGAGGTGGG - Intergenic
959418769 3:106108896-106108918 GGGGGTTGGGGGAGAGATGCAGG - Intergenic
959582013 3:107992046-107992068 CAGACTTTGGGGAGTGAAGCTGG + Intergenic
959609013 3:108273626-108273648 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
959976993 3:112472124-112472146 CAAGGTAGGGGGAGGGAGGCTGG + Intronic
960338356 3:116445594-116445616 CAGGGTGGGGGGAGGGTGGGGGG - Intronic
960343608 3:116505557-116505579 CAGGGTAGGGGGAGGGGGGACGG - Intronic
960720253 3:120618477-120618499 TAGTGTTGGGAGATGGAAGCTGG + Intergenic
960930436 3:122843039-122843061 CTGGGTTGGGGGAGGGAAATGGG - Intronic
961105212 3:124234967-124234989 CAGGGGAGCGGGAGGGGAGCTGG + Intronic
961470811 3:127110380-127110402 CAGAGATGGGTGAGGGAAGAAGG + Intergenic
961492147 3:127263620-127263642 CTGGGTGGGGGGTGGGCAGCTGG - Intergenic
961622721 3:128237598-128237620 CAGAGCTGGGAGAGGGGAGCAGG - Intronic
962096686 3:132299718-132299740 TAGTGTTGGGAGACGGAAGCTGG + Intergenic
962374781 3:134850773-134850795 CAGGGTATGGAGAGTGAAGCGGG - Intronic
962950731 3:140216208-140216230 CATGGATGGGGGTGGGAGGCGGG - Intronic
963025338 3:140913570-140913592 CAGGGTTGGGGGTTGGAGGTGGG - Intergenic
963193688 3:142502463-142502485 AAGGGGTGGGGGAGGGAGGGAGG + Intronic
963605041 3:147406195-147406217 CACGGTTGGGGGAGGGGGGTAGG + Intronic
963790506 3:149577998-149578020 GAGGGTGGGGGGAGGGAAGGAGG - Intronic
964584531 3:158282081-158282103 CAGGGCTGGGGGTGGGGAGGTGG - Intronic
964868446 3:161287548-161287570 GAGGGTGGAGGGTGGGAAGCAGG + Intergenic
964932962 3:162048171-162048193 TAGTGTTGGGAGAGGGAAGCTGG + Intergenic
965528595 3:169747818-169747840 TAGGGGTGGTGGAGGGAAGGGGG - Intergenic
965952134 3:174322365-174322387 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
966098633 3:176239062-176239084 CAGGGTGGGGGGAGGGGGGAGGG - Intergenic
966661564 3:182420213-182420235 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
966736016 3:183187860-183187882 CTGGGTAGGGGAAGGGAAGAAGG - Intronic
966767992 3:183479417-183479439 AAGGGTGGAGGGAGGGCAGCGGG - Intergenic
967228028 3:187311986-187312008 CAGGGGTGGGGGTGGGGAGGGGG + Intergenic
967459776 3:189732252-189732274 CAGGGGTGGTGGAGGGGAGTTGG - Intronic
967793725 3:193575971-193575993 CTGGGATGGGGCAGGGAAGAAGG + Intronic
967824831 3:193869752-193869774 CAGGGCTGGGGGCGGGAGCCGGG - Intergenic
967837345 3:193975475-193975497 GAGGGGTGGGGGAAGGGAGCAGG + Intergenic
968086941 3:195878045-195878067 AAAGGGTGGTGGAGGGAAGCTGG + Intronic
968266967 3:197369894-197369916 AAGGGGAGGGGAAGGGAAGCGGG - Intergenic
968299852 3:197604150-197604172 CAGGGCTGGGGAAGGCAAGCTGG - Intergenic
968337841 3:197928972-197928994 CAGGGCTGGGGAAGGGAATCAGG - Intronic
968478210 4:822543-822565 CAGGGTCGGGGAGGGGGAGCTGG - Intronic
968518771 4:1026400-1026422 CAGAGTTGGGGGAGTGACGGTGG - Exonic
968632905 4:1661400-1661422 CAGGGAGGCGGGTGGGAAGCAGG - Intronic
968657126 4:1783483-1783505 CAGGGATGGGGGCGGGATGGGGG + Intergenic
968697823 4:2041460-2041482 CTGGGTTGGGGGTGGGTAGCCGG + Intronic
968710558 4:2113236-2113258 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
968727034 4:2252552-2252574 CTGGGGTGGGGGAGGGCAGCAGG + Intronic
969056748 4:4407206-4407228 CGGGGTTGGGGGAGTGGAGGCGG + Intronic
969283897 4:6190600-6190622 TGGGGTTGGGGGTGGGAGGCGGG - Intronic
969376727 4:6768130-6768152 CAGGGTGGGGGGAGGGGAGCTGG - Intergenic
969421186 4:7097102-7097124 CGGGGCTGGGGGAGGGCAGCTGG + Intergenic
969519289 4:7666450-7666472 CAGGGTGGGAGGAGGGAGGAAGG - Intronic
969586392 4:8096709-8096731 CAGGGGCTGGGGAGGGAAGGGGG + Intronic
969674186 4:8606137-8606159 CAGGGTTCATGGAGGGCAGCAGG - Exonic
970075230 4:12210810-12210832 CAGAGTCGGGGCAGGGGAGCTGG + Intergenic
970093833 4:12439658-12439680 CACCGTTGGGAAAGGGAAGCTGG + Intergenic
970166365 4:13242487-13242509 GAGGGGTGTGGGAGTGAAGCAGG - Intergenic
970510599 4:16777968-16777990 GAGGGATGGGGGAGGAAGGCAGG - Intronic
970553666 4:17209751-17209773 AAGGGTTGGGGGTGGGAGGAGGG + Intergenic
970954465 4:21794123-21794145 CGGGGTAGGGGGAGGGGAGAGGG + Intronic
971027360 4:22601746-22601768 TAGTGTTGGGAGACGGAAGCTGG - Intergenic
971795141 4:31217485-31217507 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
971904644 4:32710687-32710709 GGGGGTTGGGGGAGGGAGGAGGG + Intergenic
972111203 4:35561646-35561668 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
972111311 4:35562688-35562710 AAAGGCTGGGGGAGGGAAGAGGG + Intergenic
972127733 4:35790172-35790194 GAGGGAAGGGGGAGGGAAGGGGG + Intergenic
972630227 4:40835962-40835984 CTGGAGTGGGGGAGGGAAGGAGG + Intronic
972651811 4:41025139-41025161 TAGGGTTGTGGGAGTGAAGGAGG - Intronic
972670616 4:41211386-41211408 CGGGGGCGGGGGAGGGGAGCAGG - Intronic
972785088 4:42319126-42319148 TAGTGTTGGGAGATGGAAGCTGG - Intergenic
973279788 4:48347318-48347340 CAGGGGTGGGGGAGGGGGGGTGG - Intronic
973772254 4:54217716-54217738 CAGTGCTGGGGGAGGGGAGGAGG - Intronic
