ID: 1124396807

View in Genome Browser
Species Human (GRCh38)
Location 15:29309430-29309452
Sequence TCATCAACACACACTTGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124396807_1124396814 23 Left 1124396807 15:29309430-29309452 CCAAGTCAAGTGTGTGTTGATGA 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1124396814 15:29309476-29309498 TCTCTATAGAAAGTGCTCAGTGG 0: 1
1: 0
2: 0
3: 17
4: 152
1124396807_1124396815 24 Left 1124396807 15:29309430-29309452 CCAAGTCAAGTGTGTGTTGATGA 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1124396815 15:29309477-29309499 CTCTATAGAAAGTGCTCAGTGGG 0: 1
1: 0
2: 1
3: 9
4: 126
1124396807_1124396808 -6 Left 1124396807 15:29309430-29309452 CCAAGTCAAGTGTGTGTTGATGA 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1124396808 15:29309447-29309469 TGATGACCTTCCCTGAACCCTGG 0: 1
1: 0
2: 1
3: 11
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124396807 Original CRISPR TCATCAACACACACTTGACT TGG (reversed) Intronic