ID: 1124399850

View in Genome Browser
Species Human (GRCh38)
Location 15:29338586-29338608
Sequence CTCCATAGGGCACTGGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124399845_1124399850 12 Left 1124399845 15:29338551-29338573 CCTTGGAGGACACAGAGGATGTC 0: 1
1: 0
2: 4
3: 25
4: 261
Right 1124399850 15:29338586-29338608 CTCCATAGGGCACTGGTGTCTGG 0: 1
1: 0
2: 1
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124399850 Original CRISPR CTCCATAGGGCACTGGTGTC TGG Intronic
903832410 1:26183108-26183130 CACCATAGAGTCCTGGTGTCTGG + Intronic
919794191 1:201311348-201311370 CTCCAAAGAGAATTGGTGTCTGG - Intronic
920669415 1:207991683-207991705 ATCCCTGGGGCATTGGTGTCAGG - Intergenic
922630819 1:227108616-227108638 ATCCATAGGGCACTGATTCCAGG + Intronic
923149817 1:231222715-231222737 TCCCATAGGTCACTGGTGTTAGG - Intergenic
923542659 1:234899640-234899662 CTCCATTGCGCGCTGGTGCCCGG - Intergenic
1067101206 10:43336027-43336049 CTCCTTCAGGCACTGGGGTCTGG + Intergenic
1067731638 10:48817084-48817106 CTCAATTGGACACTAGTGTCTGG + Intronic
1074363404 10:112839833-112839855 CTCCATGGGGCAGGGGTGGCAGG + Intergenic
1076579603 10:131498351-131498373 CTTCCTGGGGCTCTGGTGTCTGG - Intergenic
1077330200 11:1980803-1980825 CTCCACTGGGCACTGGGGTAGGG - Intronic
1082927048 11:58559976-58559998 CTCCACAGGTAACTGCTGTCAGG - Intronic
1083808157 11:65087350-65087372 CTCCATGGAGGCCTGGTGTCCGG - Exonic
1084300931 11:68251924-68251946 CTCCATAGGCCGCTCGTGACAGG - Intergenic
1089460341 11:118649429-118649451 CTGCAGTGGCCACTGGTGTCTGG + Intronic
1090122671 11:124049112-124049134 TTCCAAATGGCACGGGTGTCTGG - Intergenic
1090544438 11:127747402-127747424 CTGCATAGGGCAATGGGGCCCGG + Intergenic
1202813177 11_KI270721v1_random:35982-36004 CTCCACTGGGCACTGGGGTAGGG - Intergenic
1103401016 12:120642521-120642543 GGCCATAGGGCAGTGGTGTGTGG + Intronic
1103984964 12:124760904-124760926 CTCCATACGCCTCTGGCGTCAGG - Intergenic
1107443551 13:40449599-40449621 CTCCTTATGGCAATGGTGTGAGG - Intergenic
1111277287 13:85966862-85966884 CTCCACTGGGCACTGGTGTCTGG + Intergenic
1113767352 13:112889591-112889613 CTCCATGCGGCGCTGGGGTCAGG + Intergenic
1115742642 14:36404297-36404319 CTTCATAGGGCACTGGCCTATGG - Intergenic
1115993871 14:39175565-39175587 CTCCGTAGAGCGCTGGTCTCAGG + Intronic
1124023866 15:25946598-25946620 CCCCACATGGCACTGGTCTCAGG - Intergenic
1124399850 15:29338586-29338608 CTCCATAGGGCACTGGTGTCTGG + Intronic
1125351180 15:38769149-38769171 CAGCAGAGGGCACTGGTTTCCGG + Intergenic
1129265243 15:74389836-74389858 CTCCATGGTGCCCTGGTGACGGG - Intergenic
1129336136 15:74853282-74853304 CTCCACAGGGCTCTGGGGCCTGG + Intronic
1132767477 16:1541777-1541799 CTCCATTGGGCAGTGGCTTCGGG - Intronic
1132800319 16:1748885-1748907 CTCCACAGGGGATTGGTTTCTGG + Intronic
1133979475 16:10622564-10622586 CTCCATATGGCACAGGGGGCTGG - Intergenic
1139558247 16:67726343-67726365 CTCCATAGGCAACTGGTGCAGGG - Exonic
1140043548 16:71425140-71425162 CTCCTTTGGGAACTGGTTTCCGG - Intergenic