973913947 4:55613839-55613861 CAGGGGTGGTGGAGGCAACCGGG - Intronic
974111563 4:57531996-57532018 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
974219630 4:58949624-58949646 GAGGGTAGGGAAAGGGAAGCAGG - Intergenic
974433328 4:61826767-61826789 CAGGGTTGGGGGAGAGGGGAGGG + Intronic
974988022 4:69053648-69053670 TAGTGTTGGGAGATGGAAGCTGG - Intronic
975160738 4:71121206-71121228 AGGGGAGGGGGGAGGGAAGCGGG - Intergenic
975911827 4:79276463-79276485 TAGTGTTGGGAGATGGAAGCTGG - Intronic
976990278 4:91356789-91356811 TAGTGTTGGGAGACGGAAGCTGG + Intronic
977027293 4:91834991-91835013 CAGTGATGGGAGAGGTAAGCTGG + Intergenic
977158771 4:93608452-93608474 TGGGGTTGGGGGAGGGAGGAGGG - Intronic
977191358 4:94004669-94004691 TAGGGTTGGGGGAGGGGGGAGGG + Intergenic
977558985 4:98513333-98513355 CAGGGGTGGGGTAGGCAGGCAGG + Intronic
979666081 4:123312279-123312301 GAGGGGTGGGGGAGGTATGCAGG + Intronic
980015296 4:127643422-127643444 GAGGGTTGGGGCTGGGGAGCAGG - Intronic
980016662 4:127657900-127657922 CAGGGTTGGGGGACGGTTTCAGG - Intronic
980073059 4:128264005-128264027 TAGTGTTGGGAGATGGAAGCTGG - Intergenic
980288516 4:130813176-130813198 CGGGGTTGAGGGAGGGAGGAGGG - Intergenic
980859137 4:138479038-138479060 TGGGGTTGGGGGAGGGGAGAAGG - Intergenic
981003679 4:139853434-139853456 TTTGGTTGGGGGAGGGAAGCAGG + Intronic
981391871 4:144200308-144200330 CAGGGTTGGGGGCAGGGAGAGGG + Intergenic
981907917 4:149944051-149944073 TGGGGTTGGGGGAGGGGGGCGGG - Intergenic
982662707 4:158225838-158225860 TAGTGTTGGGAGATGGAAGCTGG + Intronic
982664916 4:158250508-158250530 CAGGGTTGGGGCAGGATAGACGG - Intronic
982721379 4:158863490-158863512 CAGGGAAGAGGGAGGGAAGCCGG + Intronic
982750706 4:159157903-159157925 GAAGGTTGAGGTAGGGAAGCTGG + Intronic
982994075 4:162318026-162318048 CAGGGGTGGAGCAAGGAAGCCGG - Intergenic
983349020 4:166563013-166563035 CAGGGTCGGGGGAGGCCAACTGG + Intergenic
983506493 4:168558545-168558567 CAGAGTTCGGAGAGGGAAGAAGG - Intronic
983708494 4:170687178-170687200 TAGTGTTGGGAGACGGAAGCTGG - Intergenic
983824080 4:172235785-172235807 CAGGGCAGGGGGAGTGAAGTGGG - Intronic
983833932 4:172366689-172366711 CAAGGTTAGGGGAGGGGAGGAGG - Intronic
984820752 4:183879772-183879794 GAGGCTTGGGGGATGGGAGCAGG + Intronic
984824278 4:183910499-183910521 CAGGGCTGGGGGAGGGGAGAGGG - Intronic
985114882 4:186580963-186580985 GAGGGTTGGGGGAGGACAGTTGG - Intergenic
985784831 5:1887996-1888018 CAGGGTTAGGGGAGGGCATGGGG + Intergenic
985936469 5:3101502-3101524 CTGGGTTGGGAGAGGGGAGCAGG - Intergenic
986859094 5:11904777-11904799 GTGGGTTGGGGGAGGGAGGCTGG + Intergenic
987130385 5:14854799-14854821 CAGGGTTGGGGTGGGAAGGCAGG - Intronic
987160301 5:15134631-15134653 GAGGGTTGGGGGAGTGAGGCAGG - Intergenic
987283456 5:16434699-16434721 CTGGGAGGGGTGAGGGAAGCAGG + Intergenic
987287860 5:16476754-16476776 TAGGGTTGGGGGTGGGAGGAGGG + Intronic
987930481 5:24394476-24394498 TAGTGTTGGGAGATGGAAGCTGG + Intergenic
987955250 5:24730218-24730240 AAGGGCGGGGGGAGGGAATCTGG + Intergenic
988832652 5:35002920-35002942 CAGGGATGGAGCAGGGAAACTGG + Intronic
989095987 5:37781730-37781752 TAGTGTTGGGAGACGGAAGCTGG + Intergenic
989125012 5:38044603-38044625 CAGGGCTGGGGGAGGGGGGGTGG - Intergenic
989165794 5:38432485-38432507 AAGGGTGGGGGCAGGGAAGGGGG + Intronic
989557649 5:42816101-42816123 TAGTGTTGGGAGACGGAAGCTGG - Intronic
989700294 5:44255896-44255918 CAGAGTTGAGAGAGTGAAGCAGG + Intergenic
989735397 5:44697288-44697310 CAGAGTGGGGGGAAGTAAGCAGG - Intergenic
989861178 5:46377240-46377262 TGGGGTTGGGGGAGGGGAGAGGG + Intergenic
990622281 5:57573069-57573091 CAGGGCTGGGGGAGTCAAGGAGG - Intergenic
991250114 5:64550721-64550743 CAGGGTTGGGGGAGGGGGGAGGG - Intronic
992273499 5:75090383-75090405 CAGGGTTGGGGCACAGAATCTGG + Intronic
992624565 5:78625493-78625515 CAGGTTTGGGGGTGGGTAGGAGG - Intronic
992989628 5:82270930-82270952 TAGTGTTGGGAGATGGAAGCTGG + Intronic
993177359 5:84503708-84503730 CAGGATTTGGAGAGGGAGGCTGG + Intergenic
993611484 5:90059779-90059801 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
993816088 5:92547148-92547170 TAGGGTTGGGGGAGGGGGGAGGG + Intergenic
993868227 5:93219848-93219870 GAGGGGTGGGGGTGGGGAGCGGG - Intergenic
993999909 5:94766522-94766544 TGGGGTTGGGGGAGGGAGGAGGG + Intronic
994262744 5:97679406-97679428 CGGGGTTGGGGGAGGGGGGAGGG - Intergenic
994535263 5:101022311-101022333 CGGGGTTGGGGGAGGCAGGAGGG + Intergenic
994670763 5:102758824-102758846 CAGGGTAGGGGGAGGGGGGAAGG + Intronic
994858459 5:105156935-105156957 CAGGGAAGGTGGAGGAAAGCAGG - Intergenic
994889131 5:105606392-105606414 CCTGTTTGGGGGTGGGAAGCTGG + Intergenic
994920259 5:106033504-106033526 AAGTGTTGTGGGAGGGAAACAGG - Intergenic
995022380 5:107381051-107381073 CGGGGTGGGGTGAGGGAGGCAGG + Exonic
995279619 5:110318349-110318371 CGGGGTTGGGGGAGGGGGGAGGG + Intronic
995324241 5:110872927-110872949 CAGGGATGGGGAAGGGAGGGTGG - Intergenic
