ID: 1124395539

View in Genome Browser
Species Human (GRCh38)
Location 15:29297947-29297969
Sequence ATCTAGCAGCTGAATGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124395539 Original CRISPR ATCTAGCAGCTGAATGCACA TGG Intronic
900312714 1:2041896-2041918 AGCCAGCAGCTGGATGGACAGGG - Intergenic
901761040 1:11471801-11471823 ATCTGGCAGCAGGATGCAGAAGG - Intergenic
904290005 1:29478690-29478712 ATGGAGCAGGTGAACGCACAGGG + Intergenic
905551204 1:38841292-38841314 ACCCAGGAGCTGAATGCATAGGG + Intronic
908892643 1:68863639-68863661 ATGTATCATCTGAACGCACAGGG + Intergenic
912560173 1:110545741-110545763 ATCTTCCAGGTGATTGCACATGG + Intergenic
915629420 1:157139923-157139945 AGCTAGTAGATGAAGGCACAAGG - Intergenic
917046979 1:170871947-170871969 AGCTGGCAGCTGATTACACATGG + Intergenic
917413333 1:174782875-174782897 ATCTATCATCTGAGAGCACAGGG + Intronic
920424789 1:205866452-205866474 ATCTATCATCTGAGAGCACAGGG - Intergenic
923048998 1:230377116-230377138 ATCTAGGGGCTGTATGCACTTGG - Intronic
923469998 1:234282045-234282067 ATCTGGCAGCTCACTCCACAGGG - Intronic
924187045 1:241503928-241503950 ATCCCGCAGCTGGATGCGCAAGG - Intronic
1066415845 10:35220856-35220878 ATCTAGAAGCTGTGTTCACAGGG - Intergenic
1068387583 10:56351907-56351929 ATCTATCACCTGAGAGCACAGGG + Intergenic
1068721296 10:60249164-60249186 ATATAGCAGTTGAATGGAAAGGG + Intronic
1069076791 10:64045476-64045498 ATCTATCACCTGAGAGCACAGGG + Intergenic
1069119490 10:64551175-64551197 ATCTAGATGCTGACAGCACAAGG - Intergenic
1070078510 10:73162318-73162340 ATTTAGCATCTGACTGAACATGG + Intronic
1070222315 10:74460952-74460974 GTCTAGCAGATGAATGAATAGGG + Intronic
1070388227 10:75946399-75946421 ATGGAGCATCTGACTGCACATGG + Intronic
1070732566 10:78841510-78841532 AATTTGCAGCTGAATCCACATGG - Intergenic
1072038924 10:91589716-91589738 ATCTCTGAGCTGAAAGCACATGG + Intergenic
1072700296 10:97636085-97636107 ATTTACCAGCTGAATGACCATGG + Intronic
1076862400 10:133144870-133144892 ATATAGCAGGTGAAGGCACCTGG + Intergenic
1080379708 11:31755694-31755716 ATATAGCAACTGAATGCAAGTGG + Intronic
1081552633 11:44128270-44128292 TCATAGCAGCTGTATGCACAGGG + Intronic
1082214868 11:49557761-49557783 ATCCAGCTGCTGAAAGCACCTGG + Intergenic
1082678043 11:56133271-56133293 ATCCACAAGCTGAATCCACATGG + Intergenic
1087149534 11:94846215-94846237 CTCTAACAGATGCATGCACAGGG - Intronic
1087458025 11:98412035-98412057 ATCTGTCACATGAATGCACAGGG + Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088695255 11:112360972-112360994 ATCTCTCAGCTGGATGCACCGGG + Intergenic
1089112940 11:116071481-116071503 AGCTAGCAGCTGATTGCCCTTGG - Intergenic
1090023090 11:123144796-123144818 ATTTATCAGCTGATTGCATATGG + Intronic
1093564989 12:20591449-20591471 ACCTAGCATCTCAATGCTCATGG + Intronic
1093966958 12:25337995-25338017 CACTAGCAACTGTATGCACAAGG + Intergenic
1094795061 12:33962134-33962156 ATGAAGCAGATAAATGCACAGGG + Intergenic
1095106855 12:38244352-38244374 ATGAAGCAGATAAATGCACAGGG + Intergenic
1096809409 12:54160104-54160126 ATCTCCCAGCTGAATGGGCAGGG + Intergenic
1100945271 12:99776427-99776449 ACCTATTAGCTGAATGAACATGG - Intronic
