ID: 1124415985

View in Genome Browser
Species Human (GRCh38)
Location 15:29473613-29473635
Sequence AAAGATAGACTTCAGTGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124415978_1124415985 27 Left 1124415978 15:29473563-29473585 CCTGGGAGCGGAAGGCCACCTGT 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1124415985 15:29473613-29473635 AAAGATAGACTTCAGTGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 149
1124415981_1124415985 12 Left 1124415981 15:29473578-29473600 CCACCTGTGGTCTTGGTTTTAGG 0: 1
1: 0
2: 0
3: 12
4: 162
Right 1124415985 15:29473613-29473635 AAAGATAGACTTCAGTGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 149
1124415983_1124415985 9 Left 1124415983 15:29473581-29473603 CCTGTGGTCTTGGTTTTAGGACC 0: 1
1: 0
2: 2
3: 11
4: 204
Right 1124415985 15:29473613-29473635 AAAGATAGACTTCAGTGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124415985 Original CRISPR AAAGATAGACTTCAGTGCTC AGG Intronic
902124894 1:14201102-14201124 AAAGATGGCCTTCAGAGATCTGG + Intergenic
907151998 1:52297577-52297599 AAAGAACCATTTCAGTGCTCTGG - Intronic
908057574 1:60306217-60306239 TAAGAAAGATTTCAGTGATCAGG - Intergenic
909118524 1:71570970-71570992 AAAGATAGACATCAGTAATTTGG - Intronic
909376004 1:74942962-74942984 AAACATATACTTCTGTGTTCTGG + Intergenic
910795433 1:91092803-91092825 AACAATAGACTTCAGTACTGGGG + Intergenic
915857598 1:159406157-159406179 AGAGATAGACAGCAATGCTCAGG + Intergenic
916341718 1:163744565-163744587 AAAGAGAGACTTCATTTCTTTGG - Intergenic
917512123 1:175677357-175677379 AAAGAGAGACAGCAGTGCCCAGG - Intronic
917629977 1:176881804-176881826 CAAGATGAACTTCAGTGCTCAGG - Intronic
917667713 1:177241265-177241287 AAAAATTGGCTTCAGTGGTCCGG - Intronic
918426978 1:184420516-184420538 AAAGAAAGACATCATTGCTAAGG + Intronic
920395454 1:205642324-205642346 TAACATAGACTGCAGTGGTCTGG + Intergenic
920780130 1:208982117-208982139 TTAGATAGACTTAAGAGCTCAGG - Intergenic
920841806 1:209561648-209561670 AAAGAAAGACTGCAGTGGCCTGG - Intergenic
920970267 1:210737307-210737329 AAAGGTAGATTTCTGTGGTCTGG + Intronic
922366920 1:224874408-224874430 ACAGATAGATTTCAATGGTCTGG - Intergenic
922897607 1:229112636-229112658 AAAAAAAGACTTAAGTTCTCTGG + Intergenic
924023464 1:239809313-239809335 AAAAATAGACTTCAGAGGCCGGG - Intronic
1063417489 10:5886031-5886053 AAAGTTACACTTCTGTGCTGTGG + Intronic
1064299667 10:14112219-14112241 AAACATGGACTTGACTGCTCTGG - Intronic
1064967138 10:21026572-21026594 GAAGGTGGACTTAAGTGCTCAGG - Intronic
1067528899 10:47056103-47056125 AAAGGTAGGCTGCAGTGCTTTGG - Intergenic
1071315414 10:84391169-84391191 AAAGCCAGACTGCAGTGCTGTGG - Intronic
1071839528 10:89454730-89454752 CAAGAGAGACTTGAGTGGTCAGG - Intronic
1074486835 10:113892681-113892703 AAACAAACTCTTCAGTGCTCAGG + Intronic
1075021744 10:118957153-118957175 AATGATAGACCCCAGTGCTCAGG + Intergenic
1075959866 10:126559010-126559032 AGAGATGGACTTCAGTGATGTGG - Intronic
1076748040 10:132524239-132524261 AAGGACAGACTTCAGTCGTCTGG - Intergenic
1079620009 11:22542541-22542563 AAGGATAGACGTCAGTGATCAGG - Intergenic