1142224272 16:88869999-88870021 CCCCATGGGGCCCTGGTGTTGGG - Intergenic
1150485706 17:65541961-65541983 ATCCATAAGGCACTGGTTCCTGG - Intronic
1152322009 17:79612951-79612973 CTCCAAAGGGCAGTAGGGTCTGG - Intergenic
1154995286 18:21634962-21634984 CACAATAAGCCACTGGTGTCTGG + Intergenic
1158264772 18:55649794-55649816 CGCCATAAGGCAAAGGTGTCAGG - Intronic
1158529028 18:58241489-58241511 CTCCATCTGGCAGTGGTATCTGG + Intronic
1160160465 18:76466548-76466570 CTGCATAGAGCACTTGGGTCCGG - Intronic
1163213995 19:15862845-15862867 CTCCTTTCGGCACTGGTGACGGG - Intergenic
1163455785 19:17404986-17405008 CTTTCCAGGGCACTGGTGTCGGG - Intronic
1163491937 19:17621970-17621992 CTGCACAGGGTACTGGTGACTGG + Intronic
925345933 2:3171806-3171828 CTCCGTGGGGCACATGTGTCGGG - Intergenic
925396068 2:3534556-3534578 CTGCCTTGGGCACCGGTGTCTGG - Intronic
926780730 2:16469187-16469209 CTCCATAGGGGATTGGTTTCAGG + Intergenic
928490612 2:31778847-31778869 CTTCATAGGGCAGTGGCATCAGG - Intergenic
931334729 2:61327962-61327984 CTCTAGAGGGCACTGGATTCAGG + Intronic
932740215 2:74285473-74285495 ATCCATAGGGCACTGGTTCCAGG - Intronic
932774506 2:74519569-74519591 CTTCAGAAAGCACTGGTGTCAGG - Exonic
932905856 2:75750475-75750497 CTCCTTAGGCCACCAGTGTCAGG + Intergenic
933290025 2:80427613-80427635 CTTCATGGGGCACTGCTATCAGG - Intronic
933578511 2:84098232-84098254 ATCCATAGGGGATTGGTTTCAGG - Intergenic
935089649 2:99882546-99882568 CTGCATTGGGCACTGCTGTGAGG - Intronic
935597979 2:104894600-104894622 CTCCATGGGGCACCTGGGTCAGG - Intergenic
935897787 2:107756293-107756315 ATCCCTAGGGCATTGGTTTCAGG - Intergenic
938367259 2:130744688-130744710 CTCCGTAGGGCTCTGGCGACAGG - Intergenic
938407952 2:131043233-131043255 CACCAGAGGCCACTGGTGACAGG + Intronic
941719455 2:168797920-168797942 ATCCATGGGGCATTGGTTTCAGG + Intronic
947931856 2:233971459-233971481 AGACACAGGGCACTGGTGTCAGG - Intronic
948823733 2:240564296-240564318 CCTCAGAGGGCACTGGTGGCAGG - Intronic
1171448859 20:25222537-25222559 GGCCAGAGGCCACTGGTGTCAGG + Intronic
1174633641 20:51979965-51979987 ATCCATGAGGCACTGGTTTCAGG + Intergenic
1175109362 20:56635756-56635778 ATCCATGGGGCACTGGTTCCAGG + Intronic
1175350557 20:58315070-58315092 GTCCACAGGGCCCTGGAGTCCGG + Intronic
1175396528 20:58667499-58667521 GACCGTATGGCACTGGTGTCAGG + Exonic
1177312544 21:19415613-19415635 ATCCATAGGGGATTGGTTTCAGG + Intergenic
1180914382 22:19474965-19474987 TGACAAAGGGCACTGGTGTCTGG + Intronic
1183259966 22:36788313-36788335 CTGCACAGGGCACTGCTCTCGGG + Intergenic
1184371833 22:44087394-44087416 CTCCATTGGGCCTTTGTGTCTGG + Intronic
949888079 3:8712150-8712172 CTCCACAGAGTACTGGTGCCTGG - Intronic
950627531 3:14259121-14259143 CTCCTGAGGGCCCTGGTCTCTGG - Intergenic
952953939 3:38545086-38545108 CTGCAGAGGGCACTGCTGTCAGG + Intergenic
953145465 3:40270745-40270767 CTCCATAGGGCAATGCTTTGTGG - Intergenic
956060743 3:65345654-65345676 CTCCATGGGGGACTGGTTCCAGG - Intergenic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
