ID: 1124396804

View in Genome Browser
Species Human (GRCh38)
Location 15:29309414-29309436
Sequence GACTTGGACCCCGGGAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124396804_1124396808 10 Left 1124396804 15:29309414-29309436 CCAGGTCTCCCGGGGTCCAAGTC 0: 1
1: 0
2: 0
3: 13
4: 130
Right 1124396808 15:29309447-29309469 TGATGACCTTCCCTGAACCCTGG 0: 1
1: 0
2: 1
3: 11
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124396804 Original CRISPR GACTTGGACCCCGGGAGACC TGG (reversed) Intronic