ID: 1124411060

View in Genome Browser
Species Human (GRCh38)
Location 15:29437562-29437584
Sequence TGAAGGATAATCAAGAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 1, 2: 2, 3: 32, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124411060 Original CRISPR TGAAGGATAATCAAGAGCCA GGG (reversed) Intronic
900794143 1:4697890-4697912 CGGAGGAGAAGCAAGAGCCAAGG + Intronic
902045898 1:13524088-13524110 TGGGGTTTAATCAAGAGCCAGGG + Intergenic
902315183 1:15613262-15613284 GGCAGGAGAATCACGAGCCAGGG + Intergenic
903337287 1:22633601-22633623 TGAAGGATGGTCTAGAGCCAGGG - Intergenic
903610467 1:24607884-24607906 TGAGGGGAAATCAAGAGTCAGGG + Exonic
905852579 1:41285148-41285170 TGAAGGAAAGTCCAGATCCAGGG + Intergenic
906889340 1:49691081-49691103 TGAAGGATAAACAGGAGAAAAGG + Intronic
907694015 1:56702459-56702481 TGAAGGATTTTAAAGAGACAGGG - Intronic
908645942 1:66277920-66277942 TGTAAGAAAATCAAGACCCAGGG - Intronic
909616037 1:77609100-77609122 TGAAAAATAAACAAGACCCATGG + Intronic
915076491 1:153312252-153312274 GGTAGGATAAGCTAGAGCCAAGG + Intergenic
917422208 1:174875742-174875764 TAAATGATAATCAGGAGACAAGG - Intronic
917751310 1:178056216-178056238 AGAAGCCTAATCCAGAGCCAGGG + Intergenic
919872770 1:201835497-201835519 TTAAGGAGAATCTAGAGTCAGGG + Intronic
920348019 1:205319083-205319105 CGAAGGACAGTCAAGAGGCAGGG + Intronic
921930350 1:220749260-220749282 TGAAGGATGAGCAAGTGGCATGG + Intronic
922279763 1:224112693-224112715 TAAAGGATACTAAAGAGACAGGG - Intergenic
922710053 1:227821539-227821561 TCACGGATAAACAAGAGCCATGG - Intronic
922737907 1:227999262-227999284 TGGAGCATAAGCCAGAGCCAAGG - Intergenic
923939938 1:238810305-238810327 TGAAAGATAAATTAGAGCCAGGG - Intergenic
924178415 1:241416518-241416540 TGAAGTATGAACATGAGCCAGGG - Intergenic
1063987460 10:11520591-11520613 TGAAGGATATTTAGGAGGCAAGG - Intronic
1069224434 10:65924336-65924358 TGAAGCATAATCAAGATGCAGGG - Intronic
1071351556 10:84751415-84751437 TGAAAGAACATCTAGAGCCAGGG + Intergenic
1071821107 10:89281916-89281938 TGATGGAGAACCAAGAGCCAGGG - Intronic
1077976890 11:7256002-7256024 AAAAGTATAATCAAGATCCATGG - Intronic
1078454328 11:11463451-11463473 AGAAGGATAAATACGAGCCAGGG + Intronic
1079143660 11:17831919-17831941 TGAAGGAGAGGCAAGAGTCAGGG - Intronic
1079147177 11:17863463-17863485 TGAGGGATAAGCATGAGCAAAGG - Intronic
1079607475 11:22388382-22388404 TGAAAAATAATCAAGATTCAGGG + Intergenic
1081419842 11:42863029-42863051 TAAAGGATGAACAACAGCCAGGG - Intergenic
1083167563 11:60900523-60900545 TGAGGGACAAACAACAGCCAAGG + Intronic
1084994031 11:72957522-72957544 TGAAGGAGACTAAAGAGACATGG + Intronic
