ID: 1124396810

View in Genome Browser
Species Human (GRCh38)
Location 15:29309457-29309479
Sequence GAGAAGAAAGCCAGGGTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 1, 2: 3, 3: 56, 4: 400}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124396810_1124396814 -4 Left 1124396810 15:29309457-29309479 CCCTGAACCCTGGCTTTCTTCTC 0: 1
1: 1
2: 3
3: 56
4: 400
Right 1124396814 15:29309476-29309498 TCTCTATAGAAAGTGCTCAGTGG 0: 1
1: 0
2: 0
3: 17
4: 152
1124396810_1124396815 -3 Left 1124396810 15:29309457-29309479 CCCTGAACCCTGGCTTTCTTCTC 0: 1
1: 1
2: 3
3: 56
4: 400
Right 1124396815 15:29309477-29309499 CTCTATAGAAAGTGCTCAGTGGG 0: 1
1: 0
2: 1
3: 9
4: 126
1124396810_1124396816 7 Left 1124396810 15:29309457-29309479 CCCTGAACCCTGGCTTTCTTCTC 0: 1
1: 1
2: 3
3: 56
4: 400
Right 1124396816 15:29309487-29309509 AGTGCTCAGTGGGCCAAGCACGG 0: 1
1: 0
2: 3
3: 25
4: 257
1124396810_1124396817 10 Left 1124396810 15:29309457-29309479 CCCTGAACCCTGGCTTTCTTCTC 0: 1
1: 1
2: 3
3: 56
4: 400
Right 1124396817 15:29309490-29309512 GCTCAGTGGGCCAAGCACGGTGG 0: 1
1: 0
2: 9
3: 76
4: 616

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124396810 Original CRISPR GAGAAGAAAGCCAGGGTTCA GGG (reversed) Intronic