ID: 1124403114

View in Genome Browser
Species Human (GRCh38)
Location 15:29367669-29367691
Sequence ACTGCCTTGCAGAATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 281}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124403111_1124403114 8 Left 1124403111 15:29367638-29367660 CCCTGAGAAGGCTCTAAGCTCTC 0: 1
1: 0
2: 1
3: 13
4: 141
Right 1124403114 15:29367669-29367691 ACTGCCTTGCAGAATGTGGAAGG 0: 1
1: 0
2: 1
3: 29
4: 281
1124403110_1124403114 17 Left 1124403110 15:29367629-29367651 CCAGGAAAGCCCTGAGAAGGCTC 0: 1
1: 0
2: 9
3: 31
4: 293
Right 1124403114 15:29367669-29367691 ACTGCCTTGCAGAATGTGGAAGG 0: 1
1: 0
2: 1
3: 29
4: 281
1124403112_1124403114 7 Left 1124403112 15:29367639-29367661 CCTGAGAAGGCTCTAAGCTCTCA 0: 2
1: 7
2: 32
3: 99
4: 236
Right 1124403114 15:29367669-29367691 ACTGCCTTGCAGAATGTGGAAGG 0: 1
1: 0
2: 1
3: 29
4: 281
1124403109_1124403114 18 Left 1124403109 15:29367628-29367650 CCCAGGAAAGCCCTGAGAAGGCT 0: 1
1: 0
2: 5
3: 51
4: 346
Right 1124403114 15:29367669-29367691 ACTGCCTTGCAGAATGTGGAAGG 0: 1
1: 0
2: 1
3: 29
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124403114 Original CRISPR ACTGCCTTGCAGAATGTGGA AGG Intronic
902033964 1:13443039-13443061 GCTGCCTTGCAAAATGTTGCAGG + Intergenic
902852518 1:19171465-19171487 ACTGCCTTGCAGAAGATAGAGGG - Intronic
903036055 1:20493286-20493308 CCTGCCTTGGAGCCTGTGGAAGG - Intergenic
903386182 1:22928448-22928470 ATTGCCTTGCAGAATGATGGTGG + Intergenic
904105210 1:28075068-28075090 ACTGCTTGGCTGAATGTGAAAGG - Intronic
904756056 1:32769607-32769629 AGTGCCCTGCAGAATGTGCCTGG + Intronic
904851975 1:33466447-33466469 ACTGTGCTGCAGAACGTGGAGGG + Intergenic
904866332 1:33581915-33581937 ACTGCCATGCAAACTGTGAAGGG + Intronic
904944932 1:34192313-34192335 ACCGCCTTGCAGAATTTGGGAGG + Intronic
905391879 1:37641223-37641245 ATTACCTTGCATAATGTGGGTGG + Intergenic
905601335 1:39254392-39254414 ACAGCCTGGAAGAATGGGGAAGG - Intronic
905733450 1:40311512-40311534 ACTGCCTTCCAGACCCTGGATGG + Exonic
905766343 1:40604754-40604776 ATTGCCTTTCATAATGTGGGTGG + Intergenic
906203935 1:43976931-43976953 TCTGCTTTGCAGAGTGGGGATGG + Intronic
906283294 1:44568586-44568608 ACTCCTTTGCAGGATTTGGAAGG + Intronic
909665141 1:78123664-78123686 ACTGGCAAACAGAATGTGGATGG + Intronic
912826287 1:112906543-112906565 ACTGCATTGCAGAATGTTCAAGG + Intergenic
912944848 1:114076392-114076414 ACTGCCTCGCAGAGGGAGGAAGG + Intergenic
912972499 1:114297255-114297277 ACTGCCTTCCATAATGTGGGTGG + Intergenic
916204521 1:162302431-162302453 GCTGGCTTGAAGAATGTGAATGG + Intronic
918070806 1:181132120-181132142 ACTGCCTGGCAGATGGAGGAGGG + Intergenic
919350920 1:196452875-196452897 ACTGCCCTCCATAATGTGGGTGG - Intronic
920038581 1:203081756-203081778 ACTGCCCTGGGGAATGAGGAGGG - Intergenic
921006737 1:211101055-211101077 AGTGCCATGCAGAAACTGGAAGG - Intronic
