ID: 1124399792

View in Genome Browser
Species Human (GRCh38)
Location 15:29338223-29338245
Sequence CCTTATATGCAGAGGGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 269}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124399792_1124399806 23 Left 1124399792 15:29338223-29338245 CCACAGCCCCTCTGCATATAAGG 0: 1
1: 0
2: 1
3: 14
4: 269
Right 1124399806 15:29338269-29338291 GGTAGGACAAGGGTTGGAATAGG 0: 1
1: 0
2: 1
3: 11
4: 149
1124399792_1124399805 17 Left 1124399792 15:29338223-29338245 CCACAGCCCCTCTGCATATAAGG 0: 1
1: 0
2: 1
3: 14
4: 269
Right 1124399805 15:29338263-29338285 TGATGAGGTAGGACAAGGGTTGG 0: 1
1: 0
2: 1
3: 18
4: 233
1124399792_1124399798 -10 Left 1124399792 15:29338223-29338245 CCACAGCCCCTCTGCATATAAGG 0: 1
1: 0
2: 1
3: 14
4: 269
Right 1124399798 15:29338236-29338258 GCATATAAGGAGTGAAGAGGAGG 0: 1
1: 0
2: 2
3: 23
4: 328
1124399792_1124399803 12 Left 1124399792 15:29338223-29338245 CCACAGCCCCTCTGCATATAAGG 0: 1
1: 0
2: 1
3: 14
4: 269
Right 1124399803 15:29338258-29338280 GGTGGTGATGAGGTAGGACAAGG 0: 1
1: 0
2: 5
3: 40
4: 393
1124399792_1124399804 13 Left 1124399792 15:29338223-29338245 CCACAGCCCCTCTGCATATAAGG 0: 1
1: 0
2: 1
3: 14
4: 269
Right 1124399804 15:29338259-29338281 GTGGTGATGAGGTAGGACAAGGG 0: 1
1: 0
2: 2
3: 26
4: 373
1124399792_1124399800 -6 Left 1124399792 15:29338223-29338245 CCACAGCCCCTCTGCATATAAGG 0: 1
1: 0
2: 1
3: 14
4: 269
Right 1124399800 15:29338240-29338262 ATAAGGAGTGAAGAGGAGGGTGG 0: 1
1: 0
2: 0
3: 74
4: 813
1124399792_1124399801 2 Left 1124399792 15:29338223-29338245 CCACAGCCCCTCTGCATATAAGG 0: 1
1: 0
2: 1
3: 14
4: 269
Right 1124399801 15:29338248-29338270 TGAAGAGGAGGGTGGTGATGAGG 0: 1
1: 0
2: 16
3: 99
4: 856
1124399792_1124399799 -9 Left 1124399792 15:29338223-29338245 CCACAGCCCCTCTGCATATAAGG 0: 1
1: 0
2: 1
3: 14
4: 269
Right 1124399799 15:29338237-29338259 CATATAAGGAGTGAAGAGGAGGG 0: 1
1: 0
2: 2
3: 16
4: 316
1124399792_1124399802 6 Left 1124399792 15:29338223-29338245 CCACAGCCCCTCTGCATATAAGG 0: 1
1: 0
2: 1
3: 14
4: 269
Right 1124399802 15:29338252-29338274 GAGGAGGGTGGTGATGAGGTAGG 0: 1
1: 0
2: 3
3: 110
4: 1085

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124399792 Original CRISPR CCTTATATGCAGAGGGGCTG TGG (reversed) Intronic
900532082 1:3159481-3159503 CCTTGTATGAAGAGGAGATGAGG - Intronic
901194254 1:7431674-7431696 CCTGATCTGCAGATGGGCTGGGG - Intronic
903283472 1:22263247-22263269 CCTGACATGCCGAGGGGCCGTGG + Intergenic
903917698 1:26776234-26776256 CCTTAGATGTAGAGTGGATGGGG + Intronic
904450378 1:30607116-30607138 CCTCACATGCACAGGGGCAGTGG + Intergenic
908886165 1:68791369-68791391 CCTTATAAGAAGAGGAGATGAGG + Intergenic
909418208 1:75431556-75431578 CCTTCTTTGCAGAGAGCCTGTGG + Intronic
910551565 1:88481329-88481351 CCTTATAAGAAGAGGAGATGAGG + Intergenic