1083471077 11:62884414-62884436 AAGGACAGACATCAGTTCTCAGG - Intronic
1085915094 11:80877268-80877290 AAAGATTTGCTTCAGTGCTTGGG + Intergenic
1086400944 11:86460471-86460493 ATAGATAGAATTCAATCCTCGGG - Intronic
1086780912 11:90904835-90904857 AAAAACAGACTTCAGTACTTTGG + Intergenic
1087289108 11:96300246-96300268 AAAGAAAGACTTCAACACTCCGG - Intronic
1090028806 11:123190061-123190083 TAGGATAGACTTCAGTGCAGAGG - Intronic
1090609906 11:128461818-128461840 AAAGATGGACTTCAGTGGGGAGG - Exonic
1091086342 11:132725226-132725248 AAATATTGACTTCTGTGCACTGG + Intronic
1092756922 12:11772403-11772425 AAAGATGGTTTTCAGTGATCAGG + Intronic
1092916619 12:13195055-13195077 AGAGATAGAATTCAGTTCTCAGG + Intergenic
1095589426 12:43887238-43887260 AAAGCTAGAATCCAGTGCTCAGG + Intronic
1097913194 12:64992760-64992782 AAAGATAGTCTTCATTCCCCAGG + Intergenic
1099286447 12:80718179-80718201 AGAGATTGACCTCAGTGCCCTGG + Intronic
1099679581 12:85807732-85807754 AAAAAAACACTTCAGTTCTCTGG + Intronic
1104705992 12:130947975-130947997 ACGGATAGACTTCAGGGATCAGG - Intergenic
1105406973 13:20141528-20141550 AGAGATAGAGCTAAGTGCTCTGG + Exonic
1107494863 13:40916363-40916385 TAAGATAGACTTGAGTCATCAGG - Intergenic
1108847320 13:54693738-54693760 AAATATACCCTTCAGTCCTCAGG - Intergenic
1109805280 13:67431484-67431506 AAAGCTTGATTCCAGTGCTCAGG - Intergenic
1113840790 13:113359995-113360017 ACAGATGGACGTCAGTTCTCTGG - Intronic
1114549546 14:23525100-23525122 AAAGAAAGACTGCAGGGCTTGGG + Exonic
1116056926 14:39875584-39875606 AAAGACAGTGTTGAGTGCTCAGG + Intergenic
1116964040 14:50996410-50996432 AACGAGAGACATAAGTGCTCAGG + Intronic
1119177412 14:72579360-72579382 CAAGATAGAGTGCTGTGCTCTGG - Intergenic
1121118165 14:91358014-91358036 CCTGATAGTCTTCAGTGCTCTGG - Intronic
1121222300 14:92295462-92295484 AAATATACACTTCAGTTCACCGG + Intergenic
1121896895 14:97657216-97657238 AAAGACAGAATTCAGGGCCCAGG + Intergenic
1124415985 15:29473613-29473635 AAAGATAGACTTCAGTGCTCAGG + Intronic
1128026598 15:64442583-64442605 AAAGATAGAATTCTTTTCTCTGG - Intronic
1128545538 15:68564611-68564633 AAAGAAAGATTTCACTGCTTTGG - Intergenic
1128947351 15:71836754-71836776 AAAGCAAAACTACAGTGCTCAGG + Intronic
1129657815 15:77536242-77536264 GAAGATAGACAGCAGTGCTGAGG + Intergenic
1131002624 15:88950872-88950894 AAGGAGAGACATCAGTGTTCTGG - Intergenic
1131029556 15:89175044-89175066 AAAGATAAACTTCAGTCCAGAGG - Intronic
1133124888 16:3640359-3640381 GAAGACAGAGTTCAGAGCTCAGG - Intronic
1135285539 16:21189613-21189635 ACAGAAAGACTGCAGTGCTGGGG + Intergenic
1135350682 16:21726618-21726640 ACAAAAAGACTTCAGTCCTCAGG + Exonic
1137499326 16:48998209-48998231 AAAGAGAGGCTTCTATGCTCTGG - Intergenic
1137768089 16:50993151-50993173 AAAGACTGGCTTCAGTGCTGTGG - Intergenic
1137895295 16:52205510-52205532 TGGGATTGACTTCAGTGCTCAGG - Intergenic
1138681284 16:58685076-58685098 AAAAAAAAACTCCAGTGCTCTGG - Intronic
1145303402 17:21655637-21655659 ACAGATAGACATCAGGCCTCAGG + Intergenic
1145346640 17:22046204-22046226 ACAGATAGACATCAGGCCTCAGG - Intergenic
