ID: 1124395756

View in Genome Browser
Species Human (GRCh38)
Location 15:29300133-29300155
Sequence GTGAGTAAATGGATGGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 666
Summary {0: 1, 1: 0, 2: 7, 3: 85, 4: 573}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124395756 Original CRISPR GTGAGTAAATGGATGGATAA TGG Intronic
900498136 1:2985870-2985892 GTGAATGAATGGATGGATGATGG - Intergenic
900498167 1:2986011-2986033 GTGAATGAATGGATGGAGGATGG - Intergenic
900509584 1:3052193-3052215 ATGAATGAATGGATGGATGATGG - Intergenic
900931032 1:5737726-5737748 ATGGATAGATGGATGGATAATGG + Intergenic
901317935 1:8321693-8321715 GTGAGTGGAAGGATGGATAGAGG + Intronic
901587819 1:10312920-10312942 CTGAGTGGATGGATGGATAATGG + Intronic
901928637 1:12583135-12583157 GTGAGTGGATGGATGGAGTAGGG - Intronic
902397931 1:16142659-16142681 ATGAGTGGATGGATGGATGAGGG + Intronic
902398004 1:16142926-16142948 ATGAGTAGATGGATGGATGAGGG + Intronic
902398065 1:16143141-16143163 ACGAGTGAATGGATGGATGATGG + Intronic
902621821 1:17655251-17655273 GTGGATAGATGGATGGATGATGG - Intronic
902722855 1:18315650-18315672 ATGGGTAGATGGATGGAGAATGG + Intronic
903044835 1:20556860-20556882 TTGAGTAAATGCATAGACAAAGG - Intergenic
903294860 1:22337273-22337295 TTGAGTGGATGGATGCATAATGG - Intergenic
903937626 1:26907494-26907516 ATGAATTAATGGATGGATAGTGG + Intronic
904270033 1:29343945-29343967 GTGAGAAAAGGAATGGATGAAGG + Intergenic
904407423 1:30301649-30301671 GTGTATAAATGCATAGATAATGG + Intergenic
905003638 1:34693364-34693386 CAGAGTGAAGGGATGGATAAAGG - Intergenic
905309513 1:37039477-37039499 GTGAGTAGATGAATGGGTAAGGG - Intergenic
905834661 1:41107152-41107174 TTGGGTAAATGGATGAATAAAGG - Intronic
906585106 1:46968705-46968727 GTGAGTGAAAGGATGGATGAGGG + Intergenic
906588574 1:47002111-47002133 GTGAGTGAAAGAACGGATAAGGG + Intergenic
908187295 1:61664552-61664574 GTGAGTAATTGCAAGGATTAGGG - Intergenic
908642114 1:66236680-66236702 GAGAGTAAATGTATGCAGAAGGG + Intronic
908647903 1:66299447-66299469 ATCAGCAAATGAATGGATAAAGG - Intronic
908734173 1:67258358-67258380 ATGAGAAAATGGAGGGAGAAAGG + Intronic
910454803 1:87386029-87386051 GTGAGTAAGTGACTGAATAAAGG + Intergenic
910554983 1:88521589-88521611 TTAAGTAAATGAATGAATAAAGG - Intergenic
911936439 1:103981024-103981046 ATGAGTCACTGGATGGATCATGG + Intergenic
912001327 1:104838192-104838214 GCAAGTAAATGAATAGATAATGG - Intergenic
912065621 1:105737492-105737514 TTATGTAAATGGATGGCTAATGG - Intergenic
913139769 1:115929280-115929302 GTGAATGAATGAATGCATAAAGG + Intergenic
914429473 1:147607719-147607741 ATGAGCAACTGGGTGGATAAAGG + Intronic
915006943 1:152647028-152647050 GTGTGTACATGCATGGATGATGG - Intergenic
918144260 1:181741990-181742012 AAGAGAAAATGGATGGAGAAGGG - Intronic
918763379 1:188445128-188445150 TTGAGAAAATGGATAGATGAGGG + Intergenic
919435977 1:197561606-197561628 TTAGGTAAGTGGATGGATAAAGG - Intronic
920062077 1:203233884-203233906 GTGAGGAAAGGGAAGGATCAAGG - Intronic
921768804 1:219008329-219008351 ATGAATAAGTGAATGGATAATGG + Intergenic
922441710 1:225661045-225661067 GTGAGTGAATGAATGGCTACTGG - Intergenic
922790597 1:228308871-228308893 AAGAATGAATGGATGGATAATGG - Intronic
922790924 1:228310582-228310604 GATAGTAAATGGATGGATAGCGG - Intronic
923744942 1:236691704-236691726 GTGAGTGAAGGGATGTAAAAGGG - Intronic
923984336 1:239363955-239363977 ATGAGTAAATGGATGGTTGGGGG + Intergenic
1062943868 10:1445125-1445147 GTGAGTGAATGGATGGTAAATGG - Intronic
1063114222 10:3062556-3062578 GTGAGTGAATGAATGAATGAGGG - Intergenic
1063222294 10:3980261-3980283 GTGAGGAAATTGATGGCTCATGG + Intergenic
1063957958 10:11283492-11283514 GTGAGTGAGTGGGTGGATAATGG + Intronic
1064701411 10:18024937-18024959 GTAAGTAAAGGGTTGGAGAAAGG - Intronic
1064947464 10:20806768-20806790 GTGACTAAATGAATGAATGATGG + Intronic
1067051489 10:43024059-43024081 ATGGATAAATGGATGGATGATGG + Intergenic
1067808240 10:49407934-49407956 ATGAAAAAATGGATGGATGAAGG + Intergenic
1068465600 10:57386501-57386523 ATGGGTGAATGGATGAATAATGG - Intergenic
1068963014 10:62884211-62884233 GTTAGTAAGAGGATGGACAATGG + Intronic
1069115015 10:64494214-64494236 ATGCGTAAATAAATGGATAAAGG - Intergenic
1069220051 10:65871909-65871931 TTAAGTAAATGGATGGTGAATGG - Intergenic
1071490654 10:86134316-86134338 GTGAGTAAGTGATTGGATGATGG + Intronic
1072767163 10:98104492-98104514 GCGAATAAATGTATTGATAATGG - Intergenic
1072922622 10:99589238-99589260 CTGAGTTAATGGCTGGGTAATGG - Intergenic
1072991806 10:100202732-100202754 GTGTGCAGATGGGTGGATAAAGG + Intronic
1073840545 10:107494362-107494384 ATGAGTAAATGAATGAACAAAGG - Intergenic
1074148881 10:110740710-110740732 CTGAGTAAGGGGATGAATAAAGG - Intronic
1075652399 10:124137054-124137076 GACAGTAAATGGATGTAAAATGG - Intergenic
1075906425 10:126085692-126085714 GTCAGTGGATGAATGGATAATGG - Intronic
1076676720 10:132150900-132150922 ATGGATAAATGGATGGATTAAGG - Intronic
1077248986 11:1552313-1552335 GTGGGTAGATGGGTGGATGAGGG - Intergenic
1077312117 11:1893525-1893547 ATGAGTGGATGGATGGATGAAGG + Intergenic
1077797413 11:5507248-5507270 ATGAGAAAAAGGATGGATATGGG - Intronic
1078548661 11:12264801-12264823 CTGAATAAATGAATGCATAAAGG - Intergenic
1079378549 11:19916557-19916579 GTGAGTGAATGCATGCATAAGGG - Intronic
1079440422 11:20508491-20508513 GTGAGCAGATGGATGGATGATGG + Exonic
1079638904 11:22779775-22779797 GTTAGAAAATGGATAGAGAAAGG - Intronic
1079748611 11:24165325-24165347 GTGAATAAATGTTTGGAAAAGGG - Intergenic
1081287183 11:41285246-41285268 ATGAATGAATGGATGGATGATGG - Intronic
1081632322 11:44698051-44698073 GTGAGTGAATGAATGGATACAGG - Intergenic
1081738333 11:45420746-45420768 GTGAGTGAATGGATGGATAGTGG - Intergenic
1082130712 11:48485827-48485849 GTGAGGAAAAGGATGGAAAAGGG - Intergenic
1083231906 11:61327017-61327039 GTCAGTATAGTGATGGATAAGGG - Intronic
1083317424 11:61825202-61825224 TTGAGCAAATGAATAGATAATGG - Intronic
