ID: 1124405114

View in Genome Browser
Species Human (GRCh38)
Location 15:29385056-29385078
Sequence GGGGATCTGATGGGCCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124405114_1124405121 1 Left 1124405114 15:29385056-29385078 CCCAGGGGGCCCATCAGATCCCC 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1124405121 15:29385080-29385102 AACTACCACCAGAGTCCTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124405114 Original CRISPR GGGGATCTGATGGGCCCCCT GGG (reversed) Intronic
900018893 1:172911-172933 GGGCATCTGATGGGCCTGCAAGG - Intergenic
900049149 1:531506-531528 GGGCATCTGATGGGCCTGCAAGG - Intergenic
900071379 1:773330-773352 GGGCATCTGATGGGCCTGCAAGG - Intergenic
900191952 1:1355776-1355798 GGGGAAGGGGTGGGCCCCCTAGG + Intronic
900399647 1:2467690-2467712 GGGGTTGTGATGGTCCCCGTAGG + Intronic
900407110 1:2497644-2497666 AGGGCTCGGATGGGCCTCCTGGG + Intronic
900422978 1:2563582-2563604 TGGGGTCTGAAGGGCCCTCTGGG - Exonic
900467529 1:2833062-2833084 GGAGCTCTGTGGGGCCCCCTGGG - Intergenic
900680165 1:3912142-3912164 GGGGGACTGATGGGTCCCCAGGG + Intergenic
902443760 1:16448469-16448491 GGGCATCTGCTGGGTGCCCTGGG - Intronic
902748408 1:18489019-18489041 GAGGATCCGAGGGGCACCCTAGG - Intergenic
903856003 1:26337863-26337885 TGGGACCTGATGGGCTCACTGGG - Intronic
904432009 1:30470349-30470371 GGGGATCTGACGGGCCCCTCAGG + Intergenic
905423869 1:37867806-37867828 GGGGATCAGATGCAACCCCTGGG - Intronic
905739948 1:40361513-40361535 GGGGACCTCAAGGGCCCACTTGG - Intronic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
912939788 1:114034676-114034698 TGGGATGAGATGGGCACCCTAGG + Intergenic
914901822 1:151715192-151715214 GGGGAGCTGGTGTGGCCCCTGGG + Intronic
922106746 1:222518779-222518801 GGGCATCTGATGGGCCTGCAAGG - Intergenic
922777829 1:228224994-228225016 GGGGATCTGACTGGCCTCATTGG + Intronic
924348926 1:243096345-243096367 GGGCATCTGATGGGCCTGCAAGG - Intergenic
1065814877 10:29474216-29474238 AGGGATCTGAGGGGCCCTCTTGG + Intronic
1066727440 10:38408558-38408580 GGGCATCTGATGGGCCTGCAAGG + Intergenic
1070934629 10:80283703-80283725 GGGCATGTGCTGGGCCCACTGGG + Intronic
1071310499 10:84339171-84339193 GGGGATCTGGAGTGCTCCCTAGG + Intronic
1072919943 10:99568429-99568451 GGGGATCAGCTGGTCACCCTAGG - Intergenic
1076614738 10:131747971-131747993 GGGGCTCTGATGGGGCCACATGG + Intergenic
1076698389 10:132257792-132257814 GGGCAGCTGATGGGTCCCCTGGG - Intronic
1077412683 11:2410859-2410881 GGGGCTCTGGTGGGTGCCCTAGG + Intronic
1078340102 11:10492520-10492542 TGGGATTTGATGGGCCCTCAGGG + Intronic
1080002389 11:27363937-27363959 TGGGATCTGAGGGGCACTCTCGG + Intergenic
1084529463 11:69718392-69718414 GGGACTCTGATGAGTCCCCTGGG + Intergenic
1084861327 11:72020185-72020207 AGAGATCTGATGGGGCCTCTTGG + Intronic
1085512081 11:77093505-77093527 GGGGAGCAGATGGGCCCTATGGG + Intronic
1089494461 11:118901311-118901333 GGGGACTTGATGGGGCCCCAGGG - Exonic
1089870675 11:121670224-121670246 GGGGACCTGTTTGTCCCCCTTGG + Intergenic
1091323707 11:134668913-134668935 GGGGATCTGATGTGCTGCCTGGG + Intergenic
1094202535 12:27808461-27808483 GGGGATGGGATGGGGCCCCTTGG + Intergenic
1095298149 12:40550580-40550602 GGGGACCTGATGGCTCCCATAGG + Intronic