1085235662 11:75013350-75013372 TGAAGGATAATGGAGATCAAAGG - Intronic
1090475423 11:127015761-127015783 TGAAGGATCATCCAGCTCCATGG + Intergenic
1090987363 11:131780654-131780676 AGAGGGAAAATCAAGTGCCATGG - Intronic
1091253303 11:134162210-134162232 TGAAGGTGGAGCAAGAGCCAAGG - Intronic
1091385828 12:93982-94004 TGCAGGATGAACAAGAGGCATGG - Intronic
1092970376 12:13688278-13688300 TAAATCATAATCAAGAGCCTAGG - Intronic
1093617169 12:21240304-21240326 GGAAGGCATATCAAGAGCCAAGG - Intergenic
1093990429 12:25583849-25583871 AGAAGGAAAATCACAAGCCAGGG + Intronic
1095275639 12:40279972-40279994 TGAAGGACTATCTAGAGCAAGGG + Intronic
1096726983 12:53572354-53572376 TGCATGACAATCAAGTGCCAGGG + Intronic
1098470299 12:70835721-70835743 TGAAGAAAAATCAAGAGTCAAGG - Intronic
1101851175 12:108403612-108403634 TGAAGAAATATCAAGATCCATGG + Intergenic
1102461054 12:113099886-113099908 GGAAGGAGGAGCAAGAGCCAGGG - Exonic
1103197733 12:119059749-119059771 AGAAGAGTAGTCAAGAGCCAGGG - Intronic
1105599924 13:21877583-21877605 TTAAGGATAAACAGGAGCCAGGG + Intergenic
1107266152 13:38557623-38557645 TGATGGATAATAAAGAGACATGG + Intergenic
1109514350 13:63422463-63422485 GGAAGGATTATCAAAAGGCATGG + Intergenic
1109625949 13:64974669-64974691 TGAAGGATAAACAAGATCATTGG - Intergenic
1114735364 14:25038098-25038120 TGAAACATAAACAAGAGGCACGG + Intronic
1117248188 14:53908152-53908174 AGATGGCTAATCAAGAGGCAAGG - Intergenic
1118393626 14:65317218-65317240 AGAAGGATAATAAAGAGCCCAGG - Intergenic
1119191368 14:72684450-72684472 TGAAGGAAAACCAAGAGGCAAGG + Intronic
1124397458 15:29316278-29316300 TGAAGGATAATCAAGAGACATGG + Intronic
1124411060 15:29437562-29437584 TGAAGGATAATCAAGAGCCAGGG - Intronic
1125289926 15:38134811-38134833 TAAAGAATGATCAAGAGCTAGGG + Intergenic
1128034270 15:64509707-64509729 TGGAGAATAAACAAAAGCCATGG - Intronic
1128757448 15:70192934-70192956 GGAAGAGTAATTAAGAGCCATGG - Intergenic
1128956147 15:71947751-71947773 TGAAGGATCAGCAATTGCCAGGG - Intronic
1130219399 15:82006363-82006385 GGAAGAATAATCATGATCCATGG + Intergenic
1130676128 15:85953600-85953622 TGAAGGATTCTAAAGAGGCATGG + Intergenic
1132051478 15:98611172-98611194 TGAAGGTTAAGCAAGAACCCGGG + Intergenic
1135683839 16:24481675-24481697 TGTAGAATGATTAAGAGCCAGGG - Intergenic
1138971522 16:62150092-62150114 TGAAAGATGTTCAAGAGCTAAGG - Intergenic
1139496143 16:67319986-67320008 TATAGGATTTTCAAGAGCCAGGG + Intronic
1142913626 17:3115776-3115798 TGAAGGGTAGGCAAGAGTCAAGG + Intergenic
1144817066 17:18041826-18041848 AGAAGGAGAATCATGAACCAGGG + Intronic
1145199409 17:20928905-20928927 TGAAATATGATTAAGAGCCATGG - Intergenic
1145941383 17:28744964-28744986 TGATGGATGCCCAAGAGCCAAGG - Intronic