921998449 1:221447761-221447783 CCTGCCTTGTAGAATCTGGGTGG + Intergenic
922346550 1:224701162-224701184 ACTGCTATGCAGAGAGTGGAAGG + Intronic
923441238 1:234022507-234022529 ACTGCATTCCATAATGTGGGTGG - Intronic
923835103 1:237602678-237602700 GATGCCTTCCAGAATGTGGCTGG + Intronic
1065313137 10:24435575-24435597 ACTGTCTTGCAGCCTGTGCAAGG + Intronic
1066416483 10:35226384-35226406 GCTGCCTTGCAGCAGGGGGAAGG + Intergenic
1067109346 10:43388792-43388814 ACTGCCTTCCAGTGTGTGGTTGG - Intronic
1068474836 10:57511435-57511457 ACTTCATTTCAGATTGTGGAGGG + Intergenic
1069184572 10:65407396-65407418 ATTGCCTTCCAAAATATGGATGG + Intergenic
1070667710 10:78357140-78357162 AATGCCTTGCAGAATGTGAATGG + Intergenic
1070698183 10:78578585-78578607 GCTGCCTTGCAGAATGAGTGGGG - Intergenic
1071868889 10:89769779-89769801 TCTGGCATGTAGAATGTGGAAGG + Intronic
1075348730 10:121704731-121704753 AGTGCCTTATAAAATGTGGAGGG - Intergenic
1075438023 10:122459704-122459726 ACTGCTTTGCGGGAGGTGGAGGG - Intergenic
1079021079 11:16909521-16909543 GCTGCCTTGGAGAGTGTGGTGGG - Intronic
1079227870 11:18623581-18623603 ACTACCCTCCATAATGTGGATGG + Intronic
1081741309 11:45442918-45442940 ATTGCCTTCCATAATGTGAATGG + Intergenic
1082809648 11:57471663-57471685 ACAGCTTTTCAGAATGGGGAAGG + Intronic
1083152689 11:60802768-60802790 GTTGTCTTGCAGAATGTTGATGG + Intergenic
1084175050 11:67418638-67418660 GCTGCCATGCTGAATGGGGATGG + Intronic
1090468706 11:126958971-126958993 ACTGCTTTCCTCAATGTGGATGG + Intronic
1090868893 11:130725690-130725712 AGGGCCTTGCAGGTTGTGGAAGG + Intergenic
1091146635 11:133285834-133285856 GCAGCCTTACAGAATGTGCAGGG - Intronic
1091613551 12:2032062-2032084 TCTACCTTGCAGCATGGGGATGG - Intronic
1092095423 12:5838296-5838318 GCTGCCTTCAAGAGTGTGGAAGG + Intronic
1092480741 12:8857178-8857200 ACAGCCCTGCAGAACCTGGATGG + Exonic
1093247250 12:16754716-16754738 GCTGTCTTGCAGAGTGTGGCTGG + Intergenic
1094079299 12:26515450-26515472 ACTGACTTCCAGCATGTGCATGG + Intronic
1094605509 12:31945608-31945630 ACTGCCATGCAGAAAAAGGAGGG + Intergenic
1096256272 12:50064009-50064031 ACTGCCATGCAGACAGGGGAAGG + Intronic
1096765954 12:53889796-53889818 ACTGCCTTAGAGAATTTGGCAGG - Intergenic
1098190273 12:67940747-67940769 ACTGACTGGCACAAAGTGGATGG - Intergenic
1101872374 12:108576830-108576852 ACAGCTTTGCAGAATGTTGGAGG - Intergenic
1102777760 12:115535417-115535439 AGGGTCTTGCAGAATGGGGATGG - Intergenic
1104852727 12:131885168-131885190 ACTCCCTTGCAGGATGCGGGTGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105821880 13:24087300-24087322 AATGCTTTGCAGAGTGTGCAGGG - Intronic
1106485605 13:30169641-30169663 ACTGCCTGGCTGAGTGTTGAAGG + Intergenic
1107185437 13:37513744-37513766 CCTGCCATGCAGAAAGTGTAAGG - Intergenic
1108956152 13:56160129-56160151 CATGCCTTGCAGAATGGGGTTGG - Intergenic
1109261391 13:60149177-60149199 CCTTCCTGACAGAATGTGGATGG + Intronic