1104850998 12:131873759-131873781 ATCTATCACCTGAGAGCACAGGG - Intergenic
1106681269 13:32010956-32010978 ATTGAGAAGCTGCATGCACAGGG - Intergenic
1108450944 13:50562324-50562346 ATGTAGCAGCTGAGTCCTCAAGG + Intronic
1109292864 13:60497356-60497378 ATCTATCACCTGAGAGCACAGGG - Intronic
1110660969 13:78059268-78059290 ATCTATCACCTGAGAGCACAGGG + Intergenic
1113964199 13:114143261-114143283 ATTTAGAAGCTGAGTACACAAGG - Intergenic
1118000820 14:61522026-61522048 TTTAAGCAGCTGAATACACATGG - Intronic
1120341403 14:83225503-83225525 ATCTATCACCTGAGAGCACAGGG + Intergenic
1120461532 14:84803577-84803599 ATCCAGCAGCTCAGGGCACAAGG + Intergenic
1121514666 14:94541739-94541761 ATACAGAAGCTGACTGCACAGGG + Intergenic
1123987259 15:25656838-25656860 ATCTATCACCTGAGAGCACAGGG + Intergenic
1124096291 15:26651400-26651422 AGCAAGTAGCTGAATGCAGAAGG - Intronic
1124395539 15:29297947-29297969 ATCTAGCAGCTGAATGCACATGG + Intronic
1125342316 15:38687132-38687154 CCCTGGCAGCTGAATTCACAGGG - Intergenic
1126153922 15:45547585-45547607 ATCTATCATCTGAGAGCACAGGG - Intergenic
1126153948 15:45547803-45547825 CTCTAGCAGCTGCATTCTCATGG + Intergenic
1131629111 15:94157428-94157450 ATCTATCATCTGAGAGCACAGGG + Intergenic
1133846879 16:9463074-9463096 ATTTAGCTGCTCAATGAACATGG + Intergenic
1134060326 16:11195686-11195708 ACCAAGCTGCTGAATCCACATGG - Intergenic
1138756191 16:59488597-59488619 CTCTAGCATCTGATTTCACAAGG - Intergenic
1141746196 16:85928040-85928062 ACCCAGGAGGTGAATGCACACGG - Intergenic
1141832829 16:86519268-86519290 ACCCAGCAGCTGAATACACAGGG + Intergenic
1143346645 17:6254375-6254397 ATCTAGCAGAGGCTTGCACAAGG + Intergenic
1148903564 17:50896929-50896951 ATTTAGCAGCTGAATAATCACGG + Intergenic
1152729688 17:81963329-81963351 ATCTTCCAGCTGGCTGCACAGGG + Intergenic
1155011638 18:21784661-21784683 ATATAGGAGCTGAAGGGACATGG + Intronic
1156115263 18:33779916-33779938 ATTTAGTAGCTGAATGCCCTTGG + Intergenic
1157898464 18:51490813-51490835 CTCTAGTATCTGAATGCCCAGGG + Intergenic
1164718803 19:30416085-30416107 ATCTAAAAGCTGAATAGACATGG - Intronic
1166165696 19:40986815-40986837 ATCTATCATCTGAGAGCACAGGG - Intergenic
1168147045 19:54425437-54425459 ATCTATCACCTGAGAGCACAGGG - Intronic
925284780 2:2708862-2708884 CACTTTCAGCTGAATGCACATGG - Intergenic
927820356 2:26258794-26258816 ATCTATCATCTGAGAGCACAGGG - Intronic
928440070 2:31284901-31284923 ATCTATCACCTGAGAGCACAGGG + Intergenic
929517143 2:42614009-42614031 ATCTAGCAGCTGACATAACAAGG - Intronic
933121803 2:78547236-78547258 ATCTATCACCTGAGAGCACAGGG - Intergenic
935162269 2:100539436-100539458 AGCTAGAACCTGAATGCACGAGG - Intergenic
938195760 2:129326268-129326290 ATCTAGCTGTAGAATGCACCTGG - Intergenic
939981431 2:148786424-148786446 ATATTCCAGCTGAATGCAAAAGG + Exonic
941395592 2:164969096-164969118 ATCTATCACCTAAATGCACAGGG - Intergenic
942345977 2:175003884-175003906 TTCTAGCAGCTTAATTCACTGGG + Intronic
943462405 2:188184879-188184901 ATCTATCATCTGAGAGCACAGGG - Intergenic
944299071 2:198101869-198101891 ATCCAGGAGATGAAAGCACAAGG - Intronic
