ID: 1124396813

View in Genome Browser
Species Human (GRCh38)
Location 15:29309465-29309487
Sequence TTTCTATAGAGAAGAAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 336}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124396813_1124396820 30 Left 1124396813 15:29309465-29309487 CCTGGCTTTCTTCTCTATAGAAA 0: 1
1: 0
2: 2
3: 37
4: 336
Right 1124396820 15:29309518-29309540 GCATGTAATTCCAGCACTTTGGG 0: 62
1: 10200
2: 243450
3: 278540
4: 179059
1124396813_1124396817 2 Left 1124396813 15:29309465-29309487 CCTGGCTTTCTTCTCTATAGAAA 0: 1
1: 0
2: 2
3: 37
4: 336
Right 1124396817 15:29309490-29309512 GCTCAGTGGGCCAAGCACGGTGG 0: 1
1: 0
2: 9
3: 76
4: 616
1124396813_1124396816 -1 Left 1124396813 15:29309465-29309487 CCTGGCTTTCTTCTCTATAGAAA 0: 1
1: 0
2: 2
3: 37
4: 336
Right 1124396816 15:29309487-29309509 AGTGCTCAGTGGGCCAAGCACGG 0: 1
1: 0
2: 3
3: 25
4: 257
1124396813_1124396819 29 Left 1124396813 15:29309465-29309487 CCTGGCTTTCTTCTCTATAGAAA 0: 1
1: 0
2: 2
3: 37
4: 336
Right 1124396819 15:29309517-29309539 CGCATGTAATTCCAGCACTTTGG 0: 24
1: 4778
2: 141959
3: 288457
4: 220799

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124396813 Original CRISPR TTTCTATAGAGAAGAAAGCC AGG (reversed) Intronic