1084036703 11:66515709-66515731 CTGAGTGACTGGATGGACAAAGG - Exonic
1084413445 11:69016884-69016906 GTGGGTGGATGGATGGATGATGG - Intergenic
1084576524 11:69992156-69992178 GTGGGTAGATGAATGGATGATGG + Intergenic
1084616811 11:70241907-70241929 GTGGGTAAGTGGATGGATGGAGG - Intergenic
1084658780 11:70535181-70535203 GTGAGCAGATGGATGGAAAATGG - Intronic
1084705318 11:70812990-70813012 GTGAATGAATGAATGGAGAAAGG - Intronic
1084781886 11:71415141-71415163 ATGGGTGAATGGATGGATGATGG + Intergenic
1084785637 11:71440319-71440341 ATGGGTAAATGGATGGATGACGG + Intronic
1084785710 11:71440584-71440606 GAGGGTAGATGGATGGATGATGG + Intronic
1085361346 11:75890488-75890510 TGAAGTAACTGGATGGATAAAGG + Intronic
1085690327 11:78658997-78659019 GTGGGTGGATGGATGGATGAAGG - Intronic
1085750852 11:79160069-79160091 GTGAGTGAGTGCATGGAGAAGGG - Intronic
1085752340 11:79172428-79172450 TTGAGTAACTGAATGGATAGGGG - Intronic
1086087806 11:82972515-82972537 GTGAATAAATGGATGGGTGAAGG + Intergenic
1086377297 11:86214491-86214513 GTGCGAAAGTAGATGGATAAGGG + Intergenic
1086775205 11:90822451-90822473 GTAGTTAAATGGATGGAGAATGG - Intergenic
1086934499 11:92729771-92729793 GTTAGTGAATGGAAGGATCAGGG + Intronic
1088168836 11:106971517-106971539 TTCAGTAAATGGATGGCTAAAGG + Intronic
1088929437 11:114335592-114335614 GAAAGTAAATGGATGGAGAAAGG + Intergenic
1089719064 11:120395322-120395344 GTAAGTAAATGGATGGTAAATGG + Intronic
1090140976 11:124261177-124261199 GTGGATGGATGGATGGATAAAGG - Intergenic
1090237171 11:125157951-125157973 GTGAATAAATGAATGGATGAGGG + Intergenic
1090675174 11:128985678-128985700 ATGAATGAATGGATGGACAAAGG - Intronic
1091187346 11:133658421-133658443 GTGGGTGGATGGATGGATGATGG + Intergenic
1091767894 12:3133786-3133808 CTGTGAAAATGGATGGATGACGG + Intronic
1092602188 12:10079273-10079295 GTGGATGGATGGATGGATAATGG + Intronic
1092841354 12:12544972-12544994 TGGAATAAATGAATGGATAATGG - Intronic
1094394198 12:29987876-29987898 GAAAGTAAAATGATGGATAAGGG + Intergenic
1096536760 12:52279827-52279849 GTGAATGGATGGATGGAGAATGG - Intronic
1097334815 12:58370272-58370294 GTGAGTAAGGGGATGGAGACAGG + Intergenic
1097757416 12:63422221-63422243 TTGAATAAATGAATGGATTAGGG - Intergenic
1099587794 12:84543835-84543857 GAAAGTAAAGGGATGGAAAAAGG - Intergenic
1099767454 12:87006282-87006304 CAGAGTAAAGGGATGGAGAAAGG - Intergenic
1100705530 12:97196469-97196491 ATGAGTAAATGGATGAACTAAGG - Intergenic
1100774695 12:97961307-97961329 TTAAGTAAATGCATGCATAAGGG + Intergenic
1101011700 12:100457430-100457452 GTGAATTAATGGATGAATTAGGG + Intergenic
1101201302 12:102439193-102439215 ATGAATAAATGAATGGAGAAGGG + Intronic
1101322013 12:103680862-103680884 ATGAGCAAATGAATAGATAAGGG - Intronic
1102043146 12:109813689-109813711 ATGAATAGATGGATGGATGATGG + Intronic
1102504242 12:113373827-113373849 ATGGGTAGATGGATGGATGATGG - Intronic
1102506993 12:113390014-113390036 GTGGGTAAGTGGATGGAAAATGG - Exonic
1103184864 12:118947995-118948017 GTGAATAGATGGGTGGATGAGGG - Intergenic
1103371453 12:120422659-120422681 ATGAATAAATGAATGAATAAAGG + Intergenic
1104764004 12:131314829-131314851 GTGGGTGAATGAAAGGATAATGG - Intergenic
1104779334 12:131409819-131409841 GTGAATGGATGGATGGATGATGG - Intergenic
1104896304 12:132166644-132166666 GTGGGTGGATGGATGGATGATGG - Intergenic
1104896313 12:132166671-132166693 ATGGGTGAATGGATGGATGATGG - Intergenic
1104896439 12:132167148-132167170 GTGGATGAATGGATGGATAAGGG - Intergenic
1104906696 12:132217350-132217372 GTAGGTAGATGGATGGATAAAGG - Intronic
1104906762 12:132217662-132217684 GTAGGTAGATGGATGGATAAAGG - Intronic
1104906799 12:132217843-132217865 GTAGGTAGATGGATGGATAAAGG - Intronic
1105279828 13:18956988-18957010 ATGGGTAGATGGATGGATCATGG - Intergenic
1106688146 13:32084219-32084241 GTGAATAAAAGGAAGAATAAGGG + Intronic
1107160568 13:37222361-37222383 GAAAGTAAATGGATGGGGAAAGG - Intergenic
1107219722 13:37967940-37967962 TTAAGTAAATGGCTGGTTAATGG - Intergenic
1107409283 13:40143556-40143578 GTGAGAAAAAGGAGGGAGAACGG + Intergenic
1108165693 13:47690622-47690644 TTGTCAAAATGGATGGATAATGG + Intergenic
1108545394 13:51488407-51488429 ATGAGTAATTGGATGGATTATGG - Intergenic
1108762068 13:53580079-53580101 GTGAGTAAATGAATGAATGGTGG - Intergenic
1109076312 13:57840623-57840645 GTAACTGAATGGATGGATGATGG + Intergenic
1109439855 13:62355311-62355333 GGGAGGGAATGGATGGAGAAAGG + Intergenic
1110752517 13:79131803-79131825 TTGAATGAATGGATGGATGAAGG - Intergenic
1110897709 13:80776143-80776165 GTGTTTAAATGAATGGAGAATGG - Intergenic
1113901059 13:113798357-113798379 ATGAATAGAAGGATGGATAATGG + Intronic
1114660247 14:24339187-24339209 GTGACTAAATTCATGGAGAACGG - Exonic
1115428948 14:33293871-33293893 GTCAGTAATTGGATGGCTCAGGG + Intronic
1116116227 14:40654467-40654489 ATAGGTAAATGGATGGAGAATGG + Intergenic
1116281993 14:42920172-42920194 GTAAGTAAGTGAATGGATAAAGG - Intergenic
1117940670 14:60960743-60960765 GTGAGTGAGTGGGTGGATATGGG - Intronic
1118005767 14:61563182-61563204 GTGAGTACATGGAGGAATCAAGG + Intronic
1119279810 14:73396256-73396278 ATGGGTAGATGGATGGATAGAGG - Intronic
1119790867 14:77348655-77348677 TTGAGTAAATGACTGGAAAATGG + Intronic
1120019537 14:79512769-79512791 TGGAGTAAATGGAGGTATAATGG - Intronic
1120471073 14:84925273-84925295 ATGAGTTAATGCATGGATGAAGG + Intergenic
1121099732 14:91242289-91242311 ATGAGTAAATGGAGGGATAGGGG + Intronic
1121177093 14:91898756-91898778 GTGAGCAAGTGAATGAATAAAGG - Intronic
1121238263 14:92409243-92409265 TTGAGCAACTGGATGGAGAATGG + Intronic
1121264727 14:92593457-92593479 AACAGTAAATGGATGGAGAAAGG + Intronic
1121277550 14:92678363-92678385 GTGAATAAGTGGATGGGTAGGGG - Intronic
1121398231 14:93646953-93646975 GTGAATGAATGAATGAATAAAGG - Intronic
1121443104 14:93961377-93961399 ATGAGTGAATGGGTGAATAAAGG - Intronic
1121449357 14:93997612-93997634 GTGAATAAATGCATGGATGGGGG + Intergenic
1121627191 14:95394520-95394542 TTGAATATATGGATGGATGATGG + Intergenic