1146565432 17:33908980-33909002 TGAAGGCTGATCCTGAGCCAAGG - Intronic
1147981167 17:44275094-44275116 TGAGGGAAAATTAAGAGTCAAGG - Intergenic
1148523218 17:48301810-48301832 TGGAAGAAAATCAGGAGCCAGGG - Intronic
1149413994 17:56439162-56439184 TGCAGGATCATCCAGAGCAAGGG + Intronic
1150485536 17:65540834-65540856 TGCAGGCTATTCAAGAACCATGG - Intronic
1150662207 17:67092668-67092690 TGAAAGATAATCAAGCGGCCAGG + Intronic
1152169093 17:78731865-78731887 TGCAGGATTATCAAAATCCAAGG + Intronic
1153388154 18:4523097-4523119 TGATGGATAATGATGAGCCATGG - Intergenic
1156342129 18:36219375-36219397 GGAAGGATATACAAGAGCAAAGG + Intronic
1156949818 18:42881490-42881512 TGCAGGATCATGAAGAGCCTTGG - Intronic
1157358118 18:46953848-46953870 TGTAGGATAATCAGGTACCAGGG + Intronic
1157970319 18:52259915-52259937 TGAAGGAAATTCAAGATTCATGG - Intergenic
1158692383 18:59672203-59672225 TGAAGGAGGATCATGATCCATGG + Intronic
1158983999 18:62794988-62795010 TGATGGATAATAAAGAGGCTGGG - Intronic
1159697364 18:71576684-71576706 TGAAGGATAATCAATAAACACGG + Intergenic
1162528957 19:11224564-11224586 TGAAGGATACCAAAGAGCCATGG + Intronic
1164144593 19:22504309-22504331 TGAAGGACAGTGACGAGCCAGGG - Intronic
1166228031 19:41409266-41409288 TGAGGGATAACCAGGAGGCAGGG - Intronic
1166777796 19:45323208-45323230 TGAAGGAGACTCAGGGGCCAGGG - Intergenic
1167730672 19:51251978-51252000 TGAAGGAAAATTGAGAGACATGG + Intronic
1168588162 19:57611396-57611418 GGAAGGAGAATAAAGAGCCTGGG - Intronic
925872007 2:8279522-8279544 TGTAGGGTGATCAGGAGCCATGG - Intergenic
929389417 2:41452258-41452280 TCAAGGAAGATAAAGAGCCATGG + Intergenic
930047167 2:47182948-47182970 TGAAGGGAAATCAGGAACCAGGG + Intergenic
930517413 2:52425191-52425213 GCAAGGATAATAAAGAGCTATGG - Intergenic
937657229 2:124390171-124390193 TGTTGGATTATCTAGAGCCAGGG - Intronic
937875265 2:126820306-126820328 TTTAAGATAATCAACAGCCAAGG + Intergenic
938144080 2:128819737-128819759 TACAGGATACTCAAGGGCCAGGG - Intergenic
939753930 2:146085767-146085789 GGAGGCAGAATCAAGAGCCATGG - Intergenic
940735119 2:157442109-157442131 TGAAGGGTATTCCAGAGCAAGGG - Intronic
940777822 2:157903130-157903152 TGAAGGCTAATCACCTGCCAGGG + Intronic
941009573 2:160284398-160284420 TGAAGAATAAACAAAAGCAAGGG + Intronic
941417834 2:165243973-165243995 TGGATTATAAGCAAGAGCCACGG - Intronic
942324219 2:174761774-174761796 AGAAGGATTATCAAGTCCCAGGG - Intronic
942417377 2:175773116-175773138 TGAAGGATTTTAAAGAGCCACGG + Intergenic
943521363 2:188954395-188954417 TGAAGGAAAATAAAGATACATGG - Intergenic
943842174 2:192597634-192597656 TGAAGGAGAATATAGACCCAAGG - Intergenic
943846056 2:192649849-192649871 TGAAGGAAAATATAGACCCAGGG + Intergenic