915162407 1:153929764-153929786 CCTCATAAGCAAGGGGGCTGTGG + Exonic
915913566 1:159928683-159928705 TCTTCAATGCAGAGGGGCTGGGG + Exonic
917495516 1:175537010-175537032 CTTTAGATGCAGAGAGGCTGTGG - Intronic
919685413 1:200479525-200479547 CAGTGTGTGCAGAGGGGCTGGGG - Intergenic
920008488 1:202850846-202850868 GCTTAGGTCCAGAGGGGCTGTGG - Intergenic
920970682 1:210741419-210741441 CCATATAAGCAGAAGGACTGAGG - Intronic
921022023 1:211244548-211244570 CCCTATATGCAGGGGTGGTGGGG + Intergenic
921559851 1:216644058-216644080 CTTTATCTGCAGTGGGGCCGTGG + Intronic
921925559 1:220707566-220707588 CCTTAGATGCGGTGGGGCTGGGG - Intergenic
922327892 1:224545998-224546020 CCTTATAAGAAGAGGAGCTTAGG - Intronic
922792069 1:228316265-228316287 CCGGAGCTGCAGAGGGGCTGAGG + Intronic
922881646 1:228985650-228985672 CCTTATAAGAAGAGGAGATGAGG - Intergenic
922958448 1:229625477-229625499 CCCTACATGCAAAGGAGCTGTGG + Intronic
923889507 1:238196815-238196837 CCTTATAAGGAGAGGGGATTTGG + Intergenic
924513680 1:244749105-244749127 CCTTATAAGAAGAGGGGATTAGG + Intergenic
1062957675 10:1551119-1551141 CCTTATAAGAAGAGGAGATGAGG + Intronic
1063039097 10:2318464-2318486 CCTGATAAGAAGAGGAGCTGAGG + Intergenic
1063741879 10:8832020-8832042 GTCTATGTGCAGAGGGGCTGAGG - Intergenic
1063796307 10:9517287-9517309 CCTTATAGGAAGAGGAGCTTAGG + Intergenic
1064396100 10:14983335-14983357 CCTAATATCCAGAGGGGGAGAGG + Intronic
1067224604 10:44367471-44367493 CCTTATGTGGAGAGAGGCTCGGG + Intergenic
1069116074 10:64508047-64508069 CATTATTTGAAGGGGGGCTGTGG + Intergenic
1069262036 10:66410618-66410640 CCTAATATGCAGAAAGGCAGAGG - Intronic
1069747602 10:70725841-70725863 CCTTAAAAGGAGAGGGGCAGAGG - Intronic
1071977099 10:90965949-90965971 CCTCTTATGAAGAGGGGGTGTGG + Intergenic
1072991915 10:100204013-100204035 CCTCACATGCAGAAGGGATGAGG + Intronic
1075721420 10:124589802-124589824 CCTTCCAACCAGAGGGGCTGCGG - Intronic
1077504018 11:2921971-2921993 CCTTCTCTGCAGAGGGGCCCTGG + Intronic
1079307780 11:19338910-19338932 CCTCATCTGCAGAATGGCTGTGG - Intergenic
1081312100 11:41586613-41586635 CCTTATAGGCAGAGAAACTGTGG + Intergenic
1081448737 11:43153380-43153402 CCTAATATCCAGAGGGGGAGTGG + Intergenic
1081450827 11:43169494-43169516 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1081820971 11:45994378-45994400 ACCCATATGCAAAGGGGCTGCGG + Intronic
1082641727 11:55669293-55669315 ACCTAGATGCATAGGGGCTGAGG - Intergenic
1084260791 11:67977320-67977342 CCTTATATCCAGAGGGAGAGAGG + Intergenic
1084472276 11:69369943-69369965 CCTTATTAACAGAGGGGCAGAGG + Intergenic
1084706983 11:70821243-70821265 CCTTATAAGAAGAGGCGATGAGG + Intronic
1084732254 11:71081113-71081135 CCTTATAAGAAGAGGAGCTGGGG + Intronic
1085023063 11:73221207-73221229 CCATCTCTGCAGAGGGGGTGGGG - Intronic