1121967278 14:98322136-98322158 GAGAGGAAATGGAAGGAAAAGGG - Intergenic
1122011545 14:98753116-98753138 GTGAGTGGATGGATGGATGGAGG + Intergenic
1122879821 14:104685739-104685761 ATGGGCAGATGGATGGATAAGGG + Intergenic
1122879963 14:104686263-104686285 ATGGGCAGATGGATGGATAAGGG + Intergenic
1123058869 14:105585504-105585526 GTGGGTAAATGGCTGGATGGAGG - Intergenic
1123083199 14:105705750-105705772 GTGGGTAAATGGCTGGATGGAGG - Intergenic
1202946466 14_KI270726v1_random:31658-31680 ATTAGTAAATGGTTAGATAAAGG - Intergenic
1124395756 15:29300133-29300155 GTGAGTAAATGGATGGATAATGG + Intronic
1124684999 15:31775073-31775095 GTGTGTAAATGCATGGACATGGG - Intronic
1126103248 15:45132179-45132201 TTGAAGAAATAGATGGATAATGG + Intronic
1128182827 15:65619933-65619955 GAGAGCAAATGGATGGAGAATGG - Intronic
1129187910 15:73921748-73921770 GTGAGTGAGTGGATGAATGAAGG + Intergenic
1129604991 15:77020525-77020547 GTGACTAAATGGATGGAGGATGG - Intronic
1130353625 15:83111358-83111380 GTGAATAGATGGATGGATGATGG - Intronic
1130456696 15:84117486-84117508 GTAAGTAAATGAGTGAATAATGG + Intergenic
1130565395 15:84989947-84989969 ATGGGTTGATGGATGGATAAAGG - Intronic
1131223920 15:90608144-90608166 GTGAGTAAGGGGATGGAGAGAGG + Intronic
1132054495 15:98639079-98639101 ATGAGTAAATGGATGGCAGATGG + Intergenic
1132083113 15:98884239-98884261 GTCAGCAGATGGATGGAGAAGGG - Intronic
1132358493 15:101191874-101191896 GTGAGTAGATAGATGGATGAAGG - Intronic
1132653816 16:1033321-1033343 ATGAGTGGATGGATGGATGATGG - Intergenic
1133204868 16:4227230-4227252 GTGGGTGGATGGATGGATGAAGG + Intronic
1133500846 16:6365224-6365246 ATGGGTAGATGGATGGATAGAGG + Intronic
1133554397 16:6891096-6891118 ATGAATGAATGGATGGATATTGG - Intronic
1133614032 16:7459074-7459096 GTGAGTGGATGGATGGATGATGG + Intronic
1133614041 16:7459126-7459148 GTGAGTGGATGGATGAATGACGG + Intronic
1134075653 16:11289638-11289660 CTAAGTAAATGGATGGAGGATGG - Intronic
1134105971 16:11486251-11486273 GTGAATAGATGGATGGATGGAGG + Intronic
1134106074 16:11486725-11486747 GTGGGTGGATGAATGGATAATGG + Intronic
1134224861 16:12381841-12381863 GTGGGTGAGTGGATGGATAATGG - Intronic
1134819996 16:17239330-17239352 GTGAGTGGATGGATGGATGATGG - Intronic
1134820024 16:17239468-17239490 GTGGGTGGATGGATGGATGATGG - Intronic
1134846439 16:17444848-17444870 CTGAGGGAATGAATGGATAAAGG + Intronic
1135086494 16:19478794-19478816 ATGGGTAAATGGATGGATGATGG - Intronic
1135528847 16:23235119-23235141 GTCAGTAACAGGATGGAAAATGG - Intergenic
1135614740 16:23901493-23901515 GAGAGTAGATGGATAGATGAGGG + Intronic
1135855854 16:26009433-26009455 GTGAGTTAATGGGTGCATATTGG + Intronic
1136071468 16:27790214-27790236 ATGAATGGATGGATGGATAATGG + Exonic
1136584936 16:31178688-31178710 GTGACTTAATGCATGAATAAGGG + Intergenic
1137238741 16:46637001-46637023 TTGAGAAACTGGATAGATAATGG - Intergenic
1137386065 16:48043799-48043821 GTGGGTCAATGGATGGATAGTGG - Intergenic
1137386165 16:48044316-48044338 GTGGATCAATGGATGGATGATGG - Intergenic
1137397974 16:48130360-48130382 GTGAATAAATGAATGAATAAAGG + Intronic
1137765040 16:50971538-50971560 GTGTATAAATGGATAGGTAATGG - Intergenic
1137977060 16:53040985-53041007 GTGGATGGATGGATGGATAATGG + Intergenic
1138495766 16:57408313-57408335 ATGAGTGAATGGATGGATGGAGG - Intronic
1138800290 16:60018163-60018185 GAGAGTAGATTGATAGATAATGG - Intergenic
1138888900 16:61116469-61116491 CTGACTAATTGAATGGATAAGGG + Intergenic
1139247254 16:65457151-65457173 ATGAATAGATGGATAGATAAAGG - Intergenic
1141031992 16:80597079-80597101 GTGGATAGATGGATGGATGATGG + Intergenic
1141110102 16:81265317-81265339 GTGGGTAGATGGATGGATGGAGG - Intronic
1141110230 16:81265822-81265844 GTGGGTAGATGGATGAATGATGG - Intronic
1141619035 16:85227006-85227028 GTGGGTGAATGGATGGAAAGGGG - Intergenic
1141690913 16:85595785-85595807 GTGGGGGAATGGATGGATAGAGG - Intergenic
1142177862 16:88653146-88653168 GAGAGCAAATGAATGGACAAAGG + Intronic
1143357912 17:6344366-6344388 ATGGGTTAATGGATGGATAGAGG - Intergenic
1144767832 17:17742447-17742469 GTGAATGAATGAATGAATAAAGG + Intronic
1144839492 17:18177018-18177040 GTGGATAGATGGATGGATGAAGG + Intronic
1145374586 17:22335631-22335653 GTGGGGAAATGGAGGGATATGGG + Intergenic
1145894725 17:28448304-28448326 GAAAGTAAAAGGATGGAAAAAGG + Intergenic
1146197411 17:30825013-30825035 ATGAGGAAATTGAGGGATAAAGG + Intergenic
1146311876 17:31775701-31775723 GTAAGTAAATGGAGAGAGAAGGG - Intergenic
1146695873 17:34908854-34908876 GTGAGTGAATAAATGGATGAAGG - Intergenic
1146805545 17:35862332-35862354 CTGAATAAATGGATGAATGATGG + Intronic
1147050838 17:37793769-37793791 GTGAGTAAATTGAGGCACAAAGG + Intergenic
1148692681 17:49540649-49540671 TTCAGTAAATGGATGGTTGATGG - Intergenic
1149420174 17:56502887-56502909 GGGAGTAGGTGGATGGAGAATGG + Intronic
1152034116 17:77861502-77861524 GTGGGTAAATGGGTGGAGATGGG + Intergenic
1152473668 17:80503934-80503956 ATGAATAGATGGGTGGATAAGGG + Intergenic
1152541866 17:80980767-80980789 GTGAGTGAATGAATGAATGAGGG + Intergenic
1153298049 18:3566604-3566626 TTTATTGAATGGATGGATAATGG + Intronic
1153777660 18:8467842-8467864 GGGCGTATATGGATGGATAAGGG - Intergenic
1153836483 18:8968844-8968866 GTGGGTGAATGGATAGAGAAAGG + Intergenic
1153965726 18:10180281-10180303 TTAAGTAAATGGGTGGAAAAGGG - Intergenic
1154307813 18:13243522-13243544 ATGAGTGGATGGATGGATGATGG - Intronic
1154307969 18:13244153-13244175 GTGGATGAATGGATGGATAGAGG - Intronic
1155138419 18:23019700-23019722 GATAGTAAGTGGATGGATATGGG - Intronic
1155302780 18:24447143-24447165 TTGAGTGGATGGATGGATGAAGG + Intronic
1155318621 18:24596561-24596583 ATGAGCAGATGGATGGATAGAGG - Intergenic
1157012305 18:43665415-43665437 ATGAATAAATGGATAAATAATGG + Intergenic
1157487100 18:48095758-48095780 GTGAGAGAATGGATGAATGACGG + Intronic
1157991165 18:52498321-52498343 GTGACTAAAATGATGGATACTGG + Intronic
1158891969 18:61880850-61880872 GTGAGTAAAGAGAAGAATAAGGG - Intronic