1112144016 13:96678092-96678114 ATTCCCTGGCAGAAAGTGGAAGG + Intronic
1114483333 14:23048317-23048339 ACGGCCTTGCAGAACCCGGACGG - Exonic
1114498111 14:23147964-23147986 ACTGGCTTGCTCACTGTGGAGGG + Intronic
1114900350 14:27049964-27049986 TCTGCCTTGCAGACTGCTGATGG + Intergenic
1115267199 14:31512706-31512728 ATTGCCTTCCATAATGTGGGTGG + Intronic
1116592033 14:46789325-46789347 GCAGACTTGCAGAATGTAGAAGG - Intergenic
1117075655 14:52101198-52101220 ACAGCCTTTCTGAAAGTGGAAGG + Intergenic
1117297859 14:54395441-54395463 ACTGCCATCCATAATATGGATGG + Intergenic
1117575349 14:57092018-57092040 AATGCGCTGCAGAATGTGAAAGG + Intergenic
1118040559 14:61911457-61911479 ATTGCCTTGCTGAATGAGGATGG - Intergenic
1120489156 14:85154628-85154650 AATGCATAGAAGAATGTGGAAGG + Intergenic
1120819942 14:88902821-88902843 ACAGACTTACAGAAGGTGGAGGG + Intergenic
1122416731 14:101553414-101553436 TCTGGCTTGCACAATGGGGAGGG - Intergenic
1122599039 14:102912265-102912287 AGTGCCTTGAAGGATGGGGAGGG - Intergenic
1124403114 15:29367669-29367691 ACTGCCTTGCAGAATGTGGAAGG + Intronic
1124700541 15:31908375-31908397 ACTGCCTAGTGGACTGTGGAAGG - Intergenic
1124816510 15:32999566-32999588 ACTGCATTGCACAATGAGCAGGG + Intronic
1126516798 15:49548528-49548550 ACTGCCTTGTAGAATGAGTTTGG + Intronic
1128732351 15:70029751-70029773 ACTGCTTGGCAGAAGGTGAAAGG + Intergenic
1128738897 15:70070074-70070096 ACTTCCTTTCATATTGTGGATGG - Intronic
1129080352 15:73033842-73033864 ACTTCCTAGCATAAGGTGGAAGG + Intergenic
1129765377 15:78162222-78162244 CCTGTCTTGCAGATTGTTGATGG + Exonic
1130766526 15:86876782-86876804 TTTGCCTTGCAGAATGTAGTTGG + Intronic
1130826752 15:87556745-87556767 ACTGCCTGGCAGAGTGCTGAAGG - Intergenic
1131071520 15:89469475-89469497 ACTGCCATGCAGAAAAAGGAGGG - Intergenic
1131089783 15:89614888-89614910 ACTGCCTGGCTGAGTGTTGAAGG - Intronic
1132035795 15:98483112-98483134 AATGCTATGAAGAATGTGGATGG - Intronic
1132268003 15:100494710-100494732 ACTGCCTAGCTAAATGTTGAAGG - Intronic
1132672159 16:1106381-1106403 GCTGCCTGGCAGAGTCTGGATGG + Intergenic
1133694635 16:8250224-8250246 TCTGCAATGCAGAAGGTGGAGGG + Intergenic
1133986201 16:10670128-10670150 ACTGCCTTGCAGCATAGGTAAGG + Intronic
1134307162 16:13043277-13043299 TCTGCCCAGCAGAATATGGATGG - Intronic
1137378955 16:47980012-47980034 GCTGTTCTGCAGAATGTGGAAGG - Intergenic
1137504680 16:49043697-49043719 ACTGCCTGGCTGATTGTTGAAGG - Intergenic
1138847880 16:60589017-60589039 ATTGCCTTCCATAATGTGGGTGG - Intergenic
1139344017 16:66290404-66290426 ACCTCCTGGCAGAATGTGGGTGG - Intergenic
1143734014 17:8897696-8897718 CCTCCCTTGCAGAATGTGTTAGG + Intronic
1148710222 17:49674887-49674909 ACTGTTTTGCAGATTGGGGAGGG - Intronic
1151534054 17:74727445-74727467 ACCACCTTGCAGTATCTGGAGGG + Intronic
1155419305 18:25637254-25637276 ATTGCCTTGTGGTATGTGGAAGG - Intergenic
1155709092 18:28853524-28853546 AGGGCCTTGGAGAGTGTGGAGGG + Intergenic