1087011889 11:93522385-93522407 CTTTCTCAGCAGAGGGGCTGTGG + Intronic
1087609542 11:100417501-100417523 GCTTATATGGAGAGGGGAAGAGG + Intergenic
1088242119 11:107783671-107783693 CCTCATCTGGAGAGGGGCAGAGG - Intergenic
1089082841 11:115791649-115791671 CCTTCTACACAGAGGGCCTGTGG + Intergenic
1089867657 11:121646030-121646052 GCATATATGCACAGGGCCTGAGG + Intergenic
1092435558 12:8444385-8444407 CCTAATATCCAGAGGGGGAGAGG + Intergenic
1096840670 12:54377926-54377948 CCTGCTCTCCAGAGGGGCTGAGG + Intronic
1097263387 12:57732347-57732369 GGTAAGATGCAGAGGGGCTGGGG - Intronic
1097432658 12:59528967-59528989 CCTTATATCCAGAGGGAAAGAGG + Intergenic
1098237517 12:68431729-68431751 CCTTCTCTGCAGAGTAGCTGTGG + Intergenic
1098479519 12:70942762-70942784 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1102544701 12:113646086-113646108 CCTGCTTTGCAGAGGGGATGCGG + Intergenic
1102978411 12:117222904-117222926 CCTGATGTGCAGGGTGGCTGAGG + Intronic
1103595853 12:122023839-122023861 CTTTCTTTGCACAGGGGCTGAGG - Intronic
1103941259 12:124502496-124502518 CCTTTTATGCAAAGGCGCCGGGG + Intronic
1106047764 13:26160890-26160912 CCTTATAAGAAGAGGATCTGAGG - Intronic
1106131824 13:26947175-26947197 CCTCTTATGAAGAGGAGCTGAGG - Intergenic
1108104143 13:46990558-46990580 CCTCATATGCAAAGGTCCTGGGG + Intergenic
1108818190 13:54315984-54316006 CCTAATATGCGGAGGTGCAGAGG + Intergenic
1109355351 13:61226513-61226535 CCTAATATCCAGGGGGGCAGAGG - Intergenic
1109355669 13:61228551-61228573 CCTTATATCCAGGGGTGCAGAGG - Intergenic
1109387818 13:61656016-61656038 CCACACATTCAGAGGGGCTGGGG - Intergenic
1111158647 13:84363173-84363195 CCTGAGGTGCACAGGGGCTGGGG - Intergenic
1111294176 13:86257948-86257970 CCCTAGATGTGGAGGGGCTGTGG - Intergenic
1111825122 13:93258184-93258206 CCTTGGATGCAAAGGAGCTGGGG - Intronic
1117037051 14:51740723-51740745 CCTAATATGCAGCGGGGTAGAGG - Intergenic
1119105053 14:71915864-71915886 CCTTATAAGCAGAGGAAATGTGG + Intergenic
1120001475 14:79308046-79308068 CCTTATATGAAGAGGTGATTAGG - Intronic
1122744242 14:103888598-103888620 GCTGAGAGGCAGAGGGGCTGAGG + Intergenic
1124166529 15:27331090-27331112 CCTTAAATGCAGTGGGGATGTGG + Intronic
1124399792 15:29338223-29338245 CCTTATATGCAGAGGGGCTGTGG - Intronic
1125355027 15:38808316-38808338 CCTTATGTTCAGAGTGTCTGGGG - Intergenic
1126695088 15:51319018-51319040 CAATGAATGCAGAGGGGCTGAGG - Intronic
1127384658 15:58457543-58457565 TCTTACATGCTGAGGGGATGTGG - Intronic
1129958450 15:79660978-79661000 CCTTGGAGGGAGAGGGGCTGGGG + Intergenic
1131663967 15:94549788-94549810 CCTAATGGGCTGAGGGGCTGTGG + Intergenic
1131720834 15:95166656-95166678 CCATATAGTCACAGGGGCTGGGG - Intergenic
1131983737 15:98020560-98020582 AATTATATGCAGAGGGGCTGAGG - Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1135124570 16:19797790-19797812 CCCTAGATGTGGAGGGGCTGTGG + Intronic