1159727754 18:71983593-71983615 TTAAGTAAATGGATAGATGATGG - Intergenic
1160502561 18:79409525-79409547 GTGGATGAATGGATGGATGATGG - Intronic
1160526551 18:79542048-79542070 GTGGGTGGATGGATGGATGAAGG - Intergenic
1160526602 18:79542258-79542280 GTGGGTGGATGGATGGATAAGGG - Intergenic
1160526669 18:79542604-79542626 GTAAATACATGGATGGATAATGG - Intergenic
1160526677 18:79542647-79542669 ATGAGTGGGTGGATGGATAATGG - Intergenic
1160687110 19:442247-442269 GTGGGTGAACGGATGGATGATGG + Intronic
1160960226 19:1717661-1717683 GTGAGTGGATGGATGGACAGAGG + Intergenic
1161018778 19:1997777-1997799 GTGAATAAATGCATGCATATGGG - Intronic
1161105282 19:2440782-2440804 ATGAGTAGATGGATGGATGATGG - Intronic
1161242807 19:3231874-3231896 ATGAATAGATGGATGGATGATGG + Intronic
1161258563 19:3323091-3323113 GTGGATAGATAGATGGATAAAGG + Intergenic
1161287616 19:3477073-3477095 GTGAGTGAATAGATGGGTGATGG + Intronic
1161449198 19:4335151-4335173 ATGAGTAGGTGGATGGATGATGG - Intronic
1161449207 19:4335193-4335215 ATGAGTGGATGGATGGATGATGG - Intronic
1161449213 19:4335220-4335242 ATGAGTAGGTGGATGGATGATGG - Intronic
1161657498 19:5525098-5525120 ATGGGTGAATGGATGGATGATGG - Intergenic
1161768977 19:6221247-6221269 ATGAATGAATGGATGGATGAGGG - Intronic
1163383546 19:16985272-16985294 GTGGATGAATGGATGGATGAAGG + Intronic
1163492641 19:17625802-17625824 GTGGGTAGATGGATGGATGCTGG - Intronic
1163494031 19:17634261-17634283 GTGAGTAAATAAATGGATAGAGG - Intronic
1163609885 19:18295318-18295340 GTGGGTAGATGGATGGATGGTGG - Intergenic
1163609890 19:18295337-18295359 GTGGGTAGATGGATGGATGGTGG - Intergenic
1164889743 19:31813007-31813029 AAGAGTAAAAGGATGGATATAGG + Intergenic
1165190314 19:34057442-34057464 ATGGGTAGATGGATGGATGATGG + Intergenic
1165561500 19:36684250-36684272 GTGAATAAGTGCATGGATATAGG - Intergenic
1166201421 19:41239993-41240015 GTGGGTCAATGGATGAATAGAGG + Intronic
1166291148 19:41864367-41864389 GTGAGTTAAGGGATGAATCAAGG + Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1167144204 19:47672281-47672303 GTAAGTAGATGGATAGATGAAGG + Intronic
1167387540 19:49172697-49172719 GTGAGAAGATGGATGGATGGAGG - Intronic
1167387610 19:49173241-49173263 GTGAGAAGATGGATGGATGGAGG - Intronic
1167387621 19:49173315-49173337 GTGAGAAGATGGATGGATGGAGG - Intronic
1167387634 19:49173390-49173412 ATGGGTAAATGGATGGAAGATGG - Intronic
1167598194 19:50438270-50438292 ATGGGTAGGTGGATGGATAACGG + Intronic
1168330880 19:55567779-55567801 GTGAATGGATGGATGGATGATGG + Intergenic
1168330890 19:55567830-55567852 GTGAATGGATGGATGGATGATGG + Intergenic
1168330961 19:55568266-55568288 ATGAATAGATGGATGGATTATGG + Intergenic
1168330970 19:55568324-55568346 GTGAATGGATGAATGGATAATGG + Intergenic
1168472130 19:56648353-56648375 ATGGGTATATGGATGCATAAGGG - Intronic
925738571 2:6985469-6985491 ATGAGTAAGTGGAAGGATTAGGG + Intronic
925925640 2:8668184-8668206 ATGGGTGAATGGATGGATAAAGG + Intergenic
925932154 2:8717007-8717029 GCAATTAAATGGATGGATAAAGG - Intergenic
926302788 2:11616512-11616534 ATGAGTAAATGGATGGGGAGAGG + Intronic
926676365 2:15625541-15625563 ATGAGTTGATGGATGGATACAGG + Intronic
926824084 2:16884827-16884849 GAGAGTAAAAGGAAGAATAAAGG - Intergenic
926896700 2:17698574-17698596 GAAAGTAAAAGGATGGAAAATGG - Intronic
927088497 2:19692942-19692964 TTGAGTAAATGGATGGCAGATGG - Intergenic
927315760 2:21679791-21679813 GAAAGTAAAAGGATGGAAAAAGG + Intergenic
927521690 2:23702909-23702931 GTGAGCAAAGGGATGGAGACAGG + Intronic
927848894 2:26486446-26486468 GTGAGTGGATGGATGGATACAGG + Intronic
928377199 2:30785121-30785143 ATGAGTGAATGGATGAATGAAGG - Intronic
929154701 2:38778991-38779013 ATGAGTGAATGGATGAAGAAAGG + Exonic
929866220 2:45719541-45719563 CTGAGTGACTGGATGGATAGTGG + Intronic
929926695 2:46218197-46218219 ATGGATAAATGGATGAATAATGG - Intergenic
930376122 2:50569110-50569132 GAGACTAAAAGGATGGATACCGG + Intronic
931856049 2:66302727-66302749 ATGAGTAAACAGATGAATAAAGG - Intergenic
931998851 2:67865076-67865098 GTGGCTAGATGGATGGATAAAGG + Intergenic
935529050 2:104210524-104210546 ATAAATAAATGAATGGATAAAGG - Intergenic
935623389 2:105147751-105147773 CTTACAAAATGGATGGATAATGG + Intergenic
935799884 2:106685052-106685074 GAAAGTAAAAGGATGGAAAATGG - Intergenic
936692658 2:114911316-114911338 ATGAGTAAATGGATTCATTAGGG - Intronic
936972984 2:118192456-118192478 GTGGGGCTATGGATGGATAAAGG + Intergenic
937167322 2:119832823-119832845 GTGCGTAAAAGAATGTATAAAGG - Intronic
937354403 2:121188910-121188932 ATGAGTGAATGGATAGATGAAGG + Intergenic
937536590 2:122896281-122896303 GAGAGTATAGGGATTGATAATGG + Intergenic
937779280 2:125818956-125818978 GTTATTAAATGGATAGATGAAGG - Intergenic
938063864 2:128270729-128270751 GTGACCAAATGGATGGAGACAGG + Intronic
938108082 2:128546855-128546877 ATGAATGAATGGGTGGATAATGG - Intergenic
938108099 2:128546922-128546944 GTGGGTGGATGGATGGATAGAGG - Intergenic
938704366 2:133909016-133909038 GAAAGTAAAAGGATGGAAAATGG + Intergenic
938981009 2:136527218-136527240 GTAACTATATGGATGTATAAAGG - Intergenic
939332379 2:140781119-140781141 GTCAGTAAATAAATGGGTAAAGG + Intronic
939499881 2:142970583-142970605 GTAGGTAAATTGATGAATAAAGG + Intronic
940130056 2:150370573-150370595 GTGGGAAAATGGATAGAGAAAGG + Intergenic
941298183 2:163767003-163767025 GTGAATAATTGGATAGAGAAAGG - Intergenic
941466149 2:165829549-165829571 TTGGGTATATGGATGGATACAGG + Intergenic
941965158 2:171293352-171293374 GTGAGTAGATGAATGAATATGGG + Intergenic
943082918 2:183278066-183278088 GTGAATGAATGGATGGATGGAGG - Intergenic
943976463 2:194484722-194484744 CTGAGAAAATGGAAGGAAAAAGG - Intergenic
944661485 2:201925126-201925148 ATGAGGAAATGGAGGGATAGAGG - Intergenic
946187210 2:217987874-217987896 GTGGGTGAATGGATGGATGAGGG + Intronic
946259192 2:218471647-218471669 CTGAGCAATTGGATAGATAATGG - Intronic
948340979 2:237251468-237251490 TTAAGTAAATGGATGGCAAATGG + Intergenic
948911486 2:241006491-241006513 GTGAGTAAATAGATTGAGAATGG + Intronic
