ID: 1124396812

View in Genome Browser
Species Human (GRCh38)
Location 15:29309464-29309486
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 643
Summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 586}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124396812_1124396817 3 Left 1124396812 15:29309464-29309486 CCCTGGCTTTCTTCTCTATAGAA 0: 1
1: 0
2: 4
3: 52
4: 586
Right 1124396817 15:29309490-29309512 GCTCAGTGGGCCAAGCACGGTGG 0: 1
1: 0
2: 9
3: 76
4: 616
1124396812_1124396816 0 Left 1124396812 15:29309464-29309486 CCCTGGCTTTCTTCTCTATAGAA 0: 1
1: 0
2: 4
3: 52
4: 586
Right 1124396816 15:29309487-29309509 AGTGCTCAGTGGGCCAAGCACGG 0: 1
1: 0
2: 3
3: 25
4: 257
1124396812_1124396815 -10 Left 1124396812 15:29309464-29309486 CCCTGGCTTTCTTCTCTATAGAA 0: 1
1: 0
2: 4
3: 52
4: 586
Right 1124396815 15:29309477-29309499 CTCTATAGAAAGTGCTCAGTGGG 0: 1
1: 0
2: 1
3: 9
4: 126
1124396812_1124396819 30 Left 1124396812 15:29309464-29309486 CCCTGGCTTTCTTCTCTATAGAA 0: 1
1: 0
2: 4
3: 52
4: 586
Right 1124396819 15:29309517-29309539 CGCATGTAATTCCAGCACTTTGG 0: 24
1: 4778
2: 141959
3: 288457
4: 220799

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124396812 Original CRISPR TTCTATAGAGAAGAAAGCCA GGG (reversed) Intronic