1137432683 16:48431264-48431286 TTTTATAAACAGAGGGGCTGAGG - Intronic
1144576551 17:16433375-16433397 ACTGAGATGCAGAGAGGCTGAGG + Intronic
1146158701 17:30547167-30547189 CCTTATAAGGAGAGGAGATGAGG + Intergenic
1150821204 17:68435837-68435859 GCTTACATGCAGATGGCCTGGGG - Intronic
1151355287 17:73554439-73554461 CCTTATAAGCAGAGGAGGTGAGG + Intronic
1151408990 17:73908482-73908504 CCTTTTAGGAAGAGGGGATGAGG - Intergenic
1152638386 17:81439483-81439505 GCTTCAGTGCAGAGGGGCTGGGG + Intronic
1152944706 17:83192599-83192621 CCCCATATGCACATGGGCTGAGG - Intergenic
1154165984 18:12014848-12014870 CCATAACTGCAGAGGGGCTAAGG - Intronic
1157866184 18:51187079-51187101 CTTAATATGCAGAAGGGGTGGGG - Intronic
1158950857 18:62493323-62493345 CATTATAAGCAGATGGGGTGGGG - Intergenic
1159257608 18:65967539-65967561 CCTTATGTGCAGAGAGGTAGTGG - Intergenic
1160135782 18:76270457-76270479 TCTGACATGCAGAGGGGCTTAGG - Intergenic
1160855388 19:1214977-1214999 CCTTCTATTCAGAGGAGATGCGG - Intronic
1161978098 19:7617231-7617253 CCCTATGTGCAGAGGGGCCAAGG - Intronic
1165388141 19:35523712-35523734 CCCCACAGGCAGAGGGGCTGGGG + Intronic
1166237791 19:41469065-41469087 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1166441000 19:42815338-42815360 CCTTATAAGAAGAGGAGATGAGG + Intronic
1166459447 19:42973304-42973326 CCTTATAAGAAGAGGAGATGAGG - Intronic
1166460474 19:42983944-42983966 CCTTATAAGAAGAGGAGATGAGG + Intronic
1166476769 19:43133349-43133371 CCTTATAAGAAGAGGAGATGAGG - Intronic
1166519874 19:43473249-43473271 CCCAGTTTGCAGAGGGGCTGGGG + Intergenic
1166883347 19:45942307-45942329 CCTTATAAGCAGAGGAGATTAGG + Intronic
1168323936 19:55528628-55528650 GTTTATTTGCAGAGTGGCTGGGG + Intergenic
1168526077 19:57089828-57089850 CCTTATAAGAAGAGGAGATGAGG + Intergenic
925055053 2:850919-850941 CCTTATAAGAAGAGGAGATGAGG - Intergenic
925416387 2:3672853-3672875 CATAATGTGCAGAGGCGCTGGGG + Intronic
925550590 2:5069837-5069859 CTTTATAAGAAGAGGGGATGAGG - Intergenic
926149046 2:10414498-10414520 CCTTATAAGAAGAGGAGATGAGG - Intronic
927435858 2:23065548-23065570 CCTTATAAGAAGAGGAGATGAGG + Intergenic
927460916 2:23297606-23297628 CCTTATAAGCAGAGGGGATTAGG - Intergenic
927682042 2:25146206-25146228 CCTAATGGGCAGAGAGGCTGGGG - Intronic
927965225 2:27263866-27263888 CTGTTTATGGAGAGGGGCTGAGG + Intronic
930026630 2:47033149-47033171 CCTCAAATGCAGAGCAGCTGAGG - Intronic
931209285 2:60177405-60177427 CCTGAGAAGCAGAGGGACTGTGG - Intergenic
932353780 2:71051845-71051867 CCTTATATCCAGAGGGAGAGGGG - Intergenic
935206817 2:100903421-100903443 CATTATGTGAACAGGGGCTGTGG + Intronic
935503072 2:103865984-103866006 CCTTAAATGAAGAGGGGGTTAGG + Intergenic
937267478 2:120625546-120625568 CCTTCCATGTAGAGGGGCAGAGG - Intergenic