944006902 2:194920653-194920675 TGAAGTATAAACAAGATCCAAGG + Intergenic
944941798 2:204636386-204636408 ATAAGGATAATAAAGAGCCTAGG - Intronic
945088581 2:206158356-206158378 TGAAGGATAAGGAGGGGCCAGGG - Intronic
945097854 2:206236724-206236746 TGCAGCAGAATAAAGAGCCATGG + Intergenic
945811032 2:214550353-214550375 TGAAGTTTAAGAAAGAGCCAAGG - Intronic
946061276 2:216943597-216943619 TGAAGGATATTAACGAACCAAGG - Intergenic
1170905188 20:20508876-20508898 TGAAGGTTGATCAAGGGGCAGGG + Intronic
1171991559 20:31700456-31700478 TGTAGGATCTTCAAGTGCCAGGG - Intronic
1172809429 20:37636859-37636881 TGCAGGGTAATGAGGAGCCATGG + Intergenic
1172961570 20:38804258-38804280 TGATTGATAATGAAGAGCCATGG - Intergenic
1174776584 20:53348452-53348474 TTGAGGATAGTCAAGAACCATGG + Intronic
1175147914 20:56910756-56910778 TGTAGGCTATTCCAGAGCCAGGG + Intergenic
1176918943 21:14663332-14663354 TGAAGGAGAATCGAGAGCTCCGG + Intergenic
1177102051 21:16910406-16910428 TGAAGGATAGTCAAGATTCATGG + Intergenic
1177310665 21:19388178-19388200 TTAAGCATAATGAAGAACCATGG + Intergenic
1178085227 21:29105507-29105529 TAAAGGACATTCAAGAGCTATGG + Intronic
1182008404 22:26980363-26980385 TGCAGGATCATCAGGAGCCTGGG + Intergenic
1184237671 22:43193126-43193148 AGAACTATAATCAAGAGTCAGGG - Intergenic
949399508 3:3651316-3651338 TGAAGGAGAATCAGAACCCATGG - Intergenic
952113367 3:30150389-30150411 TGAAGGAGAATAAAAAGACATGG + Intergenic
952755307 3:36860595-36860617 TGTAGGCTAAACCAGAGCCAAGG + Intronic
952796909 3:37247496-37247518 TGATGGATAATGAAAAGTCATGG + Intronic
952860697 3:37810098-37810120 AGAAGGACATTCAAGAGCCACGG - Intronic
953214967 3:40909529-40909551 TGAATGATATTTAAGGGCCAAGG + Intergenic
953352791 3:42228599-42228621 TAAAGGAGAATAAAGAGACAAGG + Intergenic
954466411 3:50657741-50657763 GGAAGCCTAATTAAGAGCCATGG - Intergenic
954713033 3:52514313-52514335 TGCAGGATAACCAAGTGCCCTGG - Intronic
955453206 3:59092809-59092831 AGAAGGATAATCATGAGACTGGG - Intergenic
958504633 3:94958775-94958797 TGCAGGATAATCAGGAATCAGGG - Intergenic
959027762 3:101260532-101260554 TGAAGGCTAATAAAGAGCAAGGG - Intronic
960397647 3:117156719-117156741 TGAAGGATAAAGAAGAACCCAGG + Intergenic
961624947 3:128255270-128255292 TGAAGGATAGTCAAGGGCCATGG + Intronic
962166546 3:133055450-133055472 TGAAAGATGGCCAAGAGCCAGGG + Intronic
962852408 3:139317971-139317993 TGCAGGATGATACAGAGCCAGGG + Intronic
962963128 3:140329874-140329896 TCAATGTTACTCAAGAGCCAGGG + Intronic
964136687 3:153352363-153352385 TGGAGGATAATAAACAGCTAAGG + Intergenic
964287297 3:155132178-155132200 TGAATGACAATCAAGACCCAGGG - Intronic
965242789 3:166225420-166225442 GCAAGGATAATCATGGGCCATGG + Intergenic