995534778 5:113123963-113123985 TAGGGTTTAGGGAGGCAAGCGGG + Intronic
995628394 5:114104806-114104828 CAGGCTCGGGGGAGGAAAGGAGG + Intergenic
995677317 5:114676738-114676760 CGGGGTTGGGGGAGGGGGGAGGG + Intergenic
995867485 5:116707061-116707083 TAGTGTTGGGAGATGGAAGCTGG - Intergenic
996290143 5:121843077-121843099 CAGGGATGGGGGGGGGATGAAGG + Intergenic
996564310 5:124863551-124863573 AAAGGGGGGGGGAGGGAAGCAGG - Intergenic
996900629 5:128538426-128538448 CAGGGTTGGGTGAGGGGAAGAGG + Intronic
996995855 5:129695989-129696011 TAGGTATGGGGGAGGGAAGAGGG + Intronic
997015413 5:129928187-129928209 CAGGGTGGGGGGTGGGGAGAGGG - Intronic
997049230 5:130358913-130358935 GAGGGTTGGGGGTGGGAGGAAGG + Intergenic
997243389 5:132325054-132325076 TGGGGATGGGGTAGGGAAGCAGG + Intronic
997287232 5:132688922-132688944 AAGGGATGGGGGAGGGGAGCAGG + Intergenic
997290835 5:132733095-132733117 CTGGGTTGGGGGAAGGGAGGTGG + Intronic
997297214 5:132776127-132776149 CAGGGCTGTTGGAGGGAAGGGGG - Intronic
997653034 5:135536127-135536149 CCGGGTTGGGGGAGGGGCGATGG - Intergenic
998059488 5:139108529-139108551 CAGGGCTGTGGGAGGCAGGCTGG + Intronic
998252327 5:140561556-140561578 CAGGGGTGGGGCAGGGAATGTGG - Intronic
998361863 5:141595156-141595178 AAGGGTTGGGGGAGGCAGGTAGG + Intronic
998387507 5:141766242-141766264 CAGGGGTGGGGGTGGGGACCAGG - Intergenic
998406037 5:141875469-141875491 CAGGGTTCGGGGAGGGGTGTAGG - Intronic
998552381 5:143090112-143090134 TAGTGTTGGGAGACGGAAGCTGG + Intronic
999108433 5:149094008-149094030 CAGAGTTGGGCTAGGCAAGCGGG - Intergenic
999248600 5:150168200-150168222 TAGCCTTGGGGGCGGGAAGCTGG + Intronic
999692758 5:154162935-154162957 AAGGCTCAGGGGAGGGAAGCGGG - Intronic
999725705 5:154435644-154435666 CACGGTTGGGGGTGGGGAGGGGG - Intergenic
1000225197 5:159254703-159254725 CAGGCTTGGGGTAGGGATGGGGG - Intergenic
1000503131 5:162077911-162077933 GAGGATTGGGGGAGGAAAGGAGG + Intronic
1000585088 5:163087398-163087420 TGGGGTGGGGGGAGGGAAGAGGG + Intergenic
1000604838 5:163316715-163316737 TAGTGTTGGGAGACGGAAGCTGG + Intergenic
1000760083 5:165212365-165212387 TATGGTTGGGGAAGGGGAGCAGG - Intergenic
1000774789 5:165406309-165406331 GAGGGTGGAGGGAGGGAAGGGGG - Intergenic
1000908493 5:166993021-166993043 CAGGAGTGGGGGAGGGGAGAGGG - Intergenic
1001092395 5:168751042-168751064 GAGGCTAGGGGGAGGGAGGCTGG + Intronic
1001161388 5:169318868-169318890 CAGGGTTGGAGGGAGGAAGCAGG + Intergenic
1001228277 5:169964017-169964039 CAGGATTGGGGGAGGGAGAAGGG + Intronic
1001263793 5:170257061-170257083 CAGGGCTGGGGTGGGGAGGCGGG + Intronic
1001335774 5:170795447-170795469 CAGGGGTGGAGGACGGCAGCTGG + Intronic
1001352405 5:170981456-170981478 ACGTGTTGTGGGAGGGAAGCAGG + Intronic
1001392310 5:171388587-171388609 CGTGGTTGGGGGAGGGAGGGGGG + Intronic
1001422186 5:171596414-171596436 CAGGGATGGGGGAGGCATCCAGG + Intergenic
1001558380 5:172652149-172652171 TAGTGTTGGGAGATGGAAGCTGG + Intronic
1001571218 5:172731939-172731961 CACAGTGGGGGGAGGGTAGCAGG + Intergenic
1001823948 5:174731335-174731357 CTGGGCTGGGGGATGGAAGCCGG + Intergenic
1001898626 5:175403638-175403660 TGGGGTTGGGGGAGGGGAGAGGG + Intergenic
1001934527 5:175694832-175694854 GAGTGTTGGGGGTAGGAAGCAGG + Intergenic
1002300054 5:178252781-178252803 CAGGCTTGGGGGAGGCCAGGAGG + Intronic
1002350328 5:178578650-178578672 CAGGGGTGGGTGGGGGAAGGCGG - Intronic
1002587146 5:180256392-180256414 CAGGGGTGGGGCAGGGGGGCAGG + Intronic
1002693998 5:181071754-181071776 AGGGGTTGGGGGTGGGAAGTAGG - Intergenic
1002858594 6:1059404-1059426 GGGGCTTGGGGGAGGGGAGCGGG + Intergenic
1003058182 6:2841648-2841670 AAGGGATGGGGGCGCGAAGCTGG + Intronic
1003061366 6:2865314-2865336 GAGGGGAGGGGAAGGGAAGCGGG - Intergenic
1003116441 6:3286814-3286836 CTGGGTGCAGGGAGGGAAGCTGG - Intronic
1003323291 6:5071970-5071992 GAAGGTTGGGGGTGGGAAGAGGG - Intergenic
1003510157 6:6772939-6772961 CAGGATCGGGAGAGAGAAGCCGG + Intergenic
1004201860 6:13555930-13555952 CAGAGTGGGGGGAGAGGAGCTGG + Intergenic
1004339777 6:14798193-14798215 AAGGGTTGGGGGAGGGAGGAAGG + Intergenic
1004832096 6:19487729-19487751 TGGGGTTGGGGGAGGGGAGAAGG + Intergenic
1005086356 6:22010992-22011014 CAGAGTTGGGGGAAGTAAGGGGG + Intergenic
1005417705 6:25619338-25619360 AAGGTTTGGGGGAGGGGAGGGGG - Intronic
1005436964 6:25822961-25822983 CAGTGGTGGGGGAGGGCAGGAGG - Intronic
1006032118 6:31184105-31184127 TAGTGTTGGGAGATGGAAGCTGG + Intergenic
1006061686 6:31425358-31425380 TGGGGTTGGGGGAGGGAAGAGGG - Intergenic
1006337890 6:33430366-33430388 AAGGGCTGGGGGAGGAAAGGGGG + Intronic
1006367090 6:33622019-33622041 CTGAGTTGGGGAAGGGCAGCCGG + Intronic
1006401603 6:33821039-33821061 GAGGGAGGGGGCAGGGAAGCAGG + Intergenic
1006407600 6:33854386-33854408 CTGGGTCGGGGGAAGGAAGGAGG - Intergenic
1006507515 6:34498976-34498998 CAGGGTTAGGGGAGGGTTGGGGG + Intronic
1006570700 6:35001565-35001587 TAGTGTTGGGAGATGGAAGCTGG - Intronic