949065795 2:241989759-241989781 GTGGATGGATGGATGGATAATGG - Intergenic
1169012429 20:2261544-2261566 ATGAAATAATGGATGGATAAGGG - Intergenic
1169573587 20:6932732-6932754 TTGAGGAAAAGGATAGATAAAGG + Intergenic
1169649307 20:7849248-7849270 ATGAGTGAAAGGATGGAAAAAGG + Intergenic
1170015656 20:11778912-11778934 GAGAGGAAATGGATGGTTAAAGG + Intergenic
1171113966 20:22508588-22508610 GTGAGTGAATGGAAGCATGAAGG - Intergenic
1171227085 20:23451028-23451050 ATGGGTAAATGGATGGATGGGGG - Intronic
1173974756 20:47178821-47178843 GTGGGTGGATGGATGGATATTGG + Intronic
1174279726 20:49430471-49430493 ATGAGTGGATGGATGGATGATGG - Intronic
1174289243 20:49496013-49496035 CTGAGTATATAGATGGATGAGGG - Intergenic
1175165266 20:57039088-57039110 ATGAATAAATGGATGGATAATGG + Intergenic
1175544177 20:59767475-59767497 GTGAATAAATAGATAGATGATGG - Intronic
1175676463 20:60950341-60950363 ATGAATAAATGTGTGGATAAGGG + Intergenic
1175779195 20:61671645-61671667 ATGGGTGAATGGATGGATAATGG + Intronic
1175817230 20:61889585-61889607 GTTAGTGGATGGATGGATGATGG + Intronic
1175817295 20:61889940-61889962 GTGAGTGGATGGTTGGATGATGG + Intronic
1175817396 20:61890471-61890493 GTGAGTGGATGGATGGATGATGG + Intronic
1176047158 20:63098773-63098795 GTGAATGCATGGATGGATCATGG + Intergenic
1176047190 20:63099015-63099037 GTGAATGCATGGATGGATCATGG + Intergenic
1179474765 21:41636110-41636132 GTGGATGAATGGATGGATGATGG - Intergenic
1179549152 21:42132383-42132405 ATGAGTGGATGGATGGATGATGG - Intronic
1181529717 22:23510489-23510511 GTGAGTGAATGAATGAATGATGG - Intergenic
1182039081 22:27222380-27222402 ATGGGTGAATGGATGGATGATGG + Intergenic
1182060684 22:27394997-27395019 GTGGGTGAATGGATAGATAATGG + Intergenic
1183082125 22:35463338-35463360 GTGGGTAGATGGATGGATGGTGG - Intergenic
1183270000 22:36855953-36855975 GTGAATAAATGAATGAATGAGGG + Intergenic
1183303966 22:37072144-37072166 ATGGGTGAATGGATGGATGATGG + Intronic
1183744076 22:39683533-39683555 GTAAATAAATGGTTGGCTAAAGG - Intronic
1184262019 22:43323322-43323344 GTGAGTAGATGGATGGATAGTGG - Intronic
1184434281 22:44460604-44460626 GTGGGTAGATGGATGGATGAGGG - Intergenic
1184460774 22:44636701-44636723 GTGGGTGGATGGATGGATGATGG + Intergenic
1184653345 22:45929349-45929371 GTGAATAGATGGATGGATAAAGG - Intronic
1184731222 22:46372173-46372195 GTGAGTAGATGGATGGGTGAGGG - Intronic
1184731229 22:46372201-46372223 GTGAGTAGATGGATGGTTGGAGG - Intronic
1184731288 22:46372436-46372458 GTGAGTGGATGGATGGATGGGGG - Intronic
1184731304 22:46372486-46372508 GTGAGTGGATGGATGGATGGGGG - Intronic
1185059326 22:48597852-48597874 GGGAGTTAAGGGATGGAGAAGGG + Intronic
1185103657 22:48855167-48855189 GTGAATGCATGGATGGATGATGG - Intergenic
1185187574 22:49411456-49411478 GTGAGCACATGGAGGGACAATGG - Intergenic
1185193336 22:49452606-49452628 ATGTGTGAATGGATGGATGATGG + Intronic
949845357 3:8364686-8364708 ATGAATGAATGGATGGATGAAGG - Intergenic
950321882 3:12063484-12063506 TTAAGTAAATGGATGGAAGATGG + Intronic
950526920 3:13529589-13529611 TTGAATAAATAAATGGATAAAGG - Intergenic
950573508 3:13816770-13816792 ATGGGTAGATGGATGGATGAAGG - Exonic
951707701 3:25559806-25559828 GTGGATCAATGGATGGAAAATGG + Intronic
952200582 3:31123038-31123060 ATGAGTAAATACATGAATAAAGG - Intergenic
952307669 3:32160308-32160330 ATGGGTGAATGGATGGATGATGG + Intronic
952307703 3:32160427-32160449 ATGGGTGAATGGATGGATGATGG + Intronic
952307733 3:32160533-32160555 ATGGGTGAATGGATGGATGATGG + Intronic
952655411 3:35779823-35779845 GTGAGAAAAGGGAGGGAAAAAGG - Intronic
953715380 3:45312938-45312960 ATGAATATATGAATGGATAATGG + Intergenic
953772922 3:45792609-45792631 GTCAGTCCATGGATGGATCAGGG - Intronic
954833966 3:53448424-53448446 GTCAGAAAATGGATAGAGAAAGG - Intergenic
955026154 3:55169609-55169631 GTGAGTGAATGGATGGATGAAGG - Intergenic
957418581 3:79938185-79938207 CTGAGTAAATGGATGAGTACAGG - Intergenic
957859533 3:85927232-85927254 TTGAGTAAATAAATGAATAATGG - Intronic
957941193 3:87006403-87006425 GTGTGTAATTGGCTGGGTAAAGG + Intergenic
958811505 3:98865220-98865242 ATCAGTAGATGAATGGATAAAGG + Intronic
959019202 3:101169790-101169812 GACAGTAAATGGAAGGAGAATGG - Intergenic
959153060 3:102630586-102630608 GTGATAAAATGGATGTATATAGG + Intergenic
959386662 3:105717353-105717375 GTTATTGAATGGATGGATAATGG - Intronic
959790721 3:110357970-110357992 GTAAATAAATGGATATATAAGGG + Intergenic
961554260 3:127687308-127687330 GTGAGAGAATGGATGAATGAGGG - Intergenic
961554308 3:127687796-127687818 GTGAGAAAATGAATGCATGATGG - Intergenic
962018532 3:131470804-131470826 ATAAGTAAATGTATTGATAATGG - Intronic
962952552 3:140232735-140232757 CTGAGTAACTGGGTGGATATTGG - Intronic
963278284 3:143355108-143355130 TTGAGTAAATGGATGGAGCTGGG - Intronic
964136754 3:153352962-153352984 GAGAATAAAAGGTTGGATAAGGG + Intergenic
964804316 3:160590235-160590257 GAAAATAAATGGATGGAAAAAGG + Intergenic
965260452 3:166477476-166477498 AAGAGTAAAAGGATGAATAAAGG - Intergenic
965356563 3:167681487-167681509 ATGAATGAATGGATGGATCAGGG + Intergenic
965624281 3:170671576-170671598 GTGAATAAATGAATGGACTAAGG + Intronic
965680440 3:171245731-171245753 GTGAGTAAATTCTTGGACAAAGG - Intronic
966010207 3:175065979-175066001 ATGAGTGAAAGGATGTATAACGG + Intronic
966945632 3:184775361-184775383 GTGAGGAAATGGCTAGAGAAAGG - Intergenic
967038259 3:185664496-185664518 GTGAATTAATGGAGGGAGAAGGG + Intronic
967223777 3:187272090-187272112 GGGTGTAAGTGGATGGCTAAGGG + Intronic
967855813 3:194116706-194116728 ATGAGTGAATGAATGCATAAAGG + Intergenic
969088575 4:4675208-4675230 GTGAGCAAGTGGGTGGGTAATGG - Intergenic
969424921 4:7118550-7118572 ATGAGTGGATGGATGGATGATGG + Intergenic
969424962 4:7118741-7118763 ATGAGTGGATGGATGGATGATGG + Intergenic
969501608 4:7556808-7556830 ATGGGTAGATGGATGGATGATGG - Intronic
969510293 4:7613866-7613888 GTGAATGAATGGATGGTGAATGG - Intronic
969510410 4:7614441-7614463 ATGGGTGAATGGATGGATTATGG - Intronic