937829330 2:126402764-126402786 CATTATCTGCCGAGGGGGTGAGG - Intergenic
938773580 2:134521721-134521743 CCTTGTGTGCACAGAGGCTGTGG - Intronic
939443497 2:142279050-142279072 CTTTATATCCAGTGGGGCAGAGG + Intergenic
940717524 2:157244546-157244568 CCTTATATCTAGAGGGCATGGGG + Intergenic
940871640 2:158865521-158865543 CCTAATATCCAGAGGGGGAGAGG - Intergenic
942317685 2:174710131-174710153 CCTAATATCCAGAGGGGAAGAGG - Intergenic
943695679 2:190927692-190927714 CCTTAAAAGCAGAAGGGATGAGG - Intronic
943945713 2:194060568-194060590 CATTAAATGCAGAGGTGGTGAGG + Intergenic
948501748 2:238399422-238399444 CCTGATATGGAGACAGGCTGAGG - Exonic
1168821422 20:775969-775991 CCTCCCATGCAGAGCGGCTGGGG - Intergenic
1169330093 20:4709565-4709587 CCTTGTAAGAAGAGGGGCTTAGG - Intergenic
1172130600 20:32652383-32652405 CCCTCCATGCAAAGGGGCTGGGG + Intergenic
1172662932 20:36579742-36579764 CCTTATCTGTAAAGGGGCAGGGG + Intronic
1173236866 20:41254310-41254332 ACTGAGATGCAGAGGAGCTGGGG - Intronic
1175225705 20:57442694-57442716 CCTGAGCTGCAGAGGGGCAGAGG - Intergenic
1175242185 20:57557746-57557768 CCTTAGAAGCAGAAAGGCTGAGG + Intergenic
1176376440 21:6088980-6089002 CCTTATACGGAGAGGAGATGAGG + Intergenic
1178401820 21:32293076-32293098 CCTTATAAGAAGAGGAGCTTTGG + Exonic
1179186597 21:39089706-39089728 CCTTATAAGAAGAGGGGATTAGG + Intergenic
1179430837 21:41319966-41319988 CCTTATAAGAAGAGGAGATGAGG + Intronic
1179593669 21:42428044-42428066 CCTTATAAGAAGAGGGGATGAGG + Intronic
1179713977 21:43278428-43278450 CCTGATACGGAGAGGGGGTGGGG + Intergenic
1179747035 21:43449264-43449286 CCTTATACGGAGAGGAGATGAGG - Intergenic
1179979270 21:44887973-44887995 CCTGAGAGGCAGAGGGGCTGGGG - Intronic
1180990462 22:19932685-19932707 TCGTGTCTGCAGAGGGGCTGAGG - Intronic
1181700569 22:24618889-24618911 CCTTATGGGCAGCGGGGCTCAGG + Intronic
1181767438 22:25101948-25101970 CCTTATATCCATGGGGGCAGGGG - Intronic
1182910300 22:33978656-33978678 CCTTATAAGAAGAGGAGATGAGG - Intergenic
1185030307 22:48439499-48439521 CCTTATAATAAGAGGAGCTGCGG - Intergenic
1185173443 22:49306279-49306301 CCTAATCCCCAGAGGGGCTGTGG - Intergenic
1185173880 22:49308192-49308214 CCCTGGATGCTGAGGGGCTGGGG + Intergenic
954344912 3:49988717-49988739 CCCTATATGCTGGGAGGCTGAGG + Intronic
955015723 3:55066876-55066898 CATCATAGTCAGAGGGGCTGTGG - Intronic
955939213 3:64132045-64132067 TCTTATATGCAAAGGCCCTGAGG - Intronic
956024514 3:64968924-64968946 CCTTAGGTGCAGAGGGGTAGGGG - Intergenic
958036565 3:88176376-88176398 CCTTATAGGAAGAGGAGCTTAGG - Intergenic
959707172 3:109348970-109348992 TCTTAGATGCAGAGAGACTGGGG - Intergenic
960284507 3:115811924-115811946 GCTTGTAAGCAGAGGAGCTGGGG + Intronic
961278353 3:125745008-125745030 CCTTATATCCAGAGGGAGAGAGG - Intergenic
962254086 3:133858572-133858594 CCTTATAAGAAGAGGAGATGAGG - Intronic