1007102535 6:39259623-39259645 CAGGATTGGGAGAGGGAGGTGGG - Intergenic
1007177923 6:39909219-39909241 CAGGGGAGGGGGAGGGGAGAGGG + Intronic
1007178694 6:39913280-39913302 ATGGGTTGAGGGAGGGAAGAAGG - Intronic
1007384698 6:41512789-41512811 CAGGGCTGGGGGAGAGCAGAGGG - Intergenic
1007385933 6:41520132-41520154 CAGGCTTGGGGCAAGAAAGCAGG + Intergenic
1007512359 6:42383424-42383446 CAGGGTTGGGAGGAGGAAGGGGG - Intronic
1007589456 6:43012666-43012688 CGGGGATTGGGGAGGGGAGCTGG - Intronic
1007625990 6:43246699-43246721 CATGAGTGGGGGAGGGGAGCAGG + Exonic
1007677187 6:43606302-43606324 CTGGGATGGGGGAGGGGAGGAGG - Intronic
1007690717 6:43699524-43699546 CAGGGTTGAGGGAGCAGAGCAGG - Intergenic
1007712370 6:43833001-43833023 TAGGGATGGGGTAGGGGAGCTGG - Intergenic
1007795936 6:44347224-44347246 TGGGGTTGGGGGAGGGGAGAAGG + Intronic
1008058093 6:46966304-46966326 AAGGGCTGGGGGATGGAAGGAGG - Intergenic
1008386490 6:50897346-50897368 CAGTGTGGTGGGAGGGGAGCTGG - Intergenic
1009206089 6:60803629-60803651 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1009904414 6:69850967-69850989 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
1010317815 6:74470938-74470960 TAGTGTTGGGAGATGGAAGCTGG - Intergenic
1010975147 6:82303519-82303541 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
1011232475 6:85178487-85178509 GAGGGGTGGGGGAGGGATGGAGG - Intergenic
1011305755 6:85924650-85924672 AAGGGTTGTGGGAGGGAGGAGGG - Intergenic
1011570480 6:88729126-88729148 TAGTGTTGGGAGATGGAAGCTGG - Intronic
1011863475 6:91791277-91791299 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1012251810 6:96988954-96988976 TGGGGTTGGGGGAGGGAGGAGGG + Intronic
1012291762 6:97464781-97464803 CAGGGAGGGGGGAGAGAAACGGG - Intergenic
1012505642 6:99943476-99943498 TGGGGTTGGGGGAGGGGAGAGGG - Intronic
1012863624 6:104592086-104592108 CAGGAATGGGGGTGGGAAGGGGG + Intergenic
1013082741 6:106826776-106826798 GAGGGAGGGGGGAGGGAGGCAGG + Intergenic
1013166556 6:107598667-107598689 ATGGGTTGGAGGAGGGGAGCAGG + Intronic
1013443045 6:110190881-110190903 AAGGGTTGGGGGAGATCAGCTGG - Intronic
1013492984 6:110668236-110668258 CAGGGGTGGGGTAGGGATGGAGG - Intronic
1013559235 6:111287848-111287870 TAGTGTTGGGAGACGGAAGCTGG + Intergenic
1013605824 6:111746812-111746834 GAGGGTAGAGGGAGGGAGGCAGG + Intronic
1014769458 6:125444787-125444809 CAGGGGTGGGGGTGGGGAGACGG - Intergenic
1015171983 6:130264289-130264311 TAGTGTTGGGAGATGGAAGCTGG - Intronic
1015566273 6:134574643-134574665 CAGGGTTGGGGCGGGGAGGGCGG + Intergenic
1015630240 6:135225013-135225035 CAGGGTTGGGGGAGTAAGGCAGG - Intergenic
1016070514 6:139733063-139733085 GAGGATGGGGAGAGGGAAGCAGG + Intergenic
1016653274 6:146487433-146487455 TGTGTTTGGGGGAGGGAAGCAGG + Intergenic
1016751420 6:147634447-147634469 CAGTGTTGGAGGAGGGAGGAGGG - Intronic
1016866270 6:148770437-148770459 CATGGTAGGGGAAGGGAAGAGGG + Intronic
1016924534 6:149329674-149329696 CGGGGTTGGGGGGTGGAAGTAGG + Intronic
1016932396 6:149424189-149424211 CAGAGTTGGGAGAGGACAGCAGG - Intergenic
1017121460 6:151028100-151028122 CTGGGTTGAGGCAGGGAAGCAGG + Intronic
1017153528 6:151302819-151302841 AAAAGTTGGGGGAGGAAAGCAGG - Intronic
1017154933 6:151314560-151314582 CAGGGATGGGGGAAAGAAGTTGG + Intronic
1017744859 6:157437070-157437092 CAGGGTAGGGCTATGGAAGCAGG - Intronic
1017791055 6:157799810-157799832 CAGTGTTGTGGGAGGGACCCAGG - Intronic
1018265918 6:162024174-162024196 AAGGGTTGGGGGAGGGAGGGAGG - Intronic
1018433592 6:163742545-163742567 CAGGGTGGTGGGAGGCATGCAGG - Intergenic
1018461667 6:164004694-164004716 AAGGGGAGGGGGAGGGAAGGGGG + Intergenic
1018488601 6:164268888-164268910 CAGGGTTTGGGGAGTGGAGGAGG + Intergenic
1018576390 6:165264372-165264394 CAGGGTTAGGGGAGGGACCTGGG - Intergenic
1019284335 7:216135-216157 TGGGGCTGGGGGAGGGGAGCAGG + Intronic
1019429751 7:993202-993224 CAGGGCAGGGGGACGGCAGCTGG + Intergenic
1019450095 7:1093129-1093151 CAGGGTTGGCGGGGAGGAGCTGG - Exonic
1019476975 7:1249000-1249022 GAGGCTTAGGGGAGGGAAGCAGG - Intergenic
1019571341 7:1713879-1713901 GAGAGGTGGGGGAGGGGAGCCGG - Intronic
1019573537 7:1725133-1725155 CAGGATTAGGGAGGGGAAGCAGG + Intronic
1019630341 7:2045732-2045754 GTGGGGTGGGGGAGGGGAGCGGG + Intronic
1019796027 7:3049376-3049398 GAGGGTTGGGGGAGGGAAGTGGG - Intergenic
1019960975 7:4459136-4459158 AAGGGGTGGGGGAGGGAGGGAGG + Intergenic
1019979321 7:4609546-4609568 CAGGGTGGGGGCAGGGGGGCTGG + Intergenic
1020282362 7:6656070-6656092 CAGGGCTGGGGGCGGGTAGGAGG + Exonic
1021849296 7:24791896-24791918 TAGTGTTGGGAGAAGGAAGCTGG + Intergenic
1021959325 7:25856970-25856992 CAGGGTTGAGGCAGCGAAGGTGG - Intergenic
1021960575 7:25868937-25868959 CAGGGATGGCAGAGAGAAGCAGG + Intergenic
1022218725 7:28291044-28291066 TGAGGCTGGGGGAGGGAAGCTGG - Intergenic
1022417989 7:30194801-30194823 CAGGGCTGGGTGGGGGCAGCAGG + Intergenic
1022521330 7:31009039-31009061 GAGGATGGGGGGAGAGAAGCAGG - Intergenic
