ID: 1124396817

View in Genome Browser
Species Human (GRCh38)
Location 15:29309490-29309512
Sequence GCTCAGTGGGCCAAGCACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 702
Summary {0: 1, 1: 0, 2: 9, 3: 76, 4: 616}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124396813_1124396817 2 Left 1124396813 15:29309465-29309487 CCTGGCTTTCTTCTCTATAGAAA 0: 1
1: 0
2: 2
3: 37
4: 336
Right 1124396817 15:29309490-29309512 GCTCAGTGGGCCAAGCACGGTGG 0: 1
1: 0
2: 9
3: 76
4: 616
1124396811_1124396817 9 Left 1124396811 15:29309458-29309480 CCTGAACCCTGGCTTTCTTCTCT 0: 1
1: 0
2: 11
3: 64
4: 508
Right 1124396817 15:29309490-29309512 GCTCAGTGGGCCAAGCACGGTGG 0: 1
1: 0
2: 9
3: 76
4: 616
1124396809_1124396817 14 Left 1124396809 15:29309453-29309475 CCTTCCCTGAACCCTGGCTTTCT 0: 1
1: 1
2: 7
3: 85
4: 582
Right 1124396817 15:29309490-29309512 GCTCAGTGGGCCAAGCACGGTGG 0: 1
1: 0
2: 9
3: 76
4: 616
1124396812_1124396817 3 Left 1124396812 15:29309464-29309486 CCCTGGCTTTCTTCTCTATAGAA 0: 1
1: 0
2: 4
3: 52
4: 586
Right 1124396817 15:29309490-29309512 GCTCAGTGGGCCAAGCACGGTGG 0: 1
1: 0
2: 9
3: 76
4: 616
1124396810_1124396817 10 Left 1124396810 15:29309457-29309479 CCCTGAACCCTGGCTTTCTTCTC 0: 1
1: 1
2: 3
3: 56
4: 400
Right 1124396817 15:29309490-29309512 GCTCAGTGGGCCAAGCACGGTGG 0: 1
1: 0
2: 9
3: 76
4: 616

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124396817 Original CRISPR GCTCAGTGGGCCAAGCACGG TGG Intronic