1155822818 18:30399380-30399402 ACTTCCTTCCACAATGTGGATGG - Intergenic
1156278002 18:35603286-35603308 AGTGCCTAGCAGATTGTGGGAGG + Intronic
1157893159 18:51438111-51438133 ACAGTCTGGCAGAATGTGGCAGG + Intergenic
1158422612 18:57309347-57309369 ACTGCCATGCAAAATAGGGAGGG + Intergenic
1158706615 18:59798055-59798077 ACTGCCTTACAGATTCTGGGGGG + Intergenic
1159940098 18:74400334-74400356 GCCCCCTTGCAGCATGTGGAAGG + Intergenic
1160021108 18:75182607-75182629 ACAGCCTTGCAGCATGTGTGTGG - Intergenic
1161320253 19:3637739-3637761 ACTGCCAAGCAGAAGGTGGGGGG + Intronic
1161645938 19:5453508-5453530 ACTGCCTTGGCCACTGTGGATGG - Intergenic
1163087775 19:14994619-14994641 CCTGCCTTGGAGAATCTGGTGGG + Intronic
1164767011 19:30780022-30780044 TATGCCTTGCAGAGAGTGGATGG - Intergenic
1165677139 19:37736252-37736274 ACTCCCAAGCAGAATGTTGAAGG + Intronic
1167740941 19:51324622-51324644 ACTCCTTTGCAAAATGGGGATGG + Intronic
925426909 2:3757336-3757358 ATTGCCTTGTGGAATGTGGGGGG + Intronic
925561660 2:5202906-5202928 ACTGCCTTCCACAGTGTGGGTGG + Intergenic
925767881 2:7254583-7254605 CCAGTCTTGAAGAATGTGGAAGG - Intergenic
926404358 2:12535620-12535642 AATGCCTTCCAGAATCTGAAAGG - Intergenic
928272276 2:29867100-29867122 AGTGTCTTGCAGAATCTGGAGGG - Intronic
929417726 2:41760874-41760896 ACTTCCTTACAGAATGCTGAAGG + Intergenic
929588301 2:43129816-43129838 ACAGCATTCCAGGATGTGGAGGG + Intergenic
929803448 2:45123995-45124017 ATTGCCTTCCATAATGTGGGTGG - Intergenic
929900235 2:45994229-45994251 ACTCCGTTGCAGAATGCTGATGG - Intronic
930750231 2:54927450-54927472 AATACCTTACAGAATATGGAAGG - Intronic
932591245 2:73069205-73069227 TCTGACTTGCAGAAAGAGGAAGG + Intronic
932998879 2:76895798-76895820 ACTTCCATGCAGTCTGTGGAGGG + Intronic
933019975 2:77177794-77177816 ACTGCCTTCCAGTATGAAGAGGG - Intronic
933131498 2:78678141-78678163 ACTGCCTTCCTCAATGTGGGTGG - Intergenic
938015852 2:127866653-127866675 TCTGCCCTGCAGGCTGTGGATGG - Intronic
938634821 2:133212255-133212277 ACTGCATTTCAAAATGTTGATGG - Intronic
940485779 2:154293750-154293772 ACTGCCTTTTAAAATGTTGAGGG + Intronic
940595242 2:155783133-155783155 AGTTCCATGAAGAATGTGGATGG - Intergenic
941904794 2:170710394-170710416 ATTGGCTTGCAGAGTCTGGAAGG - Intergenic
942292725 2:174487602-174487624 ACTGCCTTGGTGAAGGTGGAAGG - Intergenic
942367084 2:175239208-175239230 CCTACATTTCAGAATGTGGATGG - Intergenic
944152699 2:196577671-196577693 ACTGTCTTGCTGATTGTCGAAGG + Intronic
946247316 2:218395077-218395099 ACTGGCCTGCTGGATGTGGAGGG + Exonic
946467226 2:219922648-219922670 ACAGCCTTGGAGAATGTGCTGGG - Intergenic
946538087 2:220653083-220653105 ATTGCCTAGCAGATTGTTGAAGG + Intergenic
946818446 2:223605279-223605301 ACAGCCTATCAGAGTGTGGATGG - Intergenic
947454019 2:230236641-230236663 ATTGCCTTCCATAATGTGGGTGG - Intronic
1169057187 20:2633205-2633227 ACTGCCTGGTTGAATGTTGAAGG - Intronic