1023598074 7:41853511-41853533 TGGGGTTGGGGAAGGGGAGCAGG + Intergenic
1023732629 7:43206629-43206651 GGGAGGTGGGGGAGGGAAGCTGG - Intronic
1023732882 7:43209073-43209095 CAGGGTTAGGAGTGGGAGGCGGG + Intronic
1023789048 7:43737531-43737553 GGGGGTTGGGGGAGGAAAGGGGG - Intergenic
1023799608 7:43822430-43822452 TAGTGTTGGGAGATGGAAGCTGG - Intergenic
1023830540 7:44036653-44036675 CAAGGTGCGGGGAGGGGAGCGGG - Intergenic
1024274888 7:47669490-47669512 TAGAGATGGGGGAGGGGAGCAGG + Intergenic
1024593242 7:50908375-50908397 GAGGGTTGAGGGTGGGAAGAGGG + Intergenic
1024680696 7:51683868-51683890 TAGGGTTGGGGGAGGGGGGAGGG + Intergenic
1025143605 7:56485462-56485484 GAGGGATGGGGGAGGAATGCAGG - Intergenic
1025609612 7:63066867-63066889 GAGGGATGGGGGAGGAAGGCAGG + Intergenic
1025900682 7:65742120-65742142 CAGGGTTGGGGTGGGGAGGGAGG - Intergenic
1026110503 7:67455371-67455393 TAGGGTTTGGGGAAGGAAGGGGG + Intergenic
1026527251 7:71165192-71165214 CAGGGATTGGGAAGGGCAGCTGG + Intronic
1026847308 7:73705369-73705391 CAGAATTGGGGGAGGGGGGCGGG - Intronic
1026963894 7:74427096-74427118 CAGGGTTGGTGGCGGGGAGGTGG + Intergenic
1027001424 7:74657381-74657403 CCCGGGTGGGGGAGGGGAGCCGG - Intergenic
1027051560 7:75024565-75024587 CAGGGCCGGGGTGGGGAAGCAGG + Intronic
1027254481 7:76422334-76422356 CATGGTTGGGGTAGGTAACCTGG - Intronic
1027587967 7:80081593-80081615 CAGGGGTAGCGGATGGAAGCTGG + Intergenic
1028713624 7:93939371-93939393 AATTGTTGGGGGAGGGAATCCGG + Intergenic
1028886989 7:95944873-95944895 TGGGGTTGGGGGAGGGAGGAGGG + Intronic
1028914020 7:96238701-96238723 CAGGGTTGGGGGATGTGAGGAGG - Intronic
1028984059 7:96996218-96996240 CGGGGTTGGGGGTGGGGAGGTGG + Intergenic
1028985078 7:97003180-97003202 TAGGGTTGGGAGTGGGAAGGTGG + Intergenic
1029140721 7:98407926-98407948 CTGGGTTGGGGTAGGGGGGCAGG - Intergenic
1029405910 7:100373873-100373895 CAGGCATGGGGGAGGGAGGAGGG - Intronic
1029486153 7:100842941-100842963 TAGTGTTGGGAGACGGAAGCTGG - Intronic
1029495449 7:100893800-100893822 CAGGGGTGGGGGATGTAGGCCGG + Exonic
1029610784 7:101625519-101625541 AGGCGTTGGGGGAGGGGAGCAGG - Intronic
1029740867 7:102490967-102490989 CAAGGTGCGGGGAGGGGAGCGGG - Intronic
1029758861 7:102590140-102590162 CAAGGTGCGGGGAGGGGAGCGGG - Exonic
1029985662 7:104921012-104921034 GTGGGGTGGGGGAGGGAAGATGG - Intergenic
1030094406 7:105885259-105885281 CTGGGTGGTGGGAGAGAAGCAGG + Intronic
1030380358 7:108803946-108803968 CAGGGGGGAGAGAGGGAAGCAGG - Intergenic
1030822815 7:114116256-114116278 CAGGATTGGGCTAGGGAATCTGG + Intronic
1031009692 7:116512998-116513020 CAGGGCTGGGGGAGGGGTTCAGG - Intergenic
1031116673 7:117676275-117676297 CCAAGTTGGGGGAGGGAAGAGGG + Intronic
1031605852 7:123766809-123766831 CAGGGTTGGGGCAGGAAATGGGG - Intergenic
1031699594 7:124906489-124906511 TAGGGTGGGGGGAGGGGAGAGGG + Intronic
1031701409 7:124931026-124931048 CAGGGATGGGGAGGGGAAACAGG - Intergenic
1031826598 7:126573508-126573530 CAAGCTTTGGGGAGGGAAGAGGG + Intronic
1031955016 7:127934166-127934188 CTGTGTTGGGGGAGGGGAGTAGG + Intronic
1032123274 7:129172048-129172070 TAGGGGTGGGGGTGGGAGGCAGG + Intergenic
1032195259 7:129785000-129785022 CTGGGTAGGGGTGGGGAAGCTGG - Intergenic
1032782366 7:135174134-135174156 TAGTGTTGGGAGATGGAAGCTGG - Intergenic
1033137642 7:138798217-138798239 CTGGGAAGGGGGAGGGAAGGAGG + Intronic
1033343890 7:140512539-140512561 CAGGGGTGGGGGATGGTGGCAGG + Intergenic
1033444734 7:141410447-141410469 CAGAGGTGGGGGAGGGAGGGAGG - Intronic
1034204948 7:149307255-149307277 GAGGGTGGAGGGAGGGAAGAGGG + Intergenic
1034263309 7:149770344-149770366 GAGGGAGGGGGGAGGGAAGAAGG + Intronic
1034422069 7:150995646-150995668 CAGGGGTGGGAGAGGGAAGAGGG - Intronic
1034422278 7:150996170-150996192 CAGGGGTGGGAGAGGGGAGAGGG - Intronic
1034439733 7:151080642-151080664 GAGGGCTGCGGGAGGGCAGCGGG - Intronic
1034442372 7:151092486-151092508 CAGAGTTGAGGTAGGGAAGGGGG + Intronic
1034461204 7:151198985-151199007 CCTGGTTGGGTGAGGGGAGCTGG + Exonic
1034937556 7:155209838-155209860 CAGGGTAGGGGGAAGGGAGCGGG - Intergenic
1034954742 7:155327566-155327588 CAGGGTTGGGGGAGAGAGGGGGG - Intergenic
1035167602 7:157000594-157000616 GCGGGGTGGGGGAGGGAAGGGGG + Intronic
1035221601 7:157409714-157409736 CAGAGCAGAGGGAGGGAAGCTGG - Intronic
1035295642 7:157865551-157865573 GGGGGTTGGGGGAAGGAAGGCGG + Intronic
1035335447 7:158124988-158125010 CAGGGTGGGAGAAGGGAAGAGGG + Intronic
1035389726 7:158496694-158496716 CAGGGAAGGGGGAGGGGTGCAGG - Intronic
1035389946 7:158497219-158497241 CAGGGAAGGGGGAGGGGCGCAGG - Intronic
1035673536 8:1438256-1438278 CATGGTTGGGGGAGGAAACTGGG - Intergenic
1035724064 8:1813805-1813827 CAGGGGTCGGGGAGGGGGGCAGG - Intergenic
1036135858 8:6160987-6161009 CAGGCTTGGGAGAGGGGAGCAGG - Intergenic
1036163722 8:6411817-6411839 AGGGGTTGGGGGCGGGACGCGGG + Intronic
1036659383 8:10698103-10698125 CAGGGGAGGGGGAGAGATGCAGG + Intronic
1036988599 8:13566353-13566375 CGGGGTCGGGGGTGGGGAGCAGG - Intergenic
