ID: 1124396814

View in Genome Browser
Species Human (GRCh38)
Location 15:29309476-29309498
Sequence TCTCTATAGAAAGTGCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 152}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124396811_1124396814 -5 Left 1124396811 15:29309458-29309480 CCTGAACCCTGGCTTTCTTCTCT 0: 1
1: 0
2: 11
3: 64
4: 508
Right 1124396814 15:29309476-29309498 TCTCTATAGAAAGTGCTCAGTGG 0: 1
1: 0
2: 0
3: 17
4: 152
1124396809_1124396814 0 Left 1124396809 15:29309453-29309475 CCTTCCCTGAACCCTGGCTTTCT 0: 1
1: 1
2: 7
3: 85
4: 582
Right 1124396814 15:29309476-29309498 TCTCTATAGAAAGTGCTCAGTGG 0: 1
1: 0
2: 0
3: 17
4: 152
1124396810_1124396814 -4 Left 1124396810 15:29309457-29309479 CCCTGAACCCTGGCTTTCTTCTC 0: 1
1: 1
2: 3
3: 56
4: 400
Right 1124396814 15:29309476-29309498 TCTCTATAGAAAGTGCTCAGTGG 0: 1
1: 0
2: 0
3: 17
4: 152
1124396807_1124396814 23 Left 1124396807 15:29309430-29309452 CCAAGTCAAGTGTGTGTTGATGA 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1124396814 15:29309476-29309498 TCTCTATAGAAAGTGCTCAGTGG 0: 1
1: 0
2: 0
3: 17
4: 152
1124396806_1124396814 30 Left 1124396806 15:29309423-29309445 CCGGGGTCCAAGTCAAGTGTGTG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1124396814 15:29309476-29309498 TCTCTATAGAAAGTGCTCAGTGG 0: 1
1: 0
2: 0
3: 17
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124396814 Original CRISPR TCTCTATAGAAAGTGCTCAG TGG Intronic