1169302295 20:4454393-4454415 ATTGCCTTCCATAATGTGGGTGG - Intergenic
1169646704 20:7819090-7819112 ACTACCTTCCACAATGTAGATGG - Intergenic
1170738511 20:19031859-19031881 TCTGACTTGCAGAGTGTGGAAGG - Intergenic
1170971435 20:21120590-21120612 ACTGCTCTCCAAAATGTGGATGG - Intergenic
1171090508 20:22281675-22281697 TCTGCCTTGCACAAGGAGGAAGG - Intergenic
1172818021 20:37705030-37705052 ACTTCATTGGAGAATGTGGATGG + Intronic
1173138604 20:40461944-40461966 ACTCTCTTGCAGAATATGGTAGG - Intergenic
1173138782 20:40463598-40463620 TCTGCCTTGCAGATTGGGGTAGG - Intergenic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1175640889 20:60629320-60629342 ACAGCCTTGAAGAATGTAGAGGG + Intergenic
1176377795 21:6095406-6095428 ACAGTCTTGAAGACTGTGGATGG + Intergenic
1177731201 21:25028683-25028705 AATGCCCTCCATAATGTGGATGG + Intergenic
1178257450 21:31067388-31067410 ATTGCCTTCCACAATGTGGGTGG + Intergenic
1179050886 21:37887843-37887865 CCTATCCTGCAGAATGTGGAAGG + Intronic
1179745679 21:43442842-43442864 ACAGTCTTGAAGACTGTGGATGG - Intergenic
1179984745 21:44914085-44914107 AGGGCCTTGGAGAATGAGGAGGG - Intronic
1182005736 22:26957980-26958002 ACTGCATTGCAGACTGTAAATGG - Intergenic
1182640375 22:31762185-31762207 AGTACCTTGCACAATGTGGTGGG - Intronic
1183964801 22:41435247-41435269 ACTGGTTTGCAGACTGTGGAAGG - Exonic
1185259027 22:49851480-49851502 GCTGCCCTGCACAATTTGGAAGG + Intergenic
949145225 3:691392-691414 ACTGCACTGCAGAGTGTGGCTGG + Intergenic
950764557 3:15263750-15263772 CCTGCCTTGAAGAAAGAGGAGGG + Intronic
951599900 3:24362213-24362235 ACAGCTTTGCAGACTGTGAAAGG - Intronic
952216844 3:31286704-31286726 ACTGCCCTCCATAATGTGGGTGG + Intergenic
953241818 3:41156128-41156150 CCTGCTTTGTGGAATGTGGATGG - Intergenic
953988115 3:47461143-47461165 TTTGCCTTGAAGAGTGTGGAGGG - Intronic
958442906 3:94178443-94178465 ACGGGCTTGCAGACTGGGGAAGG - Intergenic
959045872 3:101472912-101472934 AGAGCCTTTCAGAAGGTGGAGGG - Intronic
960432388 3:117584945-117584967 AGGGCCTTTCAGAAGGTGGAGGG + Intergenic
960619793 3:119626839-119626861 AGAGCCTTGCAGATTGTGGCTGG + Intronic
960965020 3:123098615-123098637 TCTTCCATGGAGAATGTGGAAGG - Intronic
961641003 3:128364820-128364842 GCTGCCATGCAGGCTGTGGAGGG - Intronic
961723510 3:128911001-128911023 ACTGCCTTGGTGAATGGGGCAGG - Intronic
962076564 3:132088461-132088483 ACAGCCTTGGAGACTGTGGATGG + Intronic
962586336 3:136846026-136846048 ATTGCCTTCCATAATGTGGGTGG + Intronic
962990495 3:140573200-140573222 AGGGCCTGGCAGAGTGTGGAGGG + Exonic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963380720 3:144526462-144526484 ACTTCATTGCACAATGTAGAAGG + Intergenic
963672331 3:148267754-148267776 ACTGCCCTCCATAATGTGGGTGG + Intergenic
964471792 3:157064474-157064496 ACTGCCTGGCTGAATGATGAGGG - Intergenic
964804397 3:160591589-160591611 ACTACCTTGTAGAATGTGTTTGG - Intergenic
965385034 3:168035635-168035657 ACGGCCTATCAGAAGGTGGAGGG + Intronic
