ID: 1124396806

View in Genome Browser
Species Human (GRCh38)
Location 15:29309423-29309445
Sequence CACACACTTGACTTGGACCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124396806_1124396814 30 Left 1124396806 15:29309423-29309445 CCGGGGTCCAAGTCAAGTGTGTG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1124396814 15:29309476-29309498 TCTCTATAGAAAGTGCTCAGTGG 0: 1
1: 0
2: 0
3: 17
4: 152
1124396806_1124396808 1 Left 1124396806 15:29309423-29309445 CCGGGGTCCAAGTCAAGTGTGTG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1124396808 15:29309447-29309469 TGATGACCTTCCCTGAACCCTGG 0: 1
1: 0
2: 1
3: 11
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124396806 Original CRISPR CACACACTTGACTTGGACCC CGG (reversed) Intronic