ID: 1124400046

View in Genome Browser
Species Human (GRCh38)
Location 15:29340120-29340142
Sequence CTGTCAATTAGATGCAACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124400044_1124400046 12 Left 1124400044 15:29340085-29340107 CCAAGTTGCTGCAAGATAAAACT 0: 1
1: 0
2: 1
3: 14
4: 210
Right 1124400046 15:29340120-29340142 CTGTCAATTAGATGCAACCATGG 0: 1
1: 0
2: 0
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124400046 Original CRISPR CTGTCAATTAGATGCAACCA TGG Intronic
901336910 1:8457443-8457465 GTGTCAATTAGTTGCATGCAGGG + Intronic
904218819 1:28947483-28947505 CTTTTTATTAGATGCAACCAGGG + Intronic
908110492 1:60892736-60892758 CTGTCAATTGGAAGTAATCAAGG - Intronic
909001884 1:70227382-70227404 CTGACAATTTTATGCACCCAGGG - Intronic
911514707 1:98853287-98853309 CTGTCAACTTCATGGAACCATGG - Intergenic
911979422 1:104547998-104548020 CTGTCAGCTAGATGCCACCAAGG - Intergenic
912914630 1:113801415-113801437 TTCTCAATTAGTTGCCACCACGG - Intronic
913375759 1:118150294-118150316 ATTTCAATTAGATGCAATGATGG + Intronic
913415299 1:118598830-118598852 CTGCCTATTATATGCAGCCATGG - Intergenic
916527924 1:165629186-165629208 CTGTCAATAAGATGCACTCCAGG - Intergenic
1067907448 10:50308285-50308307 CTGTCATTTATCTGTAACCAAGG + Intronic
1075539101 10:123297425-123297447 ATGTCAAATAGAGGCAACCCTGG + Intergenic
1079376700 11:19899356-19899378 CTGGTGATTAGATGTAACCATGG + Intronic
1082870569 11:57941013-57941035 GTGTGAATTAGATTTAACCATGG + Intergenic
1084745932 11:71169203-71169225 CTGTCAATTAACTTCAACTAGGG - Intronic
1096743573 12:53711613-53711635 CTGTGTATCAGAAGCAACCAGGG + Intronic
1098450773 12:70616061-70616083 CTGACAATTAGATGCAATACAGG - Intronic
1105543178 13:21332459-21332481 CTATCAATTACTTGCTACCAAGG + Intergenic
1107320279 13:39178909-39178931 CTGCCAATTAGATGCATTTATGG - Intergenic
1108614086 13:52114431-52114453 TTGTGAATTAGAAGCAACCAAGG - Intronic
1109795285 13:67303899-67303921 CTGTCCATTAAATTAAACCACGG - Intergenic
1110240356 13:73259809-73259831 CTGTCAGTTGGATTCAAACATGG - Intergenic
1114359914 14:21959898-21959920 CTGTCAAATAGATTCACTCAGGG + Intergenic
1114792005 14:25669813-25669835 CTGATAAAGAGATGCAACCAAGG - Intergenic
1119766611 14:77193875-77193897 CTCTCAAGTAGCTGGAACCACGG - Intronic
1121817386 14:96939150-96939172 CTGTCTATTGGGTGAAACCATGG + Intergenic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1124400046 15:29340120-29340142 CTGTCAATTAGATGCAACCATGG + Intronic
1128265359 15:66261424-66261446 TTGTCAATTAGGTACAACCCAGG + Intergenic
1128290167 15:66472383-66472405 CTGTCTACCAGATGGAACCATGG + Intronic
1132420787 15:101666128-101666150 CTGGAAATGAGATGCAACAAAGG + Intronic