1096085982 12:48865397-48865419 GGGGATCTGATGGGTCCTCTGGG + Intronic
1097041674 12:56159652-56159674 GGGGATGTGATGAGGGCCCTGGG + Exonic
1100702965 12:97167423-97167445 GCGGAACTGCTGGACCCCCTGGG + Intergenic
1102122431 12:110452009-110452031 GGGGATGTGCTGGGCTGCCTGGG - Intergenic
1112407446 13:99133959-99133981 GGAGCTGTGATGAGCCCCCTGGG + Intergenic
1113463131 13:110495718-110495740 GAGGATCTGATGGGGTCTCTAGG - Intronic
1113533536 13:111046391-111046413 GGGGATCTACTGGGCCCGCTGGG - Intergenic
1113985727 13:114314414-114314436 GGCGATCTGATTGGCCCGCGCGG + Intergenic
1114672001 14:24416404-24416426 GGGCCTCTGGTGGGCCCCCAAGG - Exonic
1115893258 14:38056473-38056495 AGGGATCTGAGGGTGCCCCTAGG + Intergenic
1117189758 14:53278313-53278335 GAGCATCTGATGGGACCCCAGGG - Intergenic
1118716142 14:68561392-68561414 GGGCATCTAGAGGGCCCCCTTGG + Intronic
1121312611 14:92943386-92943408 TGGGATCTGAAGGACGCCCTTGG + Intronic
1123719814 15:23050164-23050186 GGGGTTATGATGGCCCCCCCGGG - Intergenic
1123719832 15:23050202-23050224 GGGGTTATGATGGCCCCCCCCGG - Intergenic
1124214048 15:27791972-27791994 TGGGCTCTGATGGGCTCCCAAGG + Intronic
1124405114 15:29385056-29385078 GGGGATCTGATGGGCCCCCTGGG - Intronic
1126076543 15:44916744-44916766 GGGGATCAGTTGGGGCCACTGGG - Intergenic
1126082354 15:44976645-44976667 GGGGATCAGTTGGGGCCACTGGG + Intronic
1126440552 15:48683689-48683711 GGGGATCTGAAGAGCCTGCTTGG - Intergenic
1127976641 15:64002176-64002198 GGGGATCAGAGGTGCCACCTTGG - Intronic
1128028699 15:64460914-64460936 GGGGATCTGATGGGGGCCGGGGG + Intronic
1129155286 15:73713756-73713778 GGGTCTGTGATGGGGCCCCTGGG + Exonic
1129677970 15:77642630-77642652 GGGGCTCTGAAGGGCTTCCTAGG - Intronic
1130076785 15:80696072-80696094 GGGGGTCTCTTGGGGCCCCTGGG + Intronic
1131101087 15:89690680-89690702 GGGGATCCGACGGGCCCCAGAGG - Exonic
1132940021 16:2501836-2501858 GGGGAGCTGAGAAGCCCCCTGGG - Exonic
1139849107 16:69940095-69940117 GGGGAACTGCAGGGCCTCCTGGG - Exonic
1141083196 16:81071653-81071675 GGGGATCCCATGGGCCCCGGAGG + Intronic
1142444766 16:90129552-90129574 GGGCATCTGATGGGCCTGCAAGG + Intergenic
1142462744 17:105914-105936 GGGCATCTGATGGGCCTGCAAGG - Intergenic
1142577666 17:920326-920348 GGGCACCTCATCGGCCCCCTTGG - Intronic
1143479782 17:7221590-7221612 GATGCTCTGATGGGCCCCCAGGG - Exonic
1146520916 17:33524931-33524953 AGGGAGCTGCTGGGCTCCCTAGG - Intronic
1147182577 17:38695927-38695949 GTGGGTCTGAGAGGCCCCCTTGG + Intergenic
1149665968 17:58364930-58364952 TGGGTTCTGAGTGGCCCCCTGGG - Intronic
1151043888 17:70896490-70896512 AGGTATCTCATGGGCCCCCCAGG - Intergenic
1151106396 17:71621077-71621099 GGGGATGTGATGAGGCCCCTAGG + Intergenic
1152432585 17:80257608-80257630 GTGGTTCTGACGGGCCTCCTGGG - Intergenic
1152650078 17:81488561-81488583 GGAGATCCGCAGGGCCCCCTAGG - Intergenic
1152717349 17:81906412-81906434 GGGCAGCTGATGGGCCCTCGAGG - Intronic
1155087755 18:22474394-22474416 AGGGATCTGCGGGGTCCCCTGGG - Intergenic
1156585569 18:38427403-38427425 GGGAACCTCATTGGCCCCCTGGG + Intergenic
1158967346 18:62634149-62634171 GGGGCTCTGCTGGGGCCACTAGG - Intergenic
1159829570 18:73258565-73258587 AGGCATCTGAAGGGCACCCTTGG + Intronic