1145836440 17:27957519-27957541 AAAAAAAGACTTCTGGGCTCAGG - Intergenic
1148809128 17:50279163-50279185 AAAGAGAGAATTCAGTCTTCTGG - Intronic
1149069348 17:52521233-52521255 AAAGACAGACTTCAGAGATCCGG + Intergenic
1153502802 18:5766536-5766558 AAAAATAGACCTCATTGCTTAGG + Intergenic
1153523948 18:5977709-5977731 AAAGATAGACTTCTGGGATTGGG - Intronic
1153850627 18:9090849-9090871 AAAGCCAGATTTCAGTGCTGAGG - Intergenic
1158227113 18:55212989-55213011 CAAGTCAGACTTCAGTTCTCTGG + Intergenic
1159771550 18:72551572-72551594 ACATATAGACTTCAGTGATGGGG - Intronic
925217272 2:2108028-2108050 AAAAATAAATTTCATTGCTCAGG - Intronic
927703642 2:25283681-25283703 AATGAGAGACCCCAGTGCTCAGG - Intronic
927866377 2:26590490-26590512 AAAGACGGAACTCAGTGCTCCGG - Intronic
930509954 2:52332085-52332107 AGAGAAAGACTTAAGTGGTCAGG - Intergenic
931280514 2:60787385-60787407 AAATACAGATTTCAGTGGTCTGG - Intronic
932875182 2:75443890-75443912 AATGATAGACTTCAAAGCTGCGG - Intergenic
933471014 2:82723320-82723342 AAAGGTAGAGTTCAGATCTCTGG - Intergenic
941345977 2:164370178-164370200 AAAATTGGACTTCAGTGTTCAGG - Intergenic
942367873 2:175247778-175247800 AAAGAAAGACTTCATTGATGTGG + Intergenic
942825294 2:180168628-180168650 AAATATATACTACAGTGTTCAGG - Intergenic
943162111 2:184267896-184267918 AAAGTTCTACTTCAGGGCTCTGG + Intergenic
1169012528 20:2262437-2262459 CAAGTTAGAGTTCAGTGGTCAGG - Intergenic
1169461187 20:5797050-5797072 AAAGATAGAATCCAGAGCTCTGG - Intronic
1169531013 20:6485073-6485095 AAAGAAAGACATCACTGCTTTGG - Intergenic
1170381908 20:15770401-15770423 AAAGACTGACTTCACTTCTCTGG + Intronic
1171316361 20:24199261-24199283 AGAGTTAGACTGCTGTGCTCAGG - Intergenic
1171520919 20:25773328-25773350 ACAGATAGACATCAGGTCTCAGG + Intronic
1171556004 20:26083163-26083185 ACAGATAGACATCAGGTCTCAGG - Intergenic
1172510349 20:35496694-35496716 ACAGAAAGAGCTCAGTGCTCAGG + Exonic
1173644311 20:44624081-44624103 AAAGACACACTTCAGAACTCAGG + Intronic
1174044075 20:47720954-47720976 AAACAAAGACTTCAGTCCTGTGG - Intronic
1174625442 20:51910626-51910648 AAAGATATACCTTTGTGCTCTGG - Intergenic
1176654772 21:9578433-9578455 ACAGATAGACATCAGGCCTCAGG + Intergenic
1177702699 21:24659034-24659056 AAAGTAATACTTCATTGCTCTGG + Intergenic
1180291700 22:10854638-10854660 CAAGATGGACATCAGTACTCAGG - Intergenic
1180494505 22:15884060-15884082 CAAGATGGACATCAGTACTCAGG - Intergenic
1182351455 22:29702367-29702389 AAAGGGAGACTTCAGAGATCCGG - Intergenic
1183828234 22:40404903-40404925 AAATATAGACTCCAGGCCTCGGG + Intronic
1184498990 22:44860669-44860691 AGAGAAACCCTTCAGTGCTCTGG + Intronic
1185394309 22:50578884-50578906 AAAGGGACTCTTCAGTGCTCTGG - Intronic
951604652 3:24419580-24419602 AAAAATAGAATTCAGTTCTCTGG + Intronic
952346659 3:32494127-32494149 AAAGATAGGATTCAGGGCTCAGG + Intronic
956507238 3:69955125-69955147 AATGCTAGACTTCAGTTCTAGGG + Intronic
960355687 3:116650333-116650355 AAATATAGACTTCTCTGTTCTGG + Intronic
961755711 3:129126211-129126233 AGTCATAAACTTCAGTGCTCTGG + Intronic
962625254 3:137219693-137219715 AAAGTTAGAAGTCAGTTCTCGGG - Intergenic