965370425 3:167855419-167855441 GGAAGCATATTCAAGAGTCAAGG + Intergenic
966626823 3:182025886-182025908 TGGAGGATCATCAATAGACAAGG - Intergenic
967248986 3:187517772-187517794 AAAAGGATTATCAAGAGCCAAGG + Intergenic
967327338 3:188254605-188254627 TGAAGGAAAAATCAGAGCCAAGG + Intronic
967498380 3:190168040-190168062 TGCTGGATAATCAGGAGCCAGGG + Intergenic
969143745 4:5102248-5102270 TGCAGGATCATCAAGAGCCCAGG - Intronic
969512755 4:7628948-7628970 CAAAGGATAATCAGGAGTCAGGG + Intronic
970007158 4:11422636-11422658 TGAACGACAATCAATAGCAAAGG + Intronic
970139338 4:12964280-12964302 TGATGGATGATAAAGAGTCAAGG - Intergenic
970379678 4:15494245-15494267 TGAAGTATAAAGAAGAGCAAGGG + Intronic
971000176 4:22313597-22313619 GGAAGGATAATCTAGTGGCAGGG + Intergenic
973928260 4:55761970-55761992 TGTATGATAATCACGAACCATGG - Intergenic
973949573 4:55997991-55998013 TGAATGATGATCAAGAGGTAGGG - Intronic
974207922 4:58730742-58730764 GAAAGGATAATCAAAACCCATGG - Intergenic
974371732 4:61024844-61024866 TGAAGCAGAATCAAGAGGCCAGG - Intergenic
976765933 4:88597571-88597593 TCAAGGATATACAACAGCCAGGG - Intronic
978074074 4:104507349-104507371 TGAAGGATATTTGAGAGCCAAGG - Intergenic
979736382 4:124091184-124091206 TGAGGGCTGATCAAGAGCCCAGG + Intergenic
979972589 4:127155471-127155493 TGAAGGACAATGAAGATACATGG + Intergenic
980145486 4:128978548-128978570 TTAAGGAAAATCAACAACCAAGG + Intronic
980524631 4:133973528-133973550 TCAAGGATAATGCAAAGCCATGG - Intergenic
981145552 4:141320117-141320139 TGAAGGATGATGCAGAGCCAGGG - Intergenic
981301609 4:143192936-143192958 TGAAGGATAATGAAAAGCCATGG + Intronic
981816222 4:148833886-148833908 AGTAGGGTAATTAAGAGCCAAGG - Intergenic
981859045 4:149332719-149332741 TGATGGATAATGATGAGTCATGG - Intergenic
983123837 4:163924342-163924364 TGAAGAAAAATCATGAGCTAAGG + Intronic
983875496 4:172870162-172870184 TTAAGGATCATAAAGAGCCTAGG + Intronic
984184142 4:176521649-176521671 ACAAGGATGATGAAGAGCCAAGG - Intergenic
987856042 5:23422203-23422225 AGAAGGATAATCAAGGGCAAGGG + Intergenic
988276420 5:29087028-29087050 TGTAGAATAATCAAGGGTCAGGG - Intergenic
989421869 5:41249757-41249779 TGAGGAATAATCAATATCCATGG - Intronic
992015009 5:72566827-72566849 AAAAGGAAAATCAAAAGCCATGG + Intergenic
993777279 5:92015055-92015077 TGAAGGAGAATCATTAGCCAAGG - Intergenic
994493910 5:100486010-100486032 TGAAGGATACACAAAAGCAAGGG + Intergenic
995925686 5:117370348-117370370 AGAAGGAGAATGAAGAGCAAGGG - Intergenic
997019094 5:129975686-129975708 TTCAGGATAGTCAAGAACCAAGG + Intronic
997943738 5:138181210-138181232 TGCAGGATAATGACGAGACAGGG + Intronic
998216664 5:140242851-140242873 TAAAGAATAATCAAGAGCCCTGG - Intronic