960984453 3:123265288-123265310 ATCCATAGGGGATTGGTTTCAGG - Intronic
964955837 3:162354877-162354899 CTCCATATGGCATTTGGGTCAGG + Intergenic
967838479 3:193984350-193984372 CTCCAAAGGCCACTGGACTCTGG + Intergenic
968489308 4:881563-881585 CTCCACACGGCACCTGTGTCAGG + Intronic
968856441 4:3127665-3127687 CTCCATAGTGCAGTGGAGGCCGG + Intronic
971686818 4:29781047-29781069 ATCCATGGGGAACTGGTTTCAGG - Intergenic
975434350 4:74334282-74334304 CCACCTTGGGCACTGGTGTCTGG + Intergenic
977679735 4:99785631-99785653 CTGCCTTGGGCATTGGTGTCTGG + Intergenic
978948477 4:114527444-114527466 CTCCTTAGTGATCTGGTGTCTGG - Intergenic
979678413 4:123434307-123434329 CCACATTGGGCGCTGGTGTCTGG + Intergenic
981778889 4:148402088-148402110 CACAATGGGGCTCTGGTGTCAGG + Intronic
985137088 4:186797193-186797215 CTCCAAAGTGCACTGATGTGAGG + Intergenic
990851639 5:60211358-60211380 CTTCACAGGGCACTGGGGACGGG + Intronic
991737072 5:69637508-69637530 ATCCATGGGGGACTGGTTTCAGG + Intergenic
991739508 5:69655541-69655563 ATCCATGGGGGACTGGTTTCAGG + Intergenic
991757994 5:69897638-69897660 ATCCATGGGGGACTGGTTTCAGG - Intergenic
991788646 5:70217232-70217254 ATCCATGGGGGACTGGTTTCAGG + Intergenic
991791083 5:70235282-70235304 ATCCATGGGGGACTGGTTTCAGG + Intergenic
991813396 5:70492337-70492359 ATCCATGGGGGACTGGTTTCAGG + Intergenic
991816528 5:70513618-70513640 ATCCATGGGGGACTGGTTTCAGG + Intergenic
991818968 5:70531659-70531681 ATCCATGGGGGACTGGTTTCAGG + Intergenic
991837397 5:70773520-70773542 ATCCATGGGGGACTGGTTTCAGG - Intergenic
991881092 5:71217596-71217618 ATCCATGGGGGACTGGTTTCAGG + Intergenic
991883529 5:71235617-71235639 ATCCATGGGGGACTGGTTTCAGG + Intergenic
993923870 5:93841522-93841544 ATCCATAGGGAACTGGTTTCAGG - Intronic
998199039 5:140103995-140104017 CTTCAGAAGGCACTGGTGTCTGG + Intergenic
1001608628 5:172982318-172982340 CTCCATAGCTCACTGCTGCCTGG - Intergenic
1001690323 5:173628269-173628291 GGCCAGAGGGCACTGGTGTGGGG - Intergenic
1003138842 6:3455608-3455630 CTCCAGAGGGGGCTGGTGACAGG + Intronic
1003383502 6:5646590-5646612 ATCCATAGGGGATTGGTTTCAGG + Intronic
1009992912 6:70865592-70865614 ATCCATAGGGAATTGGTTTCAGG - Intronic
1011345330 6:86363321-86363343 CTCCATAGGGGATTGGTTTCAGG + Intergenic
1013087248 6:106866989-106867011 CTACCTTGGGCACTGGTGTCTGG - Intergenic
1015518209 6:134105629-134105651 CTCCATGGGGGATTGGTTTCAGG + Intergenic
1015717204 6:136205176-136205198 TTCCATAAGGCAATGTTGTCAGG + Intergenic
1017481412 6:154860145-154860167 CTCCATAGTGCCCTTGTGTGGGG + Intronic
1018707795 6:166475590-166475612 CTCCAGAGGCCACTGGTTTGGGG - Intronic
1019360994 7:604121-604143 CCCCATCAGGCCCTGGTGTCTGG + Intronic
1023895027 7:44426244-44426266 CTCCTCAGGGAACAGGTGTCAGG - Intronic
1024162734 7:46695237-46695259 GGCCATAGGGCACTGCTGCCTGG + Intronic
1024598720 7:50961559-50961581 CTCTATAGGGCACTGGCATGTGG - Intergenic
1032751863 7:134849377-134849399 ATCCATAGGGGATTGGTTTCAGG + Intronic