948034159 2:234844379-234844401 ATCTAGGAGCTCATTCCACATGG - Intergenic
1169983336 20:11412065-11412087 GTCTAGCAGTGGAATGCACCGGG - Intergenic
1170961925 20:21033162-21033184 ATCTGGCAGCTGACTGCAGAGGG - Intergenic
1171987053 20:31667833-31667855 AATTAGCAGCTCAGTGCACATGG - Intronic
1172747708 20:37225747-37225769 ATCTACCAGCTGGAAGAACAAGG - Exonic
1172988194 20:39010348-39010370 ATCCTGCAGCTGAAAGCACTAGG + Exonic
1173034782 20:39398282-39398304 ATCTATAAGCTGAAGGCCCAAGG - Intergenic
1174948347 20:55013845-55013867 ATCTCGCAGCTGCATGAACAAGG + Intergenic
1177426331 21:20927474-20927496 ATCTATCAGCTGAGAGCACAGGG + Intergenic
1177788719 21:25698764-25698786 ATCCAGCTCCTGAATACACATGG + Exonic
1182327937 22:29528376-29528398 ATCAAGCAGCTGCATGCACTGGG - Intronic
949810271 3:7999942-7999964 ATCATGTAGCTGAATGCACTTGG - Intergenic
951303779 3:21031536-21031558 ATTTAGCATCTGAATTCAGATGG - Intergenic
953627373 3:44581813-44581835 ATTTAGAAGCTGAATGACCAGGG - Intronic
955381308 3:58440413-58440435 ATCTATCACCTGAGAGCACAGGG - Intergenic
957557689 3:81782106-81782128 ATCTATCATCTGAGAGCACAGGG + Intergenic
960302430 3:116020127-116020149 ATCTAGCAACATAATGAACATGG + Intronic
961773999 3:129271093-129271115 ATCTGGCAGATGTGTGCACATGG - Intronic
962169342 3:133084185-133084207 ATGTTGAAGCTGAATACACATGG - Intronic
963024059 3:140900953-140900975 ATCTATCACCTGAGAGCACAGGG + Intergenic
963592593 3:147281104-147281126 ATCTAACTGCTGAATCCAAATGG + Intergenic
967977702 3:195044647-195044669 ATCTAGCAGCCGAGCGGACAGGG - Intergenic
969409102 4:7016201-7016223 ATCTTGTAGCTGAAGCCACAAGG + Intronic
971473939 4:27055190-27055212 ATTTAGCAGGTGAAGGCAGATGG + Intergenic
971905386 4:32717767-32717789 ATCAATCAGCTGATTGAACAAGG + Intergenic
974190514 4:58496743-58496765 ATCTATCACCTGAGAGCACAGGG - Intergenic
974648528 4:64725175-64725197 ATCTATCACCTGAGAGCACAGGG - Intergenic
974808335 4:66912262-66912284 TTCTAGCAGATGAATGAAAATGG + Intergenic
976899140 4:90152438-90152460 ATCATGCAGCTGAATACTCAGGG - Intronic
977342056 4:95771542-95771564 ATCTATCGCCTGAAAGCACAGGG + Intergenic
980523619 4:133961523-133961545 ATCTATCACCTGAGAGCACAGGG + Intergenic
980871996 4:138622329-138622351 ATCTATCAACTGAGAGCACAGGG - Intergenic
981797528 4:148613945-148613967 ATCTAGAAGCTGGATGAATATGG + Intergenic
985442618 4:189994534-189994556 ATCTAGAAGATTAATGCTCATGG - Intergenic
986030530 5:3889023-3889045 GTCTAGCAGCTGGCAGCACACGG - Intergenic
986262328 5:6159128-6159150 TTCTATCATCTGATTGCACAAGG + Intergenic
986425616 5:7628417-7628439 ACTGAGCAGCTGAAAGCACATGG + Intronic
987501677 5:18718968-18718990 AACACTCAGCTGAATGCACATGG + Intergenic
987905312 5:24069159-24069181 ATCTATCATCTGAGAGCACAGGG + Intronic
988881443 5:35507936-35507958 ATCTATCATCTGAGAGCACAGGG + Intergenic
989277534 5:39607341-39607363 ATCTATCAGCTCACTTCACAAGG - Intergenic
993622858 5:90188464-90188486 ATCTATCATCTGAGAGCACAGGG - Intergenic
993642119 5:90417877-90417899 ATCTATCACCTGAGAGCACAGGG - Intergenic
993649633 5:90504033-90504055 AACTAGTAGCTTAATGCAAAAGG + Intronic