999119333 5:149197136-149197158 TGTAGGATACTGAAGAGCCGTGG - Intronic
1000389304 5:160706517-160706539 GGTAGAAAAATCAAGAGCCAAGG - Intronic
1000428115 5:161116486-161116508 TGATGGAGAAGGAAGAGCCAAGG - Intergenic
1001240356 5:170064224-170064246 TGAAGGAAAATGAAGAAACAGGG + Intronic
1002848539 6:970188-970210 TGAAGGGCAAGCAAGACCCATGG - Intergenic
1003177886 6:3766888-3766910 TGAACGAAAATGAACAGCCACGG - Intergenic
1003183859 6:3813828-3813850 TAAAGGAAAAACAAAAGCCATGG + Intergenic
1004058045 6:12161150-12161172 TGGAGGGTAATCAAGAAACAAGG - Intronic
1005287876 6:24348218-24348240 TGAAGGATTCTGAAGAGCTAAGG + Intronic
1006047469 6:31309178-31309200 TGGGGGAAAAACAAGAGCCAAGG + Intronic
1007436479 6:41816191-41816213 TCAAGGATAGTCTAGAGGCAGGG - Intronic
1008064225 6:47030396-47030418 TGAAGAATAATCTAGAGCCCAGG - Intronic
1010018505 6:71132379-71132401 TGAAATATAATCAAGAACCCAGG - Intergenic
1010112997 6:72264139-72264161 TAAAGCATAATCAAGAGGGAAGG - Intronic
1010784230 6:79981527-79981549 TGAGGGATCCTCAAAAGCCATGG - Intergenic
1011753538 6:90476632-90476654 TGGAGGATACTCAAAAGGCAAGG + Intergenic
1012053926 6:94380793-94380815 TGAAGGATAAACAAGAACAGAGG - Intergenic
1014488055 6:122025462-122025484 TGAAGGGTAATGAAGAGAGAGGG + Intergenic
1019060084 6:169251400-169251422 TGCAGGAAAATAAAGAGGCAGGG - Intronic
1020176169 7:5883866-5883888 TACAGGATAATAAAGATCCATGG - Intronic
1022878737 7:34564024-34564046 CGAAGGACAATGATGAGCCAGGG + Intergenic
1025640909 7:63367864-63367886 TGGAGCACACTCAAGAGCCAGGG + Intergenic
1027430913 7:78111772-78111794 TGAAGGATGATTAAGAGTGATGG + Intronic
1027710200 7:81591238-81591260 GGAAGGATGATCCAAAGCCAGGG - Intergenic
1028511524 7:91630212-91630234 TGTAGTATAATTAAGAGTCAGGG - Intergenic
1028808945 7:95061742-95061764 TGAATGAAAATAAAGAGCCATGG + Intronic
1029082654 7:97987158-97987180 TACAGGATAATAAAGATCCATGG + Intronic
1030583579 7:111389286-111389308 TGAAGGAGAGCAAAGAGCCAGGG + Intronic
1030745204 7:113157014-113157036 AGAAGGATAAGCCACAGCCAAGG - Intergenic
1031426729 7:121614671-121614693 GGATGGATAATCAATAACCAAGG - Intergenic
1033454701 7:141492237-141492259 TGAAGGATGATTAGGAGCGAGGG - Intergenic
1034042016 7:147887563-147887585 TGAAGAAAAATCATGAACCAAGG + Intronic
1034672818 7:152870878-152870900 TGCAGGATGATCCAGAGCCGGGG + Intergenic
1034672830 7:152870930-152870952 TGCAGGATGATCCAGAGCCGGGG + Intergenic
1034672842 7:152870982-152871004 TGCAGGATGATCCAGAGCCGGGG + Intergenic
1034672854 7:152871034-152871056 TGCAGGATGATCCAGAGCCGGGG + Intergenic
1035770520 8:2143221-2143243 TGAGGGATAAACCAAAGCCAAGG - Intronic