963006085 3:140727371-140727393 ACTTCTGTGCAGAGGGGATGGGG - Intergenic
964682057 3:159352297-159352319 TCGCATATGCAGAGGGCCTGGGG - Intronic
964888846 3:161515213-161515235 TCTAATATGCAGAGGGGGAGAGG - Intergenic
964888954 3:161515891-161515913 CCTAATATCCAGAGGGGGAGAGG - Intergenic
967806156 3:193716243-193716265 ACATATATGCAGAGTGGCTTTGG - Intergenic
968075549 3:195814210-195814232 CTGTAGATGCTGAGGGGCTGCGG + Intergenic
968814586 4:2815298-2815320 CCTCCTCTGGAGAGGGGCTGTGG + Intronic
969477605 4:7430443-7430465 CACCAGATGCAGAGGGGCTGTGG - Intronic
969670848 4:8589475-8589497 CCTTATAAGCACAGGGGCACCGG - Intronic
969828181 4:9774857-9774879 CCTTATTTGCAGAAGGAATGAGG - Intronic
971386020 4:26141096-26141118 TCTTATAGACAAAGGGGCTGAGG - Intergenic
972415127 4:38832216-38832238 CCTTCTTTGCAGAGGGGGTGAGG - Intronic
973206019 4:47560962-47560984 CTGAATATGCAGAGTGGCTGAGG + Exonic
974794342 4:66729521-66729543 CCTTTTTTGCATGGGGGCTGAGG + Intergenic
975725830 4:77290914-77290936 ACTTTTTTGCAGAGGGGATGGGG + Intronic
980097822 4:128511580-128511602 CCTTATATGCAGAGGTAGAGGGG + Intergenic
982469557 4:155771394-155771416 TGTTTTATGCAGAGGGACTGTGG + Intronic
984341819 4:178466799-178466821 CCATATCTTCTGAGGGGCTGTGG + Intergenic
985268001 4:188167843-188167865 CCTTATAGGAAGAGGTCCTGGGG - Intergenic
985724448 5:1508446-1508468 CCTTATAAGAAGAGGAGATGAGG + Intronic
985771537 5:1814940-1814962 CCTTATAAGAAGAGGGGATGAGG - Intronic
985966626 5:3342941-3342963 CCTGAGATGCTGAGGGGCTCTGG - Intergenic
986968337 5:13302302-13302324 CCTCATGTGCAAAGGGGCTTGGG + Intergenic
987152701 5:15057952-15057974 CTTTATATGAAGATGGGATGAGG + Intergenic
987588658 5:19893123-19893145 CCTCAGAGGCAGAGGGGCAGAGG - Intronic
989755115 5:44942679-44942701 CCTTAAAATCAGTGGGGCTGTGG + Intergenic
994251786 5:97544231-97544253 CCTTATATGAAGAGGAGATTAGG + Intergenic
994395896 5:99225550-99225572 CCTGATATGCAGAGGGGGAAAGG - Intergenic
995630747 5:114129420-114129442 CCTTATATGAAGAGCGTCAGTGG - Intergenic
995686625 5:114779544-114779566 CCTTAGATGAAGAGGGGATATGG - Intergenic
995837060 5:116409574-116409596 CCTTATAAGAAGAGGGGATTAGG + Intronic
997039937 5:130241016-130241038 CCTAATATGTAGAGGGTCTTTGG + Intergenic
997685073 5:135782819-135782841 CCTAATATCCAGAGGGGAAGAGG + Intergenic
997782629 5:136675370-136675392 CCTTAGAGGCAGAGGGGTTGAGG + Intergenic
1001772200 5:174304955-174304977 CATGAAATGCAGGGGGGCTGGGG + Intergenic
1003498644 6:6686453-6686475 CCTTATAGGAAGAGGAGATGAGG - Intergenic
1003521573 6:6862870-6862892 CCTTATAGGAAGAGGAGGTGAGG - Intergenic
1003909205 6:10728027-10728049 CAGTATATGCAGAGGCCCTGTGG - Intronic
1003912423 6:10754426-10754448 CAGTATATGCAGAGGCCCTGTGG - Intronic
1003970654 6:11296058-11296080 CCTTATAAGAAGAGGAGATGAGG + Intronic