969534623 4:7748143-7748165 GTGAGAAAATGGATAGACCAAGG + Intergenic
969602430 4:8184290-8184312 TTAAGTCAATGGATGGCTAATGG - Intronic
969612280 4:8234121-8234143 ATGGATAAATGGATGGATGATGG - Intronic
969612300 4:8234220-8234242 ATGGGTGAATGGATGGATGATGG - Intronic
969624393 4:8294959-8294981 ATGGGTAAATGGATGGATGATGG - Intronic
970134894 4:12911868-12911890 GTGAGTAAATGGAGGCATAGAGG - Intergenic
970851685 4:20611407-20611429 CTAAGTAAATGGATACATAAAGG + Intronic
971575279 4:28264893-28264915 GAAATTAAATGGATGGATAGGGG + Intergenic
971811726 4:31436551-31436573 ATAATTAAATGGATGGAAAATGG + Intergenic
971819632 4:31534553-31534575 ATCAGTAAATGGATGGTAAATGG - Intergenic
972345869 4:38191856-38191878 GTGAGGAAGTGGATAGAAAATGG - Intergenic
972453984 4:39233885-39233907 TTGAGGTAATGGATTGATAATGG + Intronic
973220202 4:47717482-47717504 GTAAGAAAAAGGATGGATGAAGG - Intronic
973965455 4:56157451-56157473 ATGAGTGAATGAATGGATGAGGG + Intergenic
974479484 4:62424576-62424598 TTGAGTTAATGGATGGAGAGAGG - Intergenic
975124590 4:70767442-70767464 TTCAGTAAATGAATGGACAATGG - Intronic
975401339 4:73943294-73943316 GTGAATAATTAGATGGATCAGGG - Intergenic
975675958 4:76828088-76828110 GTGAAACCATGGATGGATAAGGG - Intergenic
976098022 4:81529287-81529309 TTGTGTAAGTGGATGGATGATGG + Intronic
976261303 4:83147567-83147589 GTTAGTAAATGGAAGGCTAATGG - Intergenic
976391754 4:84512809-84512831 CTGAGAAATTGGATGGATAATGG + Intergenic
976625181 4:87172579-87172601 TTAAGCAACTGGATGGATAATGG - Intronic
977164167 4:93674913-93674935 ATAAGTAAATGGATGGAAGAGGG + Intronic
978110850 4:104962567-104962589 GCGAGTAAATGGACGGGAAAAGG - Intergenic
979323797 4:119355159-119355181 GTGAATAAATGCATGGAAAATGG - Intergenic
979354023 4:119681262-119681284 GTGATTAAATTGATAGTTAAGGG + Intergenic
979698842 4:123644089-123644111 GTGAATGAATGGATGGGTGATGG - Intergenic
980245695 4:130238093-130238115 TTGAATGAATGCATGGATAAAGG + Intergenic
980439949 4:132829361-132829383 CTGAGCAACTGGAAGGATAAAGG - Intergenic
980875586 4:138659084-138659106 GAGAGTTTCTGGATGGATAAAGG - Intergenic
981873288 4:149511919-149511941 TTGAATAAATGAATGAATAAAGG - Intergenic
983004110 4:162461322-162461344 GTGAGTAGAAAGATGGAAAAGGG + Intergenic
983622127 4:169772920-169772942 CTGAATGAATGGATGGATGAAGG - Intergenic
984400527 4:179257947-179257969 GAAACAAAATGGATGGATAATGG - Intergenic
985246419 4:187983874-187983896 GGGAGTAAATGGACTGAAAATGG + Intergenic
985887378 5:2690018-2690040 GTGTGTAAATGCATGAATCAAGG + Intergenic
987483389 5:18490348-18490370 CTGAGTGGATGGATGCATAAAGG - Intergenic
989063118 5:37430418-37430440 GAGGGTAAATGGCTGAATAATGG + Intronic
989295842 5:39825642-39825664 AAGAGTAAGTGGAAGGATAAAGG + Intergenic
989331238 5:40261403-40261425 GTGACAAAATGGATGAATAATGG + Intergenic
989829685 5:45900111-45900133 GTTAGGGAATGGATGGATGATGG - Intergenic
991060326 5:62368068-62368090 GTGATTAATTAAATGGATAATGG + Intronic
992569043 5:78033865-78033887 GTTTGTAAATGGATGTAAAAAGG + Intronic
993382891 5:87228206-87228228 TTTAGAAAATGGATGAATAAGGG + Intergenic
995532485 5:113105552-113105574 CTGAGTAACTGGGTGGATAGGGG - Intronic
995636669 5:114201251-114201273 GTGGGTTAGTGGAGGGATAAAGG - Intergenic
995800522 5:115989001-115989023 GTGAGTGGATGGATGGATGTAGG - Intronic
995978258 5:118069304-118069326 GTGAGAAAAAGGGTGGAAAAAGG + Intergenic
996876286 5:128243718-128243740 GTGAGTAAGTAGATGGATGATGG + Intergenic
999085651 5:148886744-148886766 GTGATAAAATGGATGGATTAGGG + Intergenic
999580340 5:153031439-153031461 GTGAATAAAGGGATGGAGATAGG - Intergenic
999658664 5:153835446-153835468 CTGAGTTGTTGGATGGATAATGG - Intergenic
1000645113 5:163751931-163751953 GTCAGTGGATGAATGGATAAAGG - Intergenic
1000932867 5:167272937-167272959 GTGTGTAAATGGATGCAATAAGG - Intergenic
1001724745 5:173887736-173887758 GTGAGCGAATGGAAGGTTAAGGG + Intergenic
1001735432 5:173994642-173994664 CTGGGCAACTGGATGGATAATGG + Intronic
1001751445 5:174134588-174134610 ATGGGTGAATGGATGGATGATGG - Intronic
1002010020 5:176271591-176271613 GGGAGAGAATGGATGGTTAATGG + Intronic
1002067664 5:176660209-176660231 ATGAGTGAATGGATGGAGGAAGG - Intergenic
1002216714 5:177640713-177640735 GGGAGAGAATGGATGGTTAATGG - Intergenic
1002472294 5:179442768-179442790 GTGGGTGAATGAATGGATGAAGG + Intergenic
1002472321 5:179442930-179442952 GTGGGTGAATGAATGGATGAAGG + Intergenic
1003130653 6:3392715-3392737 TTGAGCAACTGCATGGATAATGG + Intronic
1003520586 6:6855434-6855456 TTGAATGAATGGATGGAAAATGG - Intergenic
1005057082 6:21739645-21739667 GTGGGTCAAAGGATGGAAAAGGG + Intergenic
1005939744 6:30552164-30552186 CTGAGTAAAAGAATGGATGACGG - Intronic
1006937127 6:37726265-37726287 GAGAGTAAATGGATGGTATATGG - Intergenic
1007041527 6:38726759-38726781 GTGAGTAAAGAGATGGAACAAGG + Intronic
1007656460 6:43454111-43454133 ATGAGGAAATGGAAAGATAAAGG - Intronic
1007777259 6:44230666-44230688 GTGAGTAAATGGAGGGAGCTGGG + Intronic
1008097471 6:47353785-47353807 GTGAATAAAGGTATGGATGATGG - Intergenic
1008216515 6:48796611-48796633 ATGAGTATAAGGATGGATGAGGG - Intergenic
1008464725 6:51817677-51817699 GTGAGTGAATGAATGGATGGAGG - Intronic
1008483883 6:52014618-52014640 CTGGATAAATGGATGGATCATGG + Intronic
1008923095 6:56863205-56863227 ATGAGGAAAAGGATGAATAAAGG - Intronic
1009692312 6:67051613-67051635 ATCAGTAAATGGATGTATAAAGG - Intergenic
1010230832 6:73533641-73533663 ATGAATAATTGAATGGATAAAGG + Intergenic
1011425468 6:87224077-87224099 TTAAGTAAATGGATGGCCAATGG - Intronic
1011907978 6:92396364-92396386 GTAAGTAAATGGATGGAAGATGG - Intergenic
1012255315 6:97024684-97024706 TATAGTGAATGGATGGATAATGG + Intronic
1012311083 6:97724657-97724679 GTGAGTATATGGAGAGAAAACGG + Intergenic
1012545191 6:100411637-100411659 GTGAGTAAATACATGGATGCTGG + Intronic
1014078924 6:117266639-117266661 CTGAGGAAATGGAAGGAAAATGG - Intronic
1014162583 6:118186977-118186999 ATGAGTAATTGGATTGATATGGG - Intronic
1014398325 6:120954245-120954267 GAGATTAAATGGGTGGATAAAGG - Intergenic