966286693 3:178304970-178304992 AGTGCCTAAGAGAATGTGGATGG + Intergenic
966977548 3:185098780-185098802 ACTGCCCTTCATAATGTGGGTGG + Intronic
966978151 3:185104804-185104826 ACTGCATACCAGAAGGTGGAGGG + Intronic
969065687 4:4478690-4478712 ACTGCCATGCATCATGTGGAGGG + Intronic
969226045 4:5798956-5798978 TCTCCCTCGCAGAATGGGGAGGG + Intronic
970459701 4:16261080-16261102 ACTGCCCTCCATAATGTGGGTGG - Intergenic
971091684 4:23352788-23352810 ATTGCCTTGAAAAAGGTGGAAGG - Intergenic
971266555 4:25100918-25100940 ACTGCCCTCCATAATGTGGGTGG - Intergenic
971282252 4:25250434-25250456 AGGGCCTTTCAGAAGGTGGAGGG + Intronic
971315771 4:25566703-25566725 ACTGCATTGCAGACTGTGGTGGG - Intergenic
971365017 4:25970618-25970640 ACTCCCTGGCTGAGTGTGGATGG - Intergenic
972341742 4:38157913-38157935 ACTGCCTTGCAGAATGCCTTGGG + Intergenic
974247659 4:59341495-59341517 ATTGCCTTTCTTAATGTGGAGGG + Intergenic
975812677 4:78185353-78185375 ATTGTCTTGCAGAATTTAGATGG + Intronic
980847657 4:138343326-138343348 ACTGCCCTCCCTAATGTGGATGG - Intergenic
983090075 4:163493085-163493107 ACTGCCATGCAGAAAAAGGAGGG - Intergenic
983313377 4:166095068-166095090 ACTGTCTTCTAGAATATGGACGG + Intronic
985220503 4:187698501-187698523 AGTGCCTTGAAGAGTGTGGGAGG - Intergenic
986075275 5:4330501-4330523 ATTGCCTTCCACAATGTGGGTGG + Intergenic
986498092 5:8367309-8367331 ACTCCCTTTCAGAATGTCAAGGG + Intergenic
986519985 5:8605025-8605047 ATTGCCTTTCATAATGTGGGTGG + Intergenic
987746639 5:21982132-21982154 ATTGCCTTCCCTAATGTGGATGG + Intronic
988358463 5:30205707-30205729 ATTACTTTCCAGAATGTGGATGG - Intergenic
988518945 5:31929105-31929127 ACAGCCATGCAGCAGGTGGATGG - Intronic
989661426 5:43802486-43802508 ACTAACCTGCAGAATGAGGAAGG + Intergenic
991234688 5:64379904-64379926 ATTGCCTTCCATAATGTGGGTGG - Intergenic
991299105 5:65111683-65111705 ACTGCCTGGCTGAGTGTTGAAGG + Intergenic
991766812 5:69991890-69991912 ATTGCCTTCCCTAATGTGGATGG + Intergenic
991846044 5:70866964-70866986 ATTGCCTTCCCTAATGTGGATGG + Intergenic
992633287 5:78702198-78702220 ACTGTCTTGCACAATGTTAAAGG + Intronic
992964966 5:81990395-81990417 ATTACCTGGCAGAATGTGGGAGG + Intronic
993426713 5:87774137-87774159 ACAGCCTTGGAGAATGGGGAAGG - Intergenic
997447854 5:133954665-133954687 ACTGTTTTGCAGGCTGTGGAGGG - Intergenic
997707528 5:135971961-135971983 ACTGCCTGGCTGAATGTTGAAGG - Intergenic
999468533 5:151830585-151830607 ACTGCCTCACAGAATGTTTAAGG + Intronic
999550446 5:152680634-152680656 ACTGCCTGGCAGAGTGTTGAAGG + Intergenic
999809948 5:155118198-155118220 ATTGCCTTTCCCAATGTGGATGG + Intergenic
1002403315 5:179006776-179006798 ATTGCCTTCCATAATGTGGGTGG - Intergenic
1002526785 5:179819652-179819674 ACTGCCTTGCAGACAGGGGCAGG - Intronic
1004506675 6:16252539-16252561 ACTCCCTTAAAGAAGGTGGAGGG - Intronic
1005853623 6:29843215-29843237 ACTGCCCAGCAGAGTGTTGAGGG - Intergenic