1033622528 7:143075177-143075199 CTTCATTAGTCACTGGTGTCAGG - Intergenic
1037855447 8:22367774-22367796 CTCTATGGGGCTCTGGGGTCTGG + Intronic
1037855654 8:22368939-22368961 CTCCATGGGGCTCTGGGGTCTGG - Intronic
1038021029 8:23551944-23551966 AGCCACAGGGCACTGGTGTTGGG - Intronic
1040105235 8:43537874-43537896 CTCCCTGGGGTACTGCTGTCAGG - Intergenic
1040981899 8:53252561-53252583 CTCCACAGGGTACTGGAGACAGG + Intergenic
1041407594 8:57517373-57517395 CTCCTTAGGGCTCTGGGGCCAGG - Intergenic
1042218666 8:66452241-66452263 CTCCAGAGGCTGCTGGTGTCTGG - Intronic
1042264187 8:66891913-66891935 CTACTGAGGGCCCTGGTGTCTGG + Intronic
1043117688 8:76279601-76279623 ATCCATAGGGGATTGGTTTCAGG + Intergenic
1047312644 8:123705588-123705610 CTCCCTAGAGCCCAGGTGTCGGG - Intronic
1048564609 8:135582046-135582068 CTCCATAAGTCTCTTGTGTCGGG - Exonic
1049566492 8:143341788-143341810 CTAGATGGGGCAGTGGTGTCGGG - Intronic
1049745692 8:144262348-144262370 CTCCCCAGGGCAGTGGTGTCTGG - Intronic
1052880694 9:33599544-33599566 CTCCCTGGGGGACTGCTGTCAGG - Intergenic
1053070757 9:35100555-35100577 CAGCATAGAGCACTGGTGCCAGG - Intronic
1053495279 9:38544666-38544688 CTCCCTGGGGGACTGCTGTCAGG + Intronic
1053495404 9:38545225-38545247 CTCCCTGGGGGACTGCTGTCAGG - Intronic
1053666784 9:40322800-40322822 CTCCCTGGGGGACTGCTGTCAGG + Intronic
1053916380 9:42947907-42947929 CTCCCTGGGGGACTGCTGTCAGG + Intergenic
1054377935 9:64462828-64462850 CTCCCTGGGGGACTGCTGTCAGG + Intergenic
1054517826 9:66053483-66053505 CTCCCTGGGGGACTGCTGTCAGG - Intergenic
1054763003 9:69020182-69020204 TTCCATAGGGCACTCATTTCTGG + Intergenic
1054797540 9:69316690-69316712 CTCCACAGGCCACTGCTCTCTGG + Intergenic
1054825372 9:69567769-69567791 CTTCAAATGGCACTGGGGTCCGG + Intronic
1056479542 9:86987199-86987221 ATCCATTGGGGATTGGTGTCAGG + Intergenic
1056585389 9:87924488-87924510 CTCCCTGGGGGACTGCTGTCAGG + Intergenic
1056611491 9:88128452-88128474 CTCCCTGGGGGACTGCTGTCAGG - Intergenic
1060536153 9:124389717-124389739 CTCCACAGGGCATTGGTTGCAGG - Intronic
1062433216 9:136535141-136535163 CCCCACAGAGCCCTGGTGTCTGG + Intronic
1185503730 X:617761-617783 CTCCAGACCGCAATGGTGTCAGG + Intergenic
1188662501 X:32776542-32776564 CTTCACAGGGCAGTGGGGTCGGG + Intronic
1188866436 X:35318905-35318927 CTCTATAGGACACTAGTGTCAGG - Intergenic
1189076482 X:37920774-37920796 ATCCATATGGCACTGATGTAGGG - Intronic
1189576505 X:42359327-42359349 CTCCTTAGGGCACTACTTTCAGG + Intergenic
1190869879 X:54415803-54415825 AACCATAGGGCACTGGAGGCAGG - Intergenic
1191132657 X:57031050-57031072 TTCCATACTGCAGTGGTGTCTGG - Intergenic
1194355751 X:92882083-92882105 CTTCATAGCGCAGTGGTGCCTGG + Intergenic
1195252040 X:103058409-103058431 GTCCATGGGGAACTGGTGTCAGG + Intergenic
1199833688 X:151567504-151567526 CTCTTTATGGCTCTGGTGTCAGG + Intronic
1199978254 X:152906851-152906873 AGCCAGAGGGCACAGGTGTCAGG - Intergenic
1200664098 Y:5999065-5999087 CTTCATAGCGCAGTGGTGCCTGG + Intergenic