ID: 1124396808

View in Genome Browser
Species Human (GRCh38)
Location 15:29309447-29309469
Sequence TGATGACCTTCCCTGAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124396806_1124396808 1 Left 1124396806 15:29309423-29309445 CCGGGGTCCAAGTCAAGTGTGTG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1124396808 15:29309447-29309469 TGATGACCTTCCCTGAACCCTGG 0: 1
1: 0
2: 1
3: 11
4: 160
1124396804_1124396808 10 Left 1124396804 15:29309414-29309436 CCAGGTCTCCCGGGGTCCAAGTC 0: 1
1: 0
2: 0
3: 13
4: 130
Right 1124396808 15:29309447-29309469 TGATGACCTTCCCTGAACCCTGG 0: 1
1: 0
2: 1
3: 11
4: 160
1124396805_1124396808 2 Left 1124396805 15:29309422-29309444 CCCGGGGTCCAAGTCAAGTGTGT 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1124396808 15:29309447-29309469 TGATGACCTTCCCTGAACCCTGG 0: 1
1: 0
2: 1
3: 11
4: 160
1124396807_1124396808 -6 Left 1124396807 15:29309430-29309452 CCAAGTCAAGTGTGTGTTGATGA 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1124396808 15:29309447-29309469 TGATGACCTTCCCTGAACCCTGG 0: 1
1: 0
2: 1
3: 11
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124396808 Original CRISPR TGATGACCTTCCCTGAACCC TGG Intronic