1006650822 6:35549879-35549901 ACTGCCAGGCTGACTGTGGAAGG + Intergenic
1007200327 6:40102689-40102711 ACTGCCTGGCTGAGTGTTGAAGG - Intergenic
1007709000 6:43809721-43809743 ACTGCCATACAGAAGGCGGATGG + Intergenic
1008261205 6:49368399-49368421 ACGGCCTTTCAAAATGTGGAGGG + Intergenic
1008929501 6:56923765-56923787 ACTGCCTTCCATAATGTGGGTGG - Intronic
1011890532 6:92153739-92153761 ATTGCCTTCCATAATGTGGGTGG - Intergenic
1013673395 6:112430129-112430151 ACTCCATTTCACAATGTGGAAGG + Intergenic
1014069648 6:117166765-117166787 ATTGCCCTCCAGAATGTGGGTGG + Intergenic
1014204048 6:118636609-118636631 ACTGCCCTCCATAATGTGGGTGG + Intronic
1014383145 6:120769053-120769075 AATACCTTGCAGAATTTGTAGGG + Intergenic
1014394716 6:120912123-120912145 ATTGCCTTTCATAATGTGGATGG + Intergenic
1016780318 6:147950720-147950742 AGTGCCTGGAAGAATGTGGGAGG - Intergenic
1017122416 6:151037143-151037165 ACAGCAATGCAGAATGGGGAGGG - Intronic
1018439682 6:163799608-163799630 ACTTCCTTGTAGATTCTGGATGG - Intergenic
1019947881 7:4344509-4344531 ACTGGCTTTCAGAATGAGCATGG + Intergenic
1019972703 7:4554365-4554387 AGTGCTTTGCACACTGTGGAGGG - Intergenic
1020412512 7:7908777-7908799 ACTGCCTTCCATAATATGGGTGG + Intronic
1022153596 7:27636073-27636095 TCTGCTTTGCAGCATGAGGAGGG + Intronic
1022496437 7:30855842-30855864 GCTGCCTTCCAGAGTGAGGAGGG - Intronic
1024120139 7:46228190-46228212 ATTGCCCTACATAATGTGGATGG - Intergenic
1024458257 7:49632916-49632938 ACTGTCTTCCAGGATTTGGATGG + Intergenic
1024707113 7:51972689-51972711 ACGGCCTTGCAGGATGTTGGAGG - Intergenic
1025108027 7:56189157-56189179 GCTGCCTTGCAGAAGCTGGCTGG - Intergenic
1026310218 7:69176905-69176927 GCTGCCTTGCAGAAGCTGGCTGG + Intergenic
1026815224 7:73506011-73506033 AATGTCTTGCAGAATTTGCACGG - Intronic
1029336068 7:99900322-99900344 ACTGCCCTTCATAATGTGGGTGG - Intronic
1031119275 7:117703069-117703091 TCTGCCTTGCAGAAGGTGCTTGG - Intronic
1031211043 7:118826605-118826627 ACTTCCTTTCAGAATGAGGTGGG - Intergenic
1033201388 7:139374421-139374443 ACTCCCTTGCAGATTGAGGTAGG - Intronic
1034999866 7:155604060-155604082 CCTCCCTTGCAGTATTTGGACGG - Intergenic
1036513718 8:9423915-9423937 GTTTCCTGGCAGAATGTGGATGG + Intergenic
1036938208 8:13025837-13025859 ACTGGCATGTAGAATTTGGAAGG - Exonic
1039816950 8:41102542-41102564 ATTGCCTTCCATAATGTGGGTGG - Intergenic
1041140033 8:54807914-54807936 ATTGCCTTCCATAATGTGGACGG - Intergenic
1042469269 8:69164636-69164658 AGGGCCTTTCAGAGTGTGGAGGG - Intergenic
1042848222 8:73189582-73189604 ACTGCCTTCCATAATGTGGGTGG + Intergenic
1044737024 8:95289296-95289318 ACTGCATTGCAGGTAGTGGATGG - Intergenic
1044953348 8:97454791-97454813 GCTGTCTAGCAGAATGTGAATGG - Intergenic
1045701636 8:104872997-104873019 GCTGCATTGAAGAATGGGGATGG + Intronic
1046797114 8:118385251-118385273 ACTGCCTTCCATAATGTGGGTGG + Intronic
1047710843 8:127550747-127550769 ACTACCCTGCAGAGAGTGGAGGG + Intergenic