1140330674 16:74053934-74053956 CTGTCACTTAGGTGCACACAGGG - Intergenic
1145869120 17:28258963-28258985 CAGTCAATCAGCTGCTACCAGGG - Intergenic
1147923124 17:43930921-43930943 CTGTCAATCAGCTGCTACCAGGG + Intergenic
1148340400 17:46870162-46870184 CTGTCAATCAGTTGCTATCAGGG + Intronic
1153096918 18:1417604-1417626 CTGTCAATAAAATTCAACCCAGG - Intergenic
1156625047 18:38898783-38898805 TTGTCAATTACATGCAACATGGG + Intergenic
1159805292 18:72950094-72950116 GTGTCAAAGAGATGCATCCATGG - Intergenic
1166443705 19:42839687-42839709 CTGAGAAAAAGATGCAACCATGG - Intronic
1166466475 19:43036276-43036298 CTGAGAAAAAGATGCAACCATGG - Intronic
933947822 2:87302109-87302131 CCGTGAATTAGATACAACCTTGG + Intergenic
936332377 2:111559463-111559485 CCGTGAATTAGATACAACCTTGG - Intergenic
939124375 2:138158094-138158116 CTTTCACTTAGAAGCAACAATGG + Intergenic
939820162 2:146947518-146947540 TTCTCCATTAAATGCAACCAGGG - Intergenic
941063037 2:160869463-160869485 CTGTCCATCAGATGAAGCCAAGG + Intergenic
941992302 2:171569293-171569315 CTGTCACTCAGCTGCAAACATGG + Intergenic
947929765 2:233954192-233954214 CTATCAAATACATACAACCAAGG - Intronic
1169741462 20:8899420-8899442 CTGTGTCATAGATGCAACCACGG - Intronic
1170702384 20:18715021-18715043 CTGTCACTGAGATACAAGCAGGG - Intronic
1174071840 20:47905049-47905071 CTGTCATTTCCATGCCACCATGG - Intergenic
1177630366 21:23719371-23719393 CTGTAAATAATATGTAACCATGG + Intergenic
1179506818 21:41846743-41846765 CTGTCAAGTAGAGACAACAAAGG + Intronic
1181524329 22:23470807-23470829 CTGTAAAAAAGATGCTACCAAGG - Intergenic
951525614 3:23650015-23650037 CTGTGAATTTGATGTAACCCAGG + Intergenic
954342525 3:49966842-49966864 CTGGGATTTAGATGCAGCCAGGG + Intronic
955386244 3:58483341-58483363 CTGTCACTTACCAGCAACCAGGG - Intergenic
955786367 3:62544505-62544527 CTGTGAATTACATGAAACAAAGG + Intronic
956726939 3:72163958-72163980 GTGTCTATATGATGCAACCAGGG + Intergenic
957834387 3:85568124-85568146 CTGTCAATTTGATGGAATTAAGG - Intronic
958900394 3:99879327-99879349 CTGACAATTAGCTCGAACCAGGG - Intronic
959661940 3:108878883-108878905 CACTCAATCTGATGCAACCATGG - Intergenic
961409917 3:126712833-126712855 CAGTCAATTAAATGTACCCATGG - Intronic
963600898 3:147378127-147378149 CTGTGAGTTAGTTTCAACCAGGG + Intergenic
965191068 3:165530439-165530461 CTGTAAGTTAGATCTAACCATGG - Intergenic
965658222 3:171013021-171013043 CTCTAAATGAGAGGCAACCAGGG + Intronic
970529802 4:16969971-16969993 CTGTCAGTTATTTGCAACCTTGG + Intergenic
971683597 4:29734483-29734505 CTGTCATGCAGATGAAACCAGGG - Intergenic
971897210 4:32613071-32613093 CTGTGAATTACATGCATGCAAGG - Intergenic
975181718 4:71353537-71353559 CTGTCATTTAGATGAAATAAGGG - Intronic
976681985 4:87767782-87767804 CTGTCAATCAGTTGCAACACAGG - Intergenic