1014435584 6:121417308-121417330 ATAAGTAAATAGATGGAAAATGG + Intergenic
1014982582 6:127962581-127962603 GAGAGTAAAGGGAAGGAAAATGG - Intergenic
1015141544 6:129939856-129939878 ATGAATGAATGGATGGATGATGG - Intergenic
1015185986 6:130416474-130416496 TTGAGCAATTGGATGGATGATGG - Intronic
1015401736 6:132795461-132795483 GGGATTAAATGGATAAATAAGGG + Intronic
1015902540 6:138082732-138082754 GTGAGGAAATTGATTGATATAGG - Intergenic
1016070008 6:139727304-139727326 GTGAGAAAATTGATGGTGAAAGG - Intergenic
1016121671 6:140350315-140350337 GTGAATAAATGCATGAATGAAGG - Intergenic
1017237807 6:152135601-152135623 GTGAATAAATGAATGAATGAAGG - Intronic
1017591061 6:155978431-155978453 CTGAGTAGATGGATGGATGTTGG + Intergenic
1017659036 6:156656056-156656078 ATGAATGAATGGATGGATGAGGG - Intergenic
1017821766 6:158054062-158054084 ATGGCTGAATGGATGGATAATGG - Intronic
1017977833 6:159373765-159373787 GTGAGTAACTGGATGATTTAAGG - Intergenic
1018561239 6:165102759-165102781 GTGTGTAGATGGATGGAACATGG - Intergenic
1018674205 6:166205188-166205210 GTGAGGAAGAGGATGGGTAACGG - Intergenic
1018706458 6:166467237-166467259 GTGAGTGAATGGATGAGTGAGGG - Intronic
1018832455 6:167454313-167454335 ATGAGTAAATGAGTGGATGAGGG - Intergenic
1019103323 6:169649712-169649734 ATGAGTGAATGGATGGGTGATGG - Intronic
1019369893 7:656509-656531 ATGACTAAATGTATGGATAAGGG + Intronic
1019555845 7:1630942-1630964 GTGGGTGAATGGGTGGATGATGG - Intergenic
1019555878 7:1631070-1631092 GTGGGTAGATGGGTGGATGATGG - Intergenic
1019567252 7:1690425-1690447 ATGGGTGAATGGATGGATGAAGG + Intronic
1019567286 7:1690608-1690630 ATGGATAAATGGATGGATGAAGG + Intronic
1019567328 7:1690785-1690807 ATGGGTGAATGGATGGATGAAGG + Intronic
1019760182 7:2805538-2805560 GTGAGTATCTGGAGAGATAAGGG + Intronic
1020365839 7:7379665-7379687 ATGAATAAATGAATGGAGAAAGG + Intronic
1021414176 7:20362866-20362888 GTTAGTGGATGGAGGGATAAAGG + Intronic
1021447570 7:20749538-20749560 GTGACTAAATGCATGGATGTTGG - Intronic
1022500372 7:30878803-30878825 TTGAGTAAATGGGTGGATGGTGG - Intronic
1022983400 7:35625862-35625884 GAAAGTAAAAGGATGGAAAAAGG - Intergenic
1024260188 7:47568529-47568551 GTGAGTGAATGAATGAATAAAGG + Intronic
1026203561 7:68235896-68235918 ATGAATGAATGGATGGATGAAGG + Intergenic
1026205025 7:68249411-68249433 GTGAGTTAATGAATGAATGATGG + Intergenic
1026275176 7:68870158-68870180 GTGAGTAGATAGATGGGTAGAGG + Intergenic
1026275413 7:68871851-68871873 GTGAGTAGATAGATGGATGGAGG - Intergenic
1026326795 7:69317569-69317591 GGAAATAAAGGGATGGATAAAGG + Intergenic
1026771569 7:73204251-73204273 GGGAGTAAACAGAAGGATAAGGG + Intergenic
1027012435 7:74757647-74757669 GGGAGTAAACAGAAGGATAAGGG + Intronic
1027075605 7:75188406-75188428 GGGAGTAAACAGAAGGATAAGGG - Intergenic
1028872596 7:95785513-95785535 CTGAGTGAATGAATGAATAAAGG - Intronic
1029469300 7:100744053-100744075 GGGAGGAAATGGATTGAGAAAGG - Intronic
1034883634 7:154780991-154781013 ATGAGTGAATGGATGGATGATGG + Intronic
1035278964 7:157765505-157765527 GTGGGTGAATGGATGGAGGAAGG - Intronic
1035279030 7:157765788-157765810 GTGAGTGAATGGATGGAGGAAGG - Intronic
1035288524 7:157821985-157822007 ATGAGTAGATGGATGGATGATGG - Intronic
1035288533 7:157822039-157822061 ATGAGTGAATGGATGGTTATTGG - Intronic
1035288549 7:157822173-157822195 ATGAGTATTTGGATGGATGATGG - Intronic
1035288554 7:157822215-157822237 ATGAGTGTATAGATGGATAATGG - Intronic
1035318613 7:158013917-158013939 GTGATTGGATGGATGGATAGAGG - Intronic
1035318658 7:158014109-158014131 GTGATTGGATGGATGGATAGAGG - Intronic
1035898231 8:3428808-3428830 GTCAATCAATGGATGAATAATGG + Intronic
1035926444 8:3732936-3732958 GTAAGTAGATAGATAGATAATGG - Intronic
1037024749 8:14021196-14021218 TTAAGTAAATGGATGAACAAAGG - Intergenic
1037173244 8:15918508-15918530 GTGAGTAACTGGATGAGAAAGGG + Intergenic
1037685684 8:21137680-21137702 GTGTGTAAATGATGGGATAAAGG + Intergenic
1037921302 8:22808083-22808105 CTGAATGAATGGATGGATAGAGG - Intronic
1038007239 8:23442718-23442740 CTGAGTGAATGGAGGGATAAAGG - Intronic
1038137749 8:24806959-24806981 TTTGGTAAATGTATGGATAAGGG + Intergenic
1038679426 8:29653070-29653092 ATGAGTAAATGGATGGATGATGG - Intergenic
1040768993 8:50950384-50950406 GTGAGTAAATGGATTTGTGATGG - Intergenic
1041076134 8:54171778-54171800 GAAAATAAATGCATGGATAAAGG + Intergenic
1041291862 8:56315610-56315632 GTAAGTTAATGGAGGGATAGAGG - Intronic
1041304329 8:56445254-56445276 GAGAGCAAAGGGATGGAAAAGGG - Intronic
1041594374 8:59629911-59629933 GGGAATAAATGAATGAATAAAGG + Intergenic
1042075243 8:64986884-64986906 GAGAATAAATGACTGGATAAAGG + Intergenic
1042078237 8:65019404-65019426 GTGAGAAAATGGATGGACTAGGG - Intergenic
1042230902 8:66553377-66553399 ATGAGTAAAAGGCTGGAGAATGG - Intergenic
1042964344 8:74334679-74334701 GTGTGTAGATGGGTGGATAGTGG - Intronic
1044112707 8:88296116-88296138 ATGAATAAATGGATGAATGATGG - Intronic
1044236293 8:89834530-89834552 GTTTATAAATGAATGGATAAAGG + Intergenic
1044327745 8:90878681-90878703 ATGAATAAATGGATGAATGAAGG + Intronic
1044554860 8:93552217-93552239 GTTAGGAAATGGCTGAATAAGGG - Intergenic
1044889794 8:96822285-96822307 ATCAGTGAATGAATGGATAAAGG - Intronic
1045092959 8:98766058-98766080 GTGAAGAAATGGAGTGATAAGGG - Intronic
1045129125 8:99128509-99128531 GTGGGCAGATGTATGGATAATGG - Intronic
1045811024 8:106220285-106220307 GTGAGGACATGGATGGAGATGGG + Intergenic
1045988967 8:108283738-108283760 GTAAGTAAATGGAGGTAAAAAGG + Intronic
1046885188 8:119359053-119359075 GTGAGTATGTGGAAGGAGAAGGG + Intergenic
1047154725 8:122303997-122304019 GTAAGTGTATGGATGGGTAATGG - Intergenic
1047292564 8:123542161-123542183 GTGAATAAGTGAATGGATACGGG + Intergenic
1047703913 8:127478431-127478453 GTGAATAAATGAATGAATAATGG - Intergenic
1047875837 8:129136814-129136836 GGGAGAAAATGGCTGGAAAATGG - Intergenic
1048187856 8:132260774-132260796 ATAATTAAATGGATGGATAATGG - Intronic