1159986246 18:74844777-74844799 GGGAATCTGATGGGGCCCAGAGG + Intronic
1160421612 18:78751434-78751456 AGGGAACTGATGGGGCCCCTGGG + Intergenic
1160528319 18:79549802-79549824 TGGGATGTGAAGGGCCCCCGGGG - Intergenic
1161668057 19:5589068-5589090 GGGGCTCTGGTGGCCCCTCTCGG - Intronic
1162541048 19:11296128-11296150 GGGCAGCTGCTGGGCCGCCTTGG + Exonic
1165825904 19:38705607-38705629 GGGGAACAGAAGGGCCCCCTAGG + Intronic
925426298 2:3751396-3751418 GGGGAGCTGGTGGGCCCACCTGG - Intronic
925565837 2:5253281-5253303 GGGGTTCTCCTGGGCTCCCTTGG - Intergenic
927467967 2:23351156-23351178 GTGGAGCTGATGGGCCCCGTGGG - Intergenic
929557758 2:42936224-42936246 GGGGATCTGACTGTGCCCCTTGG - Intergenic
931117005 2:59175673-59175695 GGTGATCTGATGGACTCTCTGGG + Intergenic
932472388 2:71968995-71969017 GGGGATTTGATTGGCCAGCTGGG + Intergenic
936667217 2:114610390-114610412 GGGGATCTGATGGGAAGCCAGGG + Intronic
937817961 2:126274673-126274695 TGGGCTCTGATGGCCCCCATGGG + Intergenic
948752099 2:240138779-240138801 GGGGAACTGCAGTGCCCCCTAGG + Intergenic
1169195654 20:3680959-3680981 GGGGAGGTGATGGGACCCCTGGG - Intronic
1170500909 20:16974704-16974726 GGGGATTTCCTGGGCCCCCAAGG - Intergenic
1174481765 20:50836326-50836348 GGGGCTCTGATCTGCCCCTTTGG + Intronic
1174850009 20:53984808-53984830 GGTGAACTGATGGACACCCTAGG + Intronic
1175964120 20:62651961-62651983 AAGGATCTGATGGGGTCCCTGGG - Intronic
1176105351 20:63383298-63383320 GTGGATCTGAAGGGGCCACTTGG - Intergenic
1178761252 21:35404969-35404991 GGGGATATGATGGGGACCCATGG - Intronic
1179548073 21:42125450-42125472 GAGGATCTGAAGAGCCCCCGAGG - Intronic
1179722083 21:43321697-43321719 GGAGCTCAGATGTGCCCCCTGGG + Intergenic
1180008342 21:45033542-45033564 AGGGATCTGAGGGGCCACCCAGG - Intergenic
1180023265 21:45142795-45142817 GGGGATCTGAGGGGCCCAGAAGG + Intronic
1181048902 22:20229513-20229535 GGGGAGGTGATGGGACCCCCAGG + Intergenic
1182049041 22:27299273-27299295 GGGGCTCAGATGCGCGCCCTCGG + Intergenic
1182487284 22:30647038-30647060 GGGGATCTCAGGAGCCACCTGGG + Exonic
1182504022 22:30769113-30769135 TGGGCTCTGAGGGGGCCCCTCGG + Intronic
1182832673 22:33316291-33316313 GGCAAGCTCATGGGCCCCCTCGG - Intronic
1184757946 22:46527367-46527389 GAGGGTTTGGTGGGCCCCCTCGG - Intronic
1184902773 22:47457866-47457888 GGGGAACGGAAGGGCCCCATAGG + Intergenic
950633522 3:14299440-14299462 GGGGATCAGTTGGGGCCCCCAGG + Intergenic
950679259 3:14573737-14573759 GGGTATATGATGAGCCCTCTTGG - Intergenic
959592707 3:108097454-108097476 AGTGATTAGATGGGCCCCCTTGG + Intergenic
967220325 3:187242889-187242911 GGGGATATGCTGGGCTACCTGGG + Intronic
968365385 3:198181682-198181704 GGGCATCTGATGGGCCTGCAAGG + Intergenic
968966766 4:3772730-3772752 GGGGATCTGACAGGCTCCCTGGG + Intergenic
972670185 4:41207722-41207744 GGTCAGCTGATGGGGCCCCTGGG - Intronic
975313129 4:72925447-72925469 GGGGATCCCAAGGGCCCACTTGG + Intergenic
979254420 4:118596849-118596871 GGGCATCTGATGGGCCTGCAAGG + Intergenic
979334544 4:119449182-119449204 GGGCATCTGATGGGCCTGCAAGG - Intergenic
980509042 4:133760427-133760449 GGTGATATGATGGCCCACCTGGG - Intergenic
980541456 4:134201585-134201607 GGAGGTCGGAGGGGCCCCCTAGG - Intronic
982139550 4:152304873-152304895 GGGGATCTGGTGGTGCCCCCTGG - Intergenic