977187362 4:93956219-93956241 CTGTAAATTAGATGGAAGAAAGG - Intergenic
981744979 4:148044306-148044328 CTGTCAATGAGAAGCAACTTTGG - Intronic
986731030 5:10635266-10635288 CTGTCAGTTAGATTTAACCAGGG - Intronic
987058177 5:14216019-14216041 CTGTAAATTAGAGGTAATCATGG + Intronic
987369677 5:17181704-17181726 CTTTCAATCAGATGCAAACATGG + Intronic
989336078 5:40318416-40318438 CTGACAGAGAGATGCAACCAAGG - Intergenic
994923808 5:106087390-106087412 CTTTAAATTAGATGGAAACAAGG - Intergenic
995243706 5:109913860-109913882 TTGTTAATTAGATGCCATCATGG - Intergenic
1002415159 5:179116528-179116550 CTGACAATTAGATGCGAGCTTGG - Intronic
1003489525 6:6609275-6609297 ATGTCAATGAGATGAAGCCAGGG - Intronic
1003990891 6:11485468-11485490 GTGTCAATTACATGAATCCATGG + Intergenic
1014896716 6:126910045-126910067 CTGTCACTTAGATGCATCTGTGG + Intergenic
1015508779 6:134017007-134017029 CATTCAATTACATGAAACCAAGG + Intronic
1017223748 6:151996164-151996186 CTGTCCTTCAGATGCAAACAAGG - Intronic
1018050509 6:160004982-160005004 CTTGCAATTAGATGACACCAGGG + Intronic
1021643637 7:22765621-22765643 CAGTCAGTTTGATGCTACCAGGG + Intergenic
1023779619 7:43643642-43643664 CTGTCACTTGGATGCCACGATGG + Intronic
1026911140 7:74092670-74092692 CTGCCAAGGAGATGCTACCAGGG - Intronic
1028990600 7:97045123-97045145 CTGACAATGAGAGGCCACCATGG + Intergenic
1029442878 7:100597086-100597108 CTGGCAATTAGATTCTACCTGGG + Intronic
1031560464 7:123231879-123231901 CTGTATATTATATGCAACTAAGG - Intergenic
1033148407 7:138891279-138891301 CTGCCCTTTAGAAGCAACCAAGG + Intronic
1035650752 8:1262147-1262169 CTGTCAAACAAACGCAACCAGGG + Intergenic
1038310800 8:26444841-26444863 CTGTAAGCCAGATGCAACCAGGG - Intronic
1038437728 8:27548113-27548135 CTGTCAATTAGCAACATCCAAGG + Intergenic
1039375428 8:37027916-37027938 CTGTCTCTTTGATCCAACCATGG + Intergenic
1039633319 8:39135951-39135973 CTGAAAATAAGAAGCAACCAGGG - Intronic
1041457570 8:58076810-58076832 CTGTCAATCAAATCCAAGCATGG - Intronic
1048683680 8:136876644-136876666 ATGTCAATTATATGTAAACATGG + Intergenic
1051085690 9:13346340-13346362 CTGCCAATTAAATGAAATCATGG + Intergenic
1052092909 9:24351608-24351630 CTGTCAATCAAAGGTAACCAAGG - Intergenic
1052303423 9:26978117-26978139 TTGTCATTTAGATGCCACCTGGG + Exonic
1186058006 X:5672024-5672046 CTGAAAATTAGATGTAACCAAGG - Intergenic
1186773823 X:12844351-12844373 CCTTCAGTTAGATACAACCATGG - Intergenic
1198012488 X:132572474-132572496 CTGTGAATCAGGAGCAACCAAGG + Intergenic
1199590345 X:149462059-149462081 CTGTCAAGGAGATGAAACTAAGG + Intergenic
1199623186 X:149716773-149716795 CTGAGCATGAGATGCAACCAGGG + Exonic
1201275694 Y:12296324-12296346 CTCTCACTTACATGCAAACATGG + Intergenic