1042949336 8:74184915-74184937 GGAAGGAGAAAAAAGAGCCAGGG - Intergenic
1043802523 8:84628285-84628307 TGAAAGATGAGGAAGAGCCAGGG - Intronic
1044316672 8:90757194-90757216 TGAATGAAAATAAAGAGTCAAGG - Intronic
1044327124 8:90871190-90871212 TGAAGGCTATTAAAGAGCAATGG - Intronic
1045069409 8:98485716-98485738 TGAAGGATAATGAAGTGGCAGGG + Intronic
1045350766 8:101337040-101337062 TGAAGGATAAATAAGAGGAAAGG - Intergenic
1046994247 8:120498697-120498719 TGAAGGCTGATTAGGAGCCAAGG + Intronic
1047003858 8:120599213-120599235 TGATGAATAATCAAGGACCAAGG - Intronic
1047648546 8:126895245-126895267 TAAAGGATAAGTAAGAGCCAGGG + Intergenic
1050421444 9:5469643-5469665 TGAAAGATAATGAAAAGCTATGG - Exonic
1050490740 9:6185419-6185441 TGAGGGAAAATAAAAAGCCAAGG + Intergenic
1051007355 9:12362316-12362338 TGAAGGACACACATGAGCCAGGG + Intergenic
1052204690 9:25825771-25825793 TGAAGGACAAACAAAAGCTAAGG - Intergenic
1052319628 9:27154100-27154122 TGGAAAAGAATCAAGAGCCATGG - Intronic
1054830226 9:69616782-69616804 TGAGGGAAAATCAAAACCCAAGG + Intronic
1056091607 9:83211146-83211168 TGAAGGAGACTAAAGAGGCATGG - Intergenic
1057980910 9:99662256-99662278 TTAAGGAGCATCAGGAGCCAAGG - Intergenic
1058056046 9:100449901-100449923 TCAAGGATAGTCAAGTACCAGGG + Intronic
1059980561 9:119767080-119767102 TGAGGGATACTCAACAGTCAAGG + Intergenic
1060391001 9:123276668-123276690 TGAATGAGATTCTAGAGCCATGG - Intergenic
1060882239 9:127125358-127125380 TGGAGGAGGATGAAGAGCCATGG + Intronic
1062102778 9:134737251-134737273 TGCAGGATAATCAGTACCCATGG + Intronic
1187039354 X:15577317-15577339 TGAGGAAGAATCAAAAGCCATGG + Intronic
1187106472 X:16248040-16248062 AGAAAGATAACCAAGAGCCATGG - Intergenic
1188016981 X:25116765-25116787 GGCAGGGTATTCAAGAGCCATGG - Intergenic
1188100652 X:26079392-26079414 TAAAGGCTAGTCAATAGCCAAGG - Intergenic
1189565309 X:42235448-42235470 TCAAGAATAGTCAAGAGCCTGGG - Intergenic
1190738555 X:53272104-53272126 TAAAGGTTAAGTAAGAGCCAGGG - Intronic
1192072668 X:67957751-67957773 TGGAGGAGAATAATGAGCCAGGG - Intergenic
1192272391 X:69594104-69594126 AGAAGAAGAATCAAGAGCCCAGG + Intergenic
1192994853 X:76502332-76502354 TAAAGGACAATCAAGAGCTTGGG + Intergenic
1194009793 X:88547323-88547345 AGAAAGATAATGAAAAGCCAAGG - Intergenic
1198204221 X:134451283-134451305 GGAAGGATAAACAAAAGCTATGG + Intergenic
1198244664 X:134818622-134818644 TGAAGAATAACTGAGAGCCAAGG + Intronic
1199479471 X:148282328-148282350 TAAAGGAGAAACAAGAGTCAAGG + Intergenic
1199802759 X:151267872-151267894 TTAGGGGTAATCTAGAGCCAGGG + Intergenic
1200366082 X:155666097-155666119 TGAAGGATCAGCAAGTGCAAAGG + Intronic
1202023336 Y:20491633-20491655 TGATGGTTAATCAAGGTCCAAGG - Intergenic