985494365 5:196468-196490 GGGGATGACATGGGGCCCCTGGG - Intergenic
985794247 5:1950212-1950234 GGGGAGCTGATCGGCCACCAGGG + Intergenic
990349294 5:54899754-54899776 CTGGTTCTGAGGGGCCCCCTGGG + Intergenic
991092471 5:62706386-62706408 GAGGGTCTGATGGGGCCACTTGG - Intergenic
996276205 5:121668840-121668862 GGTGATCTGAAGGACCCCCAAGG - Intergenic
998054559 5:139063299-139063321 GGGGCTGTGGTAGGCCCCCTAGG - Intronic
1001118978 5:168963099-168963121 TGGGATCAGATTGGCCCCGTAGG - Intronic
1001940402 5:175736003-175736025 GGGGCTGTGAGGGGCACCCTGGG - Intergenic
1002845971 6:944549-944571 GTTGATATGATGGGCCTCCTTGG + Intergenic
1007145466 6:39625616-39625638 GGGGATTTGAGGGGACTCCTAGG - Intronic
1016228477 6:141771943-141771965 GGGGACCTGATGAGCCTGCTTGG + Intergenic
1017021628 6:150143984-150144006 GGGGATCTCAGAGGCCCCCTTGG + Intronic
1019703746 7:2487793-2487815 TGGGAGCTGATGGCTCCCCTGGG - Intergenic
1019970220 7:4534776-4534798 GTGGTGCTGTTGGGCCCCCTAGG - Intergenic
1022630041 7:32076219-32076241 GGAGATTTGATGTGGCCCCTAGG + Intronic
1023828107 7:44023364-44023386 GAGGATCTGATTGGACCCCCAGG - Intergenic
1023877357 7:44294210-44294232 GGGCATCTGATGTGGTCCCTTGG - Intronic
1023959661 7:44915928-44915950 GGAGATCTCAGGGGCCCCCAGGG + Intergenic
1029112985 7:98223012-98223034 GGGGATGTGCTGTGCCGCCTGGG - Exonic
1029679301 7:102097007-102097029 GGGGATGTGATTGACCTCCTGGG + Intronic
1029756408 7:102576803-102576825 GAGGATCTGATTGGACCCCCAGG - Intronic
1029774351 7:102675882-102675904 GAGGATCTGATTGGACCCCCAGG - Intergenic
1032046904 7:128618801-128618823 GGGCATCTGATGGGCCTGCAAGG + Intergenic
1033476329 7:141696756-141696778 TGGGATCTGATGGCCCCTTTAGG - Intronic
1035249950 7:157590653-157590675 GGGGAGCTGATGGGGCCTCGCGG + Intronic
1036099382 8:5760825-5760847 GGGGATTTGGGCGGCCCCCTTGG - Intergenic
1037934609 8:22907013-22907035 GGGGATCTGGAAGGCCTCCTTGG + Intronic
1040423643 8:47262748-47262770 GGGGATCACAGGGGCCACCTTGG + Intronic
1044756585 8:95468841-95468863 GGGACTCTGATGTGCCTCCTAGG + Intergenic
1049179973 8:141217220-141217242 GGGCATCTGCTGGGCCCTCCAGG + Intronic
1049587571 8:143439134-143439156 GGGGAGCAGATGGGGCCCCGAGG - Intronic
1056815844 9:89800180-89800202 GTGGGTCTGATGGGACACCTGGG + Intergenic
1060555497 9:124505398-124505420 GGAGATGTGGTGGGCCCCATGGG - Intronic
1061074671 9:128333839-128333861 GGGTAGCTGCTGGTCCCCCTGGG - Exonic
1061480645 9:130896302-130896324 GGGCATCTGCCGTGCCCCCTTGG - Intergenic
1062671482 9:137712365-137712387 GGGGAACTGCTGGACCCCCACGG + Intronic
1062749752 9:138244549-138244571 GGGCATCTGATGGGCCTGCAAGG + Intergenic
1188615735 X:32156909-32156931 GTGGATCTGTTGGGCGACCTTGG - Intronic
1189157252 X:38771104-38771126 GGGCAGCTGATGGGGGCCCTTGG - Intergenic
1194148048 X:90287953-90287975 GGGGATCTGCTGTGCACGCTAGG + Intergenic
1197573345 X:128177722-128177744 GGGCATGTGATGGCCCACCTGGG + Intergenic
1199308314 X:146293074-146293096 GGTGATGTGATGGCCCACCTGGG - Intergenic
1200494432 Y:3864716-3864738 GGGGATCTGCTGTGCACACTAGG + Intergenic
1201283459 Y:12360199-12360221 GGGCACCTGAGGGGTCCCCTTGG + Intergenic
1201926741 Y:19295628-19295650 AGGGACCTGATGGACACCCTGGG + Intergenic