1037764464 8:21763756-21763778 CAGGGTAGGGGGACGGATGAGGG - Intronic
1037803605 8:22048141-22048163 CGTGGTTGGGGAAGGGCAGCTGG - Exonic
1038293663 8:26271663-26271685 CAGGGATGGAGGAGGGAAGTGGG + Intergenic
1038598384 8:28911801-28911823 CAGGGTTGGGGGAGGGCAGAGGG + Intronic
1038842456 8:31197762-31197784 GAGGGATGGGGGAGGGGAGAAGG - Intergenic
1039454384 8:37697606-37697628 CGGGGTTGGCGGCGGGGAGCTGG + Exonic
1039849557 8:41352088-41352110 TAGGGTTGGGGGAAGGAGGAGGG - Intergenic
1039882325 8:41632690-41632712 CTGGGCTGGCGGAGGGAAGGAGG + Intergenic
1040414431 8:47183783-47183805 GAGGGTTGGGGTAGAGGAGCAGG - Intergenic
1040461887 8:47657403-47657425 GAGGGTTGGGAGATGGAAGGAGG + Intronic
1041083236 8:54233570-54233592 CAGGGGTGGGGGTGGGGAGTGGG - Intergenic
1041133818 8:54734428-54734450 CAGGGTAGGGTGAAGCAAGCAGG - Intergenic
1041255705 8:55978295-55978317 CAGGGATGAGGGAGGGAGGATGG + Intronic
1041279718 8:56197919-56197941 CAAGGTTGGGAGAGAGAAGGTGG - Intronic
1041387654 8:57321090-57321112 CAGGGTTGGGGGACGGGAGAGGG - Intergenic
1041467120 8:58168001-58168023 CTGGGTGGGGGGTGGGGAGCTGG - Intronic
1041484602 8:58360600-58360622 CAGGGTTGGGGTGGGGTGGCGGG + Intergenic
1042087783 8:65127742-65127764 TAGTGTTGGGAGATGGAAGCTGG + Intergenic
1042119339 8:65467367-65467389 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1042835156 8:73072874-73072896 CAGAGTTGGGGGAGGGTTGTGGG - Intronic
1043061436 8:75509424-75509446 TAGGGTTGGGTGTGAGAAGCCGG + Intronic
1043443379 8:80296727-80296749 CAGGGTTGGGGGAAAGAGGAGGG + Intergenic
1043463750 8:80486135-80486157 CCGGGCTGGGGGAGGGGGGCTGG - Intronic
1043847377 8:85177819-85177841 CCGGGATGGGGGAGGGACGAGGG + Intronic
1044184480 8:89235687-89235709 TAGTGTTGGGAGATGGAAGCTGG + Intergenic
1044482286 8:92705276-92705298 TGGGGTTGGGGGAGGGGAGAGGG + Intergenic
1044653252 8:94521186-94521208 GAGGGTTGGGGGAGAGCATCAGG - Intronic
1044725532 8:95191545-95191567 GAGGCCAGGGGGAGGGAAGCAGG - Intergenic
1044829189 8:96229383-96229405 CCGGGTGGGTGGAGGGAGGCTGG - Intronic
1044858074 8:96495282-96495304 CCAGGGCGGGGGAGGGAAGCTGG - Intronic
1045093844 8:98776332-98776354 CAGGTTTGCTGCAGGGAAGCTGG + Intronic
1045432974 8:102131098-102131120 CAAGGTTGGGGGTGGGAATGGGG - Intergenic
1045608504 8:103806919-103806941 CAGGTTTGGGTGAGGAAATCAGG + Intronic
1046276742 8:111971348-111971370 CAGTGTTGGAGGAGGGGACCTGG - Intergenic
1046459188 8:114509888-114509910 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
1047341104 8:123981249-123981271 CAGGTTTGGGGTAGGGGAGTAGG - Intronic
1047492844 8:125388664-125388686 AGGGGTGGGGGGAGGGGAGCGGG - Intergenic
1048201643 8:132379548-132379570 AAGGGTTTGGGAAGGGAAGAGGG - Intronic
1048608341 8:135993866-135993888 AAGGGTAGTGGGAGGGAAGTAGG + Intergenic
1048719512 8:137307898-137307920 GAGAGTTGGGTAAGGGAAGCAGG + Intergenic
1048981348 8:139704504-139704526 CGGGGTTGGAGGAGGAAAACGGG + Intergenic
1049088744 8:140497613-140497635 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
1049220884 8:141428323-141428345 CAGGGATGGGGCAGGCGAGCTGG - Intronic
1049468721 8:142765463-142765485 CAGGGTGGGGGGTGGGGAGGAGG + Intronic
1049526547 8:143129752-143129774 CAGGGCTGGGGGAAGGAGGAGGG + Intergenic
1049532136 8:143160058-143160080 CAGGGGTGGGGGTGGGGACCTGG - Intronic
1049533842 8:143169038-143169060 TGGGGTTGGGGGAGGGAAGAGGG - Intergenic
1049701945 8:144019207-144019229 CAGGCATGGGGGAGGCAAGCAGG + Intronic
1050185491 9:2968441-2968463 CAAGGTCGGGGGAGAGATGCAGG + Intergenic
1050230990 9:3525986-3526008 GAGGGGTGGGGGAGGGAAGAGGG + Intronic
1050309656 9:4339856-4339878 GAGGGGTGGGGGAGGGGAGGGGG + Intronic
1050392151 9:5155325-5155347 CAGGGTTGGGGGAGGGGGGAGGG + Intronic
1050491344 9:6191277-6191299 CAGGGTCTGGGGTGGGAAGAAGG - Intergenic
1050909352 9:11047583-11047605 TTGGGTTGGGGGAGGAAATCTGG - Intergenic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1052230536 9:26145643-26145665 CAGGCTTGGAGGAGAGAAGGTGG + Intergenic
1052845327 9:33330614-33330636 CAGGGTTGGGACATGTAAGCTGG + Intronic
1052947420 9:34179279-34179301 CGGAGTTGGGGGAGGGGGGCTGG + Intronic
1052951994 9:34220100-34220122 GAGGGGAGGGGGAGGGAAGAGGG - Intronic
1052996412 9:34553715-34553737 GAGGGTTGGGGGAGACCAGCAGG - Intronic
1053072580 9:35110033-35110055 CAGAGGTGGGGGTGGGGAGCAGG + Exonic
1053512673 9:38702125-38702147 CAGGACTGGGGGACGGAAGATGG + Intergenic
1054449908 9:65398206-65398228 CCGGGCTGGGGGAGGGGAGGCGG + Intergenic
1054771834 9:69090557-69090579 CTGGGTTGGGGGAGGGAGGAAGG + Intronic
1054831692 9:69632331-69632353 CACCTTTGGGGGAGGGAAGTTGG - Intronic
1055775116 9:79759559-79759581 CAGGGTTGGGGCAGGGAAGGAGG + Intergenic
1056040506 9:82660651-82660673 AAGGGAAGGGGGAGGGAAGGGGG + Intergenic
1056182985 9:84103442-84103464 CTGGGGAGGGGGAGGGAGGCAGG + Intergenic
1056190013 9:84175854-84175876 CAAGCTGGGGGGAGGGAAGGTGG - Intergenic