1004319965 6:14624711-14624733 CCTTATGTGGAGTGAGGCTGTGG + Intergenic
1006858750 6:37155066-37155088 CCTTATAAGAAGAGGAGATGAGG - Intergenic
1009222172 6:60995503-60995525 CCTAATATCCAGAGGGGGAGAGG + Intergenic
1009226478 6:61024516-61024538 CCTAATATTCAGAGGGGGAGAGG + Intergenic
1009227189 6:61030536-61030558 CCTAATATCCAGAGGGGAAGAGG - Intergenic
1009228564 6:61038733-61038755 CCTAATATGCAGAAGGGTAGAGG - Intergenic
1009368587 6:62875187-62875209 CCTAATATTCAGAGGGGGAGAGG + Intergenic
1010729960 6:79380831-79380853 CCTTATAAGAAGAGGGGGTTAGG - Intergenic
1011758300 6:90528450-90528472 CTTTATCTGGAGAGGGGTTGGGG + Intronic
1011841072 6:91499565-91499587 CCTCATATGGAGTGGGGGTGGGG + Intergenic
1012774045 6:103480252-103480274 CCTCATATGCAGAAGGGGAGAGG + Intergenic
1014170945 6:118278467-118278489 CCTCATATGCTTAGGGGATGGGG - Intronic
1015178888 6:130340397-130340419 CCTTATAAGCAAAAGAGCTGGGG - Intronic
1015224306 6:130838961-130838983 CCTGATATACAGAGGGCCAGTGG + Intergenic
1017021036 6:150141025-150141047 CCCTAAAGGCAGAGGGGCAGAGG + Intergenic
1019382548 7:731954-731976 CCTTCTGTGCAGAGAGGATGGGG - Intronic
1020335441 7:7058969-7058991 CCTAATATGCAGGGGGGGAGAGG - Intergenic
1020336196 7:7064145-7064167 CCTAATATGGAGAGGGGTAGAGG + Intergenic
1020474312 7:8577855-8577877 GCTTATTTGAAGAGGGACTGAGG + Intronic
1022473914 7:30698208-30698230 GCTTACATGCTGAGTGGCTGTGG + Intronic
1023823795 7:43995182-43995204 CCTGATCTGCAGTGAGGCTGCGG + Intergenic
1024472714 7:49779885-49779907 CCTTATAAGAAGAGGAGATGTGG - Intronic
1026687918 7:72528271-72528293 ATTTATATGCAGAGGTGGTGAGG - Intergenic
1026723137 7:72850120-72850142 ATTTATATGCAGAGGTGGTGAGG - Intergenic
1029301838 7:99587326-99587348 CCTTATATGTAGGGGGGGAGAGG - Intronic
1029752063 7:102548595-102548617 CCTGATCTGCAGTGAGGCTGCGG + Intronic
1029770015 7:102647689-102647711 CCTGATCTGCAGTGAGGCTGCGG + Intronic
1030479611 7:110085989-110086011 CCTTATATGCAGTGTGGTTTGGG + Intergenic
1031548227 7:123076771-123076793 CCTTGTATGCACTGGGGTTGGGG - Intergenic
1032190016 7:129759507-129759529 ACTCATATTCAGAGGGGCTTGGG - Intergenic
1033469696 7:141634147-141634169 TCCTATATGCAGAAAGGCTGGGG + Intronic
1034645783 7:152645977-152645999 CATTACATGCAAAGGGACTGAGG - Intronic
1035070457 7:156140935-156140957 CTTTATCTGCAAAGGGTCTGTGG + Intergenic
1035640240 8:1179254-1179276 CCTTAGATGCAGAGTGGGGGTGG + Intergenic
1035700813 8:1638311-1638333 CCTTATAAGAAGAGGAGATGAGG + Intronic
1035780574 8:2224250-2224272 CCTTATATGAAGAGGAGTTTAGG + Intergenic
1036240237 8:7074847-7074869 CCTAATATCCAGAGGGCCAGAGG - Intergenic
1036516926 8:9452760-9452782 CCTTTTAAGGAGAGGGGCTTTGG - Intergenic
1039798535 8:40935247-40935269 CCTAGTAGGCAGAGGGGCTACGG + Intergenic
1041662198 8:60411414-60411436 CCTTATATGGAGAGGAGATAAGG - Intergenic