1048989273 8:139751848-139751870 GTGAGTGGATGGATGAATAGTGG - Intronic
1049359854 8:142207278-142207300 GTGAGTGGATGGATGGGGAATGG + Intergenic
1049364284 8:142229217-142229239 GTGGGTGGATGGATGGATGATGG + Intronic
1049524243 8:143113241-143113263 GAGAGTAAATGGATAGAAAGAGG - Intergenic
1050140109 9:2508799-2508821 TTAAGTAAATAGATGGACAATGG - Intergenic
1052721324 9:32174447-32174469 TTGAATAAGTGGTTGGATAAAGG - Intergenic
1053428556 9:38027015-38027037 GTGAGTAAATGCCTGGGTGAAGG + Intronic
1053487468 9:38470766-38470788 ATGAATAAGTGGATGGATGAAGG - Intergenic
1054650218 9:67618917-67618939 GTGGGTGGATAGATGGATAATGG - Intergenic
1054921290 9:70545274-70545296 AAAAGTAAATGAATGGATAAAGG + Intronic
1055013863 9:71595196-71595218 ATGAATAACTGCATGGATAATGG - Intergenic
1055044306 9:71909758-71909780 GTAAGCAAAAGGATGAATAACGG - Intronic
1055616124 9:78074729-78074751 GTGAGTGAGTGAATGGATGAGGG - Intergenic
1056819722 9:89830335-89830357 CTAAGTAAATGGATGGAGGATGG - Intergenic
1057082630 9:92184424-92184446 ATGGATAAATGGATGGATAATGG - Intergenic
1058090672 9:100802214-100802236 GTGAGTATCTGGAGGGATGAAGG + Intergenic
1059170231 9:112117788-112117810 CTGGTTGAATGGATGGATAAAGG + Intronic
1059252158 9:112895531-112895553 GTGGGTAGATGGATGGATGATGG - Intergenic
1059252230 9:112895801-112895823 ATGGGTAGATGGATGGATGATGG - Intergenic
1059252238 9:112895832-112895854 GTGGGTGGATGGATGGATGATGG - Intergenic
1059452414 9:114378716-114378738 GTGGGTAGATGGATGGATGTTGG - Intronic
1059635892 9:116170561-116170583 GAGAGTTAATAGATGGGTAATGG - Intronic
1060040925 9:120300282-120300304 ATGAGTCAGTGGATGGATGATGG + Intergenic
1060119994 9:120979912-120979934 ATGAATAAATGAATGAATAACGG + Intronic
1060989003 9:127837739-127837761 ATGAGAGGATGGATGGATAAGGG - Intronic
1061417477 9:130454914-130454936 ATGAATGGATGGATGGATAATGG - Intronic
1061417491 9:130454991-130455013 GTGAATGGATGGATGGATGATGG - Intronic
1061846718 9:133392448-133392470 GTGGGTAAGTGGATGGATGATGG + Intronic
1062092520 9:134685868-134685890 GTGGGTGGATGGATGGATGATGG - Intronic
1062092547 9:134685973-134685995 GTGGGTGGATGGATGGCTAATGG - Intronic
1062201294 9:135304209-135304231 TTGAGTGGATGGATGGATGATGG + Intergenic
1062201357 9:135304492-135304514 TTGAGTGGATGGATGGATGATGG + Intergenic
1062201371 9:135304545-135304567 ATGAGTGGATGGATGGATGATGG + Intergenic
1062205470 9:135334385-135334407 TTGGATAAATGGATGGATGATGG + Intergenic
1062205489 9:135334505-135334527 TTGGATAAATGGATGGATGATGG + Intergenic
1062247979 9:135579411-135579433 GTGAATAAATGGATGGTGTATGG - Intergenic
1062248072 9:135579929-135579951 GTAAATAAATGGATGGACAATGG - Intergenic
1062281241 9:135752680-135752702 ATGAGTGGATGGGTGGATAATGG + Intronic
1062520725 9:136956815-136956837 ATGGATAAATGGATGGATGAAGG + Intronic
1062520837 9:136957243-136957265 GTGGGTGGATGGATGGATGATGG + Intronic
1062520855 9:136957301-136957323 GTGGGTGGATGGTTGGATAATGG + Intronic
1062520958 9:136957636-136957658 GTGGGTGGATGGATGGATGAAGG + Intronic
1185481875 X:452319-452341 GTGGATAAATAGATAGATAATGG - Intergenic
1185495218 X:549578-549600 GTGGGTGGATGGATGGATGAAGG - Intergenic
1185497296 X:565277-565299 GTGGACAAATGGATGGATGATGG + Intergenic
1185497528 X:566566-566588 ATGAGTAGATGGATGGATGGTGG + Intergenic
1185497532 X:566589-566611 ATGGATAAATGGATGGATGATGG + Intergenic
1185546998 X:953845-953867 CTGAATGAATGGATGGATGAGGG - Intergenic
1185582290 X:1219552-1219574 GTGAGTACATAGATAGATGATGG + Intergenic
1185616429 X:1424687-1424709 GTGGATGACTGGATGGATAAAGG - Intronic
1185762670 X:2700597-2700619 GTGCATTAACGGATGGATAAAGG - Intronic
1185867909 X:3639407-3639429 GTGGGTGCATGGATGGATGAAGG + Intronic
1185867944 X:3639492-3639514 GTGGGTACATGGATGGATGAAGG + Intronic
1186481888 X:9902283-9902305 GTGGATAGATGGATGGATAGAGG + Intronic
1186630109 X:11339512-11339534 GTGAGGAAATGGAGGTATGATGG - Intronic
1187247554 X:17566565-17566587 ATGAGTAAATGAATGAATTATGG + Intronic
1188029255 X:25246312-25246334 TTGAGAAAATGGATGGATAGTGG + Intergenic
1188452458 X:30322373-30322395 GTTAATAATTGGCTGGATAATGG - Intergenic
1189063686 X:37783137-37783159 ATGAGTTGATGGATGGATACAGG + Intronic
1190561185 X:51686910-51686932 ATGAGTAAATGGATGGTGGAGGG - Intergenic
1190563106 X:51706407-51706429 ATGAGTAAATGGATGGTGGAGGG + Intergenic
1191798088 X:65044634-65044656 GAGAGAAAATGGTTGGATTAGGG + Intergenic
1192373434 X:70534944-70534966 GAGAGGAAATGGAAGGATATTGG - Intronic
1192907718 X:75569321-75569343 GTAAGAAAATGGATGGATATTGG + Intergenic
1193133124 X:77939374-77939396 GGAAATAAATGGAGGGATAATGG - Intronic
1193141906 X:78036466-78036488 CAGAGTAAATGGATGGGCAAGGG + Intronic
1193620249 X:83744415-83744437 TTGACTGAATGGATGGAAAAGGG - Intergenic
1194809465 X:98373035-98373057 GTGAATAACTGGATGGTTAGAGG + Intergenic
1195343417 X:103926302-103926324 GTGGGAAAATGGATGGAGCAGGG + Intronic
1195343434 X:103926382-103926404 GTGAGGATATGGATGGAGCAGGG + Intronic
1195365113 X:104117271-104117293 GTGATAAAATGGATGGAGCAAGG - Intronic
1195569231 X:106380442-106380464 TGGACCAAATGGATGGATAAAGG - Intergenic
1195662128 X:107389405-107389427 TTGAGAAAATGGATGGATGTTGG + Intergenic
1195769076 X:108329797-108329819 GTTGGTAAATGGACGGATTAAGG + Intronic
1196306132 X:114105347-114105369 TTGAGTAAATGGTTGAATAAGGG + Intergenic
1196921023 X:120585293-120585315 TTGTGCAAATGGATGGATGATGG + Intergenic
1197540541 X:127754685-127754707 GTGATTAAATGCATGGATGGTGG + Intergenic
1198944852 X:141999417-141999439 TTGAGTCAATGGATAGATATAGG - Intergenic
1199046497 X:143180789-143180811 CTGAGTAAATGGATAGATGATGG + Intergenic
1199296741 X:146167775-146167797 GTGAGTGAATGAATGAATGAAGG - Intergenic
1199450717 X:147976227-147976249 TTGAGTGAATGGATGGATAAAGG - Intergenic
1199664041 X:150082575-150082597 GTGACTGAATAGATGGATGAGGG + Intergenic
1199785543 X:151101978-151102000 TTGAGCAACTGGATGGATTATGG + Intergenic
1199797512 X:151214661-151214683 GAGAGTAAAACCATGGATAAGGG - Intergenic