ID: 1124417750

View in Genome Browser
Species Human (GRCh38)
Location 15:29487783-29487805
Sequence CAGGATAATTAGTTGAATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98561
Summary {0: 1, 1: 5, 2: 226, 3: 7991, 4: 90338}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124417750_1124417756 8 Left 1124417750 15:29487783-29487805 CCTGGATTCAACTAATTATCCTG 0: 1
1: 5
2: 226
3: 7991
4: 90338
Right 1124417756 15:29487814-29487836 TCCAGAGCAGCTGGGATTACAGG 0: 163
1: 7257
2: 117664
3: 258986
4: 245143
1124417750_1124417758 27 Left 1124417750 15:29487783-29487805 CCTGGATTCAACTAATTATCCTG 0: 1
1: 5
2: 226
3: 7991
4: 90338
Right 1124417758 15:29487833-29487855 CAGGCATGCACCACCACACCTGG 0: 3308
1: 11467
2: 35816
3: 78486
4: 152181
1124417750_1124417752 -1 Left 1124417750 15:29487783-29487805 CCTGGATTCAACTAATTATCCTG 0: 1
1: 5
2: 226
3: 7991
4: 90338
Right 1124417752 15:29487805-29487827 GCCTCAGCCTCCAGAGCAGCTGG 0: 284
1: 13285
2: 203943
3: 260195
4: 182163
1124417750_1124417754 0 Left 1124417750 15:29487783-29487805 CCTGGATTCAACTAATTATCCTG 0: 1
1: 5
2: 226
3: 7991
4: 90338
Right 1124417754 15:29487806-29487828 CCTCAGCCTCCAGAGCAGCTGGG 0: 350
1: 15254
2: 223441
3: 278622
4: 178387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124417750 Original CRISPR CAGGATAATTAGTTGAATCC AGG (reversed) Intronic
Too many off-targets to display for this crispr