1042000056 8:64112054-64112076 CCTTATAAGAAGAGGGGATTAGG - Intergenic
1043106444 8:76118478-76118500 CCTTATAAGCAGAGGAGATTAGG - Intergenic
1045924880 8:107571878-107571900 CCTTATATCCAGTGGGGGAGTGG + Intergenic
1047295467 8:123566902-123566924 CTTCCTATGCAAAGGGGCTGAGG - Intergenic
1048270113 8:133021711-133021733 CCTTATAAGAAGAGGGGGTCAGG - Intronic
1049127463 8:140804880-140804902 AAGAATATGCAGAGGGGCTGTGG - Intronic
1049241685 8:141540571-141540593 CCTTATAAGAAGAGGCGATGGGG - Intergenic
1049421911 8:142520759-142520781 CCCCATCTGCACAGGGGCTGTGG - Intronic
1053737665 9:41111722-41111744 CCTTATATAGAGAGGGGGAGGGG + Intergenic
1053737763 9:41112298-41112320 CCTAATATGCAGCGGGGTAGAGG + Intergenic
1053737888 9:41113188-41113210 CCGTATATGCGGAGGTGCAGAGG + Intergenic
1054690461 9:68318132-68318154 CCGTATATGCGGAGGTGCAGAGG - Intergenic
1054690585 9:68319021-68319043 CCTAATATGCAGCGGGGTAGAGG - Intergenic
1054690684 9:68319597-68319619 CCTTATATAGAGAGGGGGAGGGG - Intergenic
1056865272 9:90222983-90223005 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1058521083 9:105814752-105814774 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1058521542 9:105817969-105817991 CCTTATATCGAGAGGGGGAGAGG + Intergenic
1058521631 9:105818465-105818487 CCTAATATGCAGCGGGGTAGAGG + Intergenic
1059343170 9:113611054-113611076 CCTTATAAGAAGAGGAGATGAGG - Intergenic
1059537636 9:115097428-115097450 CCTTGTATCCAGAAGGGATGGGG + Intronic
1061183774 9:129040254-129040276 CCTGGTAGGCAGAGGGTCTGTGG + Intronic
1061318625 9:129814064-129814086 CATTGTAAGCAGAGTGGCTGAGG - Exonic
1185606251 X:1368652-1368674 CCTTATAAGAAGAGGAGATGAGG + Intronic
1185704699 X:2258004-2258026 CCTTATAAGAAGAGGAGATGAGG + Intronic
1185721826 X:2388416-2388438 CCTTATAAGAAGAGGAGATGAGG + Intronic
1185776359 X:2805731-2805753 CCTTATAAGAAGAGGAGATGAGG - Intronic
1185790215 X:2923651-2923673 CCTTATAAGAAGAGGAGATGAGG - Intronic
1186186816 X:7028957-7028979 CCTTATAAGAAGAGGAGATGAGG - Intergenic
1186410308 X:9340697-9340719 CCTTATAAGAAGAGGCGATGAGG + Intergenic
1187519377 X:20000322-20000344 GCATGTATGCAGAGTGGCTGGGG + Intergenic
1189271461 X:39755144-39755166 TCTTATTTCCTGAGGGGCTGAGG - Intergenic
1190444492 X:50509892-50509914 CCTTATAAGAAGAGGGGATTTGG + Intergenic
1190792207 X:53710970-53710992 CCTTATAAGAAGAGGAGATGAGG + Intergenic
1196930174 X:120674268-120674290 CCTCATAGGCAGAGGGGATTAGG - Intergenic
1198073367 X:133171164-133171186 CCTTATATGAAGAGGAGATGAGG - Intergenic
1198272214 X:135065677-135065699 CCTTATGTACAAAGGGGCTATGG - Intergenic
1199268550 X:145856221-145856243 CCTTCCTTGCTGAGGGGCTGAGG + Intergenic
1201231370 Y:11867942-11867964 CCTTATAAGAAGAGGAGATGAGG + Intergenic
1201293616 Y:12445744-12445766 CCTTATAAGAAGAGGAGATGAGG + Intergenic