1056198503 9:84251784-84251806 CAGGGAAGGGGGAGGGCAGGAGG - Intergenic
1056262018 9:84858421-84858443 GGGGGTTGGGGGAGGGAAATGGG - Intronic
1056414357 9:86362080-86362102 TAGTGTTGGGAGACGGAAGCTGG + Intergenic
1056474567 9:86941397-86941419 CAAGGTTGTGGGAGGGCATCAGG - Intergenic
1056971168 9:91204963-91204985 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1057531118 9:95847552-95847574 CAGGGATGGGGGTGGGGAGTGGG - Intergenic
1057841090 9:98486065-98486087 CAGGAGAAGGGGAGGGAAGCAGG - Intronic
1058494660 9:105543574-105543596 TGGGGTTGGGGGAGGGGAGAGGG - Intronic
1059168643 9:112103620-112103642 CAGGCTTGGGCGTGGGAAGTGGG - Intronic
1059199582 9:112401712-112401734 GTGGGGTGGGGGAGGGAAGGAGG + Intronic
1059290663 9:113221258-113221280 CCGGGTTGCGGGGAGGAAGCTGG + Exonic
1059618822 9:115980857-115980879 CAGGTGTGGGGGAGATAAGCAGG + Intergenic
1060103235 9:120857842-120857864 CTGGGGTGGGAGAAGGAAGCAGG - Exonic
1060251154 9:121987762-121987784 CAGGGGAGGGGGAGGGAGCCAGG - Intronic
1061081381 9:128372681-128372703 CAGGCTTTGGGGAGTGTAGCTGG - Intronic
1061085213 9:128394093-128394115 AAGGGTGGGGGGAGGGGAGCAGG + Intergenic
1061147545 9:128808728-128808750 CAGGGCTGGGGGATGGGAACAGG - Exonic
1061182077 9:129030274-129030296 CAGGGCTGGGAGAGGGAACAGGG - Intergenic
1061239946 9:129364123-129364145 CAGGGTGGGGGCAGGAAAGAGGG - Intergenic
1061242582 9:129383130-129383152 GAGGGTGGGGGCAGGGAGGCGGG + Intergenic
1061246329 9:129402828-129402850 ATGGGATGGGGGAGAGAAGCTGG - Intergenic
1061289885 9:129644666-129644688 GAGGGGTGGGGGTGGGCAGCTGG + Intergenic
1061382263 9:130265652-130265674 CACGATTGGGGGAGGGGAGGAGG + Intergenic
1061480762 9:130896753-130896775 CTGGCCTGGGGGATGGAAGCTGG - Intergenic
1061483531 9:130908916-130908938 CAGGGTTGGGGTGGTGAGGCGGG - Intronic
1061887994 9:133602442-133602464 TAGCATTGGTGGAGGGAAGCAGG - Intergenic
1061890192 9:133615171-133615193 CAGACTTGGGGAAGGGGAGCGGG + Intergenic
1061947120 9:133914676-133914698 AAGGGATGGGGGAGGGAAGCGGG + Intronic
1061958691 9:133977101-133977123 CAGGCTTGGGGCAGGGCGGCTGG - Intronic
1062032168 9:134366587-134366609 CAGGGCTGGGGCAGGGAGGAAGG + Intronic
1062051224 9:134448042-134448064 ATGGGGTGGGGGAGGGGAGCAGG + Intergenic
1062126149 9:134864122-134864144 CAGGGGAGGGAGAGGGAAGCAGG - Intergenic
1062127375 9:134870814-134870836 GAGGGAGGTGGGAGGGAAGCTGG + Intergenic
1062281213 9:135752567-135752589 CATGGATGGGGGTGGGAAGATGG + Intronic
1062344836 9:136109849-136109871 CTGGGCTGGGGGAGGGGCGCCGG + Intergenic
1062360520 9:136185875-136185897 CAGGGTAGGAGGAGGGAACGGGG + Intergenic
1062520259 9:136954674-136954696 CAGGGATGGGTGAGGGGAGGAGG - Intronic
1062521111 9:136958395-136958417 CTGCCTTGGGGGAGGGAAGCTGG - Intergenic
1062623966 9:137434710-137434732 GGAGGTTGGGGGAGGGACGCCGG + Exonic
1062686603 9:137816943-137816965 CAGGCCTGGGGGAGGGTGGCCGG - Intronic
1062686629 9:137817013-137817035 CAGGGCTGGGGGAGGGTGGCAGG - Intronic
1203761181 EBV:13499-13521 CAGGCTGGGGGGAGAAAAGCTGG - Intergenic
1203762110 EBV:16571-16593 CAGGCTGGGGGGAGAAAAGCTGG - Intergenic
1203763039 EBV:19643-19665 CAGGCTGGGGGGAGAAAAGCTGG - Intergenic
1203763968 EBV:22715-22737 CAGGCTGGGGGGAGAAAAGCTGG - Intergenic
1203764897 EBV:25787-25809 CAGGCTGGGGGGAGAAAAGCTGG - Intergenic
1203765826 EBV:28859-28881 CAGGCTGGGGGGAGAAAAGCTGG - Intergenic
1203766755 EBV:31931-31953 CAGGCTGGGGGGAGAAAAGCTGG - Intergenic
1203767684 EBV:35003-35025 CAGGCTGGGGGGAGAAAAGCTGG - Intergenic
1185499476 X:585715-585737 CAGGGATGGAGGAGGGAGGTGGG - Intergenic
1185706802 X:2273620-2273642 GAAGGTAGGGGGAGGGAGGCAGG - Intronic
1186146870 X:6633487-6633509 TAGGATGGGGGGAGGGGAGCGGG - Intergenic
1186551186 X:10507305-10507327 CAGGGTTGTGGGAAGGGAGAGGG + Intronic
1186564115 X:10644005-10644027 TGGGGTTGGGGGAGGGAGGAGGG + Intronic
1186677995 X:11840885-11840907 TAGGGTGGGGGGAGGGGGGCGGG - Intergenic
1186974749 X:14889591-14889613 GGGGGTTGGGGGAGAGAGGCAGG - Intronic
1187179670 X:16932016-16932038 CAGTGGTGGGGGAGGACAGCAGG + Intergenic
1187256500 X:17647840-17647862 CAGGATTGGAGGAGGAAAGGTGG + Intronic
1188239497 X:27768287-27768309 CAGGTTTGGTGGTGGGAAGATGG + Intergenic
1188640012 X:32489327-32489349 CAGGGTTGGGTAAGGGTGGCGGG + Intronic
1188738262 X:33744561-33744583 CAGGGTGGAGGGTGGGAAGAGGG + Intergenic
1189051634 X:37651742-37651764 TGGGGTTGGGGGAGGGAGGAGGG - Intronic
1189192061 X:39118847-39118869 CAGTGAGGGAGGAGGGAAGCAGG + Intergenic
1189230895 X:39451521-39451543 AAGGGATAGGGGAGGGAAGGTGG - Intergenic
1189248559 X:39582040-39582062 CAGGGTGGGGGCAGTGGAGCAGG + Intergenic
1189363292 X:40369626-40369648 CAGGCTTGGGGCAGGGGAGTGGG + Intergenic
1189581147 X:42407845-42407867 GAGGGTTGGGGGTGGGAGGAGGG - Intergenic
1189661435 X:43304204-43304226 TAGGGTTGGGGGAGGGGGGAGGG - Intergenic
1190258508 X:48783080-48783102 CGGGGATGGGGGAGGGAATGGGG + Intergenic
1190270326 X:48858143-48858165 TAGTGTTGGGAGACGGAAGCTGG - Intergenic