996939837 5:128991132-128991154 ATCTATCACCTGAGAGCACAGGG - Intronic
997839024 5:137221323-137221345 TTTTTGCAGCTGGATGCACATGG - Intronic
1000967868 5:167681203-167681225 TTCTAGCATCTATATGCACACGG + Intronic
1001662990 5:173410439-173410461 AACTATCAGCTGAAAGGACAGGG - Intergenic
1004726049 6:18312246-18312268 ATTTGGGAGCTGAATGAACAGGG + Intergenic
1008031798 6:46704847-46704869 CTTTAGCAGCTGAATGCAAACGG + Intronic
1009519583 6:64664264-64664286 ATCTATCATCTGAGAGCACAGGG - Intronic
1009702433 6:67201524-67201546 ATCTATCACCTGAGAGCACAGGG + Intergenic
1010908192 6:81519470-81519492 ATTTGGCAGCTGAATGGACTTGG - Intronic
1012119982 6:95354524-95354546 ATCTATCATCTGAGAGCACAGGG + Intergenic
1013544023 6:111137932-111137954 ATCTATCACCTGAGAGCACAGGG + Intronic
1013720828 6:113026129-113026151 ATCTTGCTGCCCAATGCACATGG - Intergenic
1016444206 6:144116443-144116465 ATCTATCACCTGAGAGCACAGGG - Intergenic
1017475182 6:154783639-154783661 ATCTGGTAGCTGTATGTACATGG + Intronic
1021126187 7:16853157-16853179 ATCTATCACCTGAGAGCACAGGG + Intergenic
1021144222 7:17065729-17065751 ATCTGTCATCTGAAAGCACAGGG + Intergenic
1023282966 7:38590576-38590598 ATCTATCATCTGAGAGCACAGGG - Intronic
1023439805 7:40173555-40173577 ATATATCACCTGAAAGCACAGGG - Intronic
1024215632 7:47246035-47246057 GTCTAGAAGCTGAATTTACATGG - Intergenic
1027357344 7:77370880-77370902 TTGTAGTAGCTGAAGGCACAGGG - Intronic
1030516657 7:110547046-110547068 ATTTAACAGATGAATACACAGGG + Intergenic
1032425829 7:131821395-131821417 ATCTATCATCTGAGAGCACAGGG - Intergenic
1034960664 7:155362424-155362446 CTCTGGAAGCTGAATGCACCCGG + Intronic
1035065809 7:156104483-156104505 TTCTAGCAGCTGTATGCTGATGG - Intergenic
1041117861 8:54557792-54557814 ATCCAGCAGCTCAGGGCACAAGG - Intergenic
1041450236 8:57998009-57998031 TTCCAGCAACTGAATGTACAAGG - Intronic
1044105921 8:88206555-88206577 ATCCAGCAGCTTAGGGCACAAGG - Intronic
1044988328 8:97774376-97774398 ATCTATCATCTGAGAGCACAGGG - Intergenic
1046242379 8:111513038-111513060 TTCCAACAGATGAATGCACAAGG + Intergenic
1047367094 8:124221677-124221699 TGCCAGCAGCTGTATGCACATGG + Intergenic
1047399966 8:124538191-124538213 ATTTAGCAGCTGAGTGTTCATGG - Intronic
1047443590 8:124900336-124900358 ATCTATCACCTGAGAGCACAGGG - Intergenic
1051736215 9:20201808-20201830 AAGTGGCAGCTGACTGCACAGGG - Intergenic
1051878333 9:21813694-21813716 AGCTAGTAGCTGAATCCCCAGGG + Intronic
1058961279 9:109994926-109994948 TTCTAGCAAATGAATGCACTTGG - Intronic
1061789239 9:133050221-133050243 ATAAAGCAGCTGAAACCACAGGG - Intronic
1186363931 X:8872295-8872317 CTCTTGCAGCTGAATGCAGCAGG + Intergenic
1189946979 X:46189438-46189460 ATCTATCATCTGAGAGCACAGGG + Intergenic
1191164046 X:57368193-57368215 ATCTAGCAGCCAAATACACAAGG + Intronic
1192803144 X:74486077-74486099 ATCTATCATCTGAGAGCACAGGG - Intronic
1193239213 X:79146844-79146866 ATCTATGAGCGGAATGCAGAAGG - Intergenic
1199303351 X:146238525-146238547 ATATGGCAGCTGAAGGCATATGG + Intergenic
1201642276 Y:16192392-16192414 ATCTATCATCTGAGAGCACAGGG - Intergenic
1201660538 Y:16392928-16392950 ATCTATCATCTGAGAGCACAGGG + Intergenic