965242597 3:166222105-166222127 AAAGAAAGACTATAGTGCTGGGG - Intergenic
966198029 3:177333203-177333225 AAATTTAGACTTTTGTGCTCAGG - Intergenic
970800129 4:19963523-19963545 AAATATAGAATTTAGTGCTCAGG - Intergenic
973258547 4:48137588-48137610 ACAGAGAGACTTCACTGCTTTGG + Intronic
973666779 4:53167917-53167939 AAAGGTAGACTTCAGTGTCTTGG + Intronic
973788439 4:54356856-54356878 AAACCCACACTTCAGTGCTCAGG - Intergenic
975468479 4:74736425-74736447 AAAAATAGACTTGAGTACACTGG - Intergenic
975850010 4:78562728-78562750 AAAGACAGTTTTAAGTGCTCTGG + Intronic
976314505 4:83644816-83644838 AGAGATGGATTTCAGTGCTGAGG + Intergenic
980493162 4:133556029-133556051 ATAGAAAGACTTCACTTCTCAGG - Intergenic
982992426 4:162295213-162295235 AAACATAAACTTCTGGGCTCTGG - Intergenic
985798167 5:1980343-1980365 AAAAGTAGACTTCAGTCTTCTGG + Intergenic
988079153 5:26394010-26394032 AAAAATAGATTTCATTCCTCTGG - Intergenic
989500296 5:42158542-42158564 AAAGACAGTCTGCACTGCTCAGG - Intergenic
990479310 5:56192922-56192944 AAATAAAGACTTCCGTGCTGTGG + Intronic
996483862 5:124007491-124007513 GAAGATAGAGTTCAGAGTTCTGG - Intergenic
997145181 5:131425448-131425470 AAAGTTACACTTCAGTGATTTGG - Intronic
999360050 5:150976514-150976536 AAGGAGTGACTTCATTGCTCTGG + Intergenic
999829617 5:155306161-155306183 AAAGTTAGTCTTCATTGTTCAGG + Intergenic
1009734708 6:67662323-67662345 AAAGATAGAGTACAGAGGTCAGG - Intergenic
1010329021 6:74600191-74600213 AAAGATAGCTTTCTGTTCTCAGG - Intergenic
1011105994 6:83782314-83782336 AAAAACTGACTTCAGTGCTCAGG + Intergenic
1012519775 6:100107044-100107066 AAAGATATTCTTCAGTTCTTTGG - Intergenic
1014633753 6:123819183-123819205 ATAGATAATCTGCAGTGCTCAGG + Intronic
1015512481 6:134052353-134052375 AAAGTGAGCCTGCAGTGCTCGGG - Intronic
1018610227 6:165641493-165641515 AAAGTTACACTTCAGTAATCTGG + Intronic
1021583195 7:22178641-22178663 AAACAGAGGCTTCTGTGCTCAGG - Intronic
1025281400 7:57628291-57628313 ACAGATAGACATCAGGCCTCAGG + Intergenic
1025303329 7:57837216-57837238 ACAGATAGACATCAGGCCTCAGG - Intergenic
1027136365 7:75627146-75627168 AGAGATAGCCTTGAGTGCACTGG - Intronic
1041712101 8:60904006-60904028 AACGGAAGACTTCAGTTCTCTGG + Intergenic
1041924277 8:63220519-63220541 AATGATAGCCTTCATTGCTAGGG + Intergenic
1046878645 8:119283774-119283796 AAAGATAGTCTCCAGAGTTCTGG + Intergenic
1047335933 8:123936247-123936269 GAAGATAGACCACATTGCTCAGG + Intronic
1049983538 9:926963-926985 ACAGACAGACGTCAGTTCTCTGG - Intronic
1051448659 9:17170466-17170488 AAAGAAAGACTACAGTACTTAGG - Intronic
1053344410 9:37367664-37367686 AAATTCAGACTTCAGTGATCTGG - Intergenic
1053538136 9:38946369-38946391 AAAGAAAGAGTTGAGGGCTCTGG + Intergenic
1054627998 9:67417552-67417574 AAAGAAAGAGTTGAGGGCTCTGG - Intergenic
1055122549 9:72678989-72679011 AAATATAGACTTCAGTGGGATGG - Intronic
1057687004 9:97243797-97243819 CAAGATAGACTTGAGTCATCAGG + Intergenic
1203632497 Un_KI270750v1:81891-81913 ACAGATAGACATCAGGCCTCAGG + Intergenic
1195196307 X:102500671-102500693 AAAGCTAAAAATCAGTGCTCAGG + Intergenic
1200093046 X:153644612-153644634 AAAGTCAGAGCTCAGTGCTCGGG - Intronic