1190336571 X:49266379-49266401 GAAGGTTGGGGGAGGAAAGGGGG - Intergenic
1190410361 X:50131021-50131043 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
1190641773 X:52487132-52487154 GAGGGATGGGGGAGAGATGCGGG + Intergenic
1190645899 X:52525733-52525755 GAGGGATGGGGGAGAGATGCGGG - Intergenic
1190765472 X:53472650-53472672 CTGTGTTGGGTGGGGGAAGCAGG + Intergenic
1191101608 X:56735566-56735588 CCGGGTGGGTGGAGGGAGGCTGG - Intergenic
1191639295 X:63413053-63413075 TAGTGTTGGGAGACGGAAGCTGG - Intergenic
1191980550 X:66919775-66919797 AAGGGGTGGGGGTGGAAAGCAGG + Intergenic
1192050390 X:67719132-67719154 CAGGGTTGGGAGAGGGCAGCTGG - Intronic
1192124178 X:68486186-68486208 CAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1192169692 X:68846659-68846681 CCTGGGTGGGGGAGGGAAGAAGG - Intergenic
1192204808 X:69088756-69088778 CAGGGCTCGGGGAGGGCTGCGGG + Intergenic
1192225240 X:69222926-69222948 CAGGGTTGGGGGTAGGAAGCAGG - Intergenic
1192237410 X:69304728-69304750 CAGGAATGGGGGAAGGAAGGAGG - Intergenic
1192241759 X:69336757-69336779 GAGGGTTGGGGGTGGGAGGAGGG - Intergenic
1192589855 X:72350859-72350881 CAGCCTTGGGGAAGGGAAGGAGG + Intronic
1192639453 X:72848099-72848121 AAGGATTGGGGGAGGCAAGATGG + Intronic
1192642258 X:72872706-72872728 AAGGATTGGGGGAGGCAAGATGG - Intronic
1192677619 X:73214889-73214911 CATAGTTGTGGGAGGGAAGGAGG - Intergenic
1192748626 X:73964799-73964821 CAGGCTTGCGGAAGGAAAGCAGG + Intergenic
1192838733 X:74831334-74831356 TGGGGTTGGGGGAGGGGGGCGGG - Intronic
1192904491 X:75536437-75536459 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1193717389 X:84948808-84948830 TAGTGTTGGGAGACGGAAGCTGG - Intergenic
1194038458 X:88910382-88910404 TGGGGTTGGGGGAGGGAGGGGGG + Intergenic
1194358728 X:92920109-92920131 TGGGGTTGGGGGAGGGGAGAGGG + Intergenic
1194614115 X:96080054-96080076 CGGGGTGGGGGGAGGGGAGAGGG + Intergenic
1195116448 X:101703690-101703712 GAGGTTTGGGGGAGGGGAGTGGG + Intergenic
1195310710 X:103629453-103629475 CAGGGTAGGGGGCGGGGAGTGGG - Intronic
1195957329 X:110345345-110345367 TGGGGTTGGGGGAGGGGAGAGGG + Intronic
1196157169 X:112443080-112443102 CAGAGTTTGGGAAGGGTAGCAGG - Intergenic
1196460128 X:115920892-115920914 TAGTGTTGGGAGACGGAAGCTGG - Intergenic
1196650077 X:118159352-118159374 GAGGGGGGGGGGAGGGAAGGAGG + Intergenic
1196855292 X:119977183-119977205 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1196869462 X:120099116-120099138 TAGTGTTGGGAGATGGAAGCTGG - Intergenic
1196889107 X:120275240-120275262 CAGAGTCTGGGGAGGGAAGCTGG + Intronic
1197199472 X:123735210-123735232 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1197416440 X:126179560-126179582 TGGGGTGGGGGGAGGGGAGCGGG + Intergenic
1197417667 X:126194551-126194573 TGGGGTTGGGGGAGGGGGGCGGG + Intergenic
1198124319 X:133627164-133627186 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1198173936 X:134135963-134135985 CAGTGTTGGGGGAGGGGGCCTGG + Intergenic
1198275410 X:135094440-135094462 CAAGGCTGGGGAAGGGAAGGAGG + Intergenic
1198311103 X:135426257-135426279 CAAGGTTGGGAAAGGGAAGCAGG - Intergenic
1198675327 X:139124837-139124859 CAGGATTTGGGGAAGAAAGCAGG + Intronic
1198742538 X:139856307-139856329 TAGTGTTGGGAGACGGAAGCTGG - Intronic
1198839424 X:140840835-140840857 CAGTGTTGGGTGAGGGAGCCAGG + Intergenic
1199101668 X:143808886-143808908 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1199536873 X:148912460-148912482 CAGGGTGGAGGGTGGGAAGAGGG + Intronic
1199559296 X:149146191-149146213 CTGGGGTGGGGGTGGGAAGTTGG + Intergenic
1199599935 X:149535852-149535874 GTGGGTTGGAGGAGGGAAGGAGG - Intergenic
1199771915 X:150980675-150980697 CAGGGTTGGGGCAGTGGGGCAGG + Intronic
1199872822 X:151913544-151913566 TGGGATTGGCGGAGGGAAGCGGG + Intronic
1199873001 X:151914232-151914254 TGGGATTGGCGGAGGGAAGCGGG + Intronic
1199873181 X:151914914-151914936 TGGGATTGGCGGAGGGAAGCGGG + Intronic
1199873528 X:151916276-151916298 TGGGATTGGCGGAGGGAAGCGGG + Intronic
1199873708 X:151916958-151916980 TGGGATTGGCGGAGGGAAGCGGG + Intronic
1199874233 X:151918993-151919015 TGGGATTGGTGGAGGGAAGCGGG + Intronic
1199977471 X:152902837-152902859 GAGGGTTGTGGGAGGGGAGAAGG + Intergenic
1199982676 X:152929385-152929407 CAGGGACTGGGGAGAGAAGCGGG + Intronic
1200666897 Y:6035799-6035821 TGGGGTTGGGGGAGGGGAGAGGG + Intergenic
1201308966 Y:12577258-12577280 TAGTGTTGGGAGATGGAAGCTGG - Intergenic
1201740371 Y:17317564-17317586 TGGGGTTGGGGGAGGGGAGAGGG + Intergenic
1201918202 Y:19205320-19205342 CAGGGTTGGGGGGGTGAAATAGG - Intergenic
1201945023 Y:19502330-19502352 CAGAGAGGGGGAAGGGAAGCAGG + Intergenic
1202033446 Y:20604499-20604521 CGGGGTTGGGGGAGGGGAGAGGG + Intergenic
1202241308 Y:22773394-22773416 GAGGGTTGGGGGAGGGGGGAGGG - Intergenic
1202394294 Y:24407137-24407159 GAGGGTTGGGGGAGGGGGGAGGG - Intergenic
1202476491 Y:25262955-25262977 GAGGGTTGGGGGAGGGGGGAGGG + Intergenic