1048500996 8:134974881-134974903 CCTGTCTTGCAGACTGGGGAAGG - Intergenic
1049328003 8:142034086-142034108 ACCGCCCTGCAGGAGGTGGATGG - Intergenic
1049937390 9:512461-512483 ACTGCCCTCCATAATGTGGGTGG - Intronic
1051098978 9:13499281-13499303 ACTGCATTCAAGAATCTGGAAGG + Intergenic
1052602989 9:30662220-30662242 GTTGCCTTTCTGAATGTGGATGG + Intergenic
1053174586 9:35912774-35912796 ACGGCCGTGCAGGATCTGGAAGG + Intergenic
1054894350 9:70291291-70291313 ACTGCCTGGCTGAATGATGAAGG - Intronic
1055391378 9:75825716-75825738 GATGCCTTGGAAAATGTGGATGG - Intergenic
1056955418 9:91077200-91077222 ACTCCATGGCAGAAGGTGGAAGG + Intergenic
1057056323 9:91964037-91964059 GCTGCCTGGCTGAATGTGGAAGG - Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1058936506 9:109774084-109774106 GCTGACTTGCAGAATGTACACGG + Intronic
1060231179 9:121826811-121826833 GGGGCCTTGCAGAATGAGGAGGG + Intronic
1186522808 X:10220939-10220961 TCAGCCCTGAAGAATGTGGAGGG + Intronic
1186596309 X:10985357-10985379 AGAGACTTGAAGAATGTGGAGGG - Intergenic
1187987636 X:24831780-24831802 AATGCATTGCAGAATGTTAAAGG + Intronic
1189030348 X:37443025-37443047 GCTGCTTTGAAGAATGTAGAGGG + Intronic
1189037468 X:37507033-37507055 ACTGCTTTGAAGAATGTAGAGGG + Intronic
1189221177 X:39373564-39373586 GCTGCCTTGCAGCAAGGGGAAGG - Intergenic
1189361009 X:40351380-40351402 ACTGCCTGGCTGAGTGTTGAAGG - Intergenic
1189621684 X:42847250-42847272 ACTGCCTAGCTGAGTGTTGAAGG + Intergenic
1191781371 X:64871405-64871427 ACTGCCTGCCAGAATATTGAAGG - Intergenic
1191893566 X:65969669-65969691 ACTGGCTTACAGAATGTTGTAGG - Intergenic
1192103071 X:68286379-68286401 ACTGTCTGGCTGAATGTTGAAGG - Intronic
1192207127 X:69103815-69103837 AGTGCCTTGTTGGATGTGGAGGG + Intergenic
1192279345 X:69667841-69667863 ACTCCATGGCAGAAGGTGGAAGG + Intronic
1192631695 X:72782325-72782347 TCTGTCTTTCAGAATGTGAAAGG - Intronic
1192634998 X:72807883-72807905 TCTGTCTTTCAGAATGTGAAAGG - Intronic
1192646717 X:72912920-72912942 TCTGTCTTTCAGAATGTGAAAGG + Intronic
1192650014 X:72938476-72938498 TCTGTCTTTCAGAATGTGAAAGG + Intronic
1193041389 X:77007380-77007402 TCTGCATTACAAAATGTGGAGGG + Intergenic
1193245363 X:79222092-79222114 ACTGCCTTCCTGAGTGTTGAAGG + Intergenic
1194544274 X:95213253-95213275 ATTTCATGGCAGAATGTGGAAGG - Intergenic
1194908354 X:99607734-99607756 ATTGCCCTCCATAATGTGGATGG + Intergenic
1194961803 X:100244672-100244694 ACCGCCTTCTACAATGTGGAGGG - Intergenic
1195262695 X:103148968-103148990 ATTACCTTCCAGAATGTGAATGG - Intergenic
1197907147 X:131437692-131437714 ACTGCCTTGGAGACTGTGGCTGG + Intergenic
1198279010 X:135123953-135123975 AGTGGCTTGCAGAGTGGGGAGGG + Intergenic
1198291948 X:135248567-135248589 AGTGGCTTGCAGAGTGGGGAGGG - Intergenic
1198297981 X:135305546-135305568 AGTGGCTTGCAGAGTGGGGAGGG - Intronic
1199282646 X:146020795-146020817 CCTGTCTTGCAGAATTTGCAGGG - Intergenic