ID: 1124417878

View in Genome Browser
Species Human (GRCh38)
Location 15:29489192-29489214
Sequence AGGCAGTAGCAGAAGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 668
Summary {0: 1, 1: 0, 2: 11, 3: 75, 4: 581}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124417878 Original CRISPR AGGCAGTAGCAGAAGCAGCA TGG Intronic
900510079 1:3054683-3054705 TGGCAGAGGCAGAAGCAGCTGGG + Intergenic
901110262 1:6787639-6787661 AAGCAGCAGCAGAAGAATCACGG + Intronic
901905232 1:12403222-12403244 AAGGAGTAGCAGGAGTAGCATGG - Intronic
901954661 1:12775438-12775460 AGAGAGTGGGAGAAGCAGCAGGG + Intronic
902037722 1:13469742-13469764 AGGCAGTGGCAACAGCAGCATGG + Intergenic
902343517 1:15799791-15799813 AGGCAGGAACCAAAGCAGCAAGG + Intergenic
902377334 1:16036052-16036074 CGGCAGTGGCAGGAGCAGGAAGG - Intergenic
903351979 1:22722886-22722908 AGCCAGGTGAAGAAGCAGCAAGG + Intronic
903788183 1:25875197-25875219 TGGGAGGAGCAGAAGGAGCACGG - Intergenic
904478299 1:30778250-30778272 TGGCATTATCAGAAGCAGAAGGG - Intergenic
906873692 1:49512650-49512672 AGGCTGTACAAGAAGCATCATGG - Intronic
907011496 1:50968200-50968222 AGGCAGCAGCAGCCGCAGCCTGG + Exonic
907472564 1:54683500-54683522 GGGCAGGAGCAGAATCAGGAAGG - Intronic
907971641 1:59388503-59388525 AGGCAGCAGCAGGAGAAGAAGGG + Intronic
908107185 1:60856939-60856961 CAGCAGAAGCAGCAGCAGCAGGG + Intergenic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
909344887 1:74573169-74573191 AGGGAGCAGCAGAAGCAGAAGGG - Exonic
909865293 1:80661123-80661145 AGTTTGTAGCAGAAGCATCAAGG + Intergenic
910141532 1:84031877-84031899 AGGCTGTAGCTAAAGCAGCTGGG + Intergenic
911054423 1:93698121-93698143 AGGCAGCAGCGGAAGCAGGATGG + Intronic
911732853 1:101308234-101308256 AGGAAACAGCAGAAGCAGGAAGG + Intergenic
912169159 1:107076967-107076989 AGGCAAAAGCAGAAACTGCAAGG - Intergenic
912565776 1:110586177-110586199 CTGCAGGAGCAGAAGAAGCAAGG - Intergenic
912681209 1:111730051-111730073 GGGCAGTGGCAGGAGCAACAAGG + Intronic
914775525 1:150730574-150730596 AGGAAATTGCAGAAGCAGGAAGG - Exonic
914826687 1:151142574-151142596 CAGCAGCAGCAGTAGCAGCAAGG + Exonic
914925986 1:151888125-151888147 AGGGAGTGGGAGAAGCAGGACGG - Intronic
915049265 1:153050092-153050114 TGCCAGGAGCAGAGGCAGCATGG - Intergenic
915185816 1:154104484-154104506 AGGCAGTGGCAGCAGCCACATGG + Intronic
915531159 1:156502924-156502946 AGGCTGTGGCAGTAGCAGGATGG + Intergenic
915571805 1:156748960-156748982 AGGAAGCAGCAAAAGCAGAAAGG + Intronic
915577693 1:156791391-156791413 AGGAAGTAGCTGAGGGAGCAAGG + Intronic
916456104 1:164972443-164972465 AGGCAGCAGCAGAGGCAGAAGGG - Intergenic
916562609 1:165946154-165946176 CGGCAGCAGTAGCAGCAGCAAGG + Intergenic
916574137 1:166052166-166052188 AGTCAGTGGCAAATGCAGCAGGG - Intergenic
916583529 1:166129714-166129736 GTGCAGGAGAAGAAGCAGCAGGG - Intronic
916700159 1:167284367-167284389 GGACAGTAGGAGATGCAGCATGG - Intronic
917109839 1:171536050-171536072 TGGCAGCAGCAGCAACAGCAAGG + Exonic
917235653 1:172888912-172888934 TGGCTGTAGCATAAGCAGCCAGG + Intergenic
917931979 1:179828897-179828919 AGTCAGTAGCAGAGGAGGCAGGG - Intergenic
918149321 1:181784570-181784592 AGGTAGGAGCTGAATCAGCAGGG - Intronic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920366750 1:205452000-205452022 AGGCAGAACCGGAGGCAGCAGGG + Intronic
920641919 1:207760785-207760807 TGGCAGGAGCAGGAGGAGCAAGG + Intronic
921812362 1:219529419-219529441 GAGCAGCAGCAGCAGCAGCAGGG + Intergenic
922226018 1:223646477-223646499 AGGCTGGCGCAGAAGCAGGAAGG - Intronic
923550102 1:234957135-234957157 AGCCGGTAGCAGAAACAGCTGGG - Intergenic
923918765 1:238540667-238540689 AGGCAGTACCAGGAGCAGCGAGG - Intergenic
924705686 1:246500074-246500096 AAGGAGCAGCAGCAGCAGCAGGG - Intronic
1062905730 10:1178400-1178422 AGGCAGGAGCAGAGGCCACAGGG - Exonic
1062955041 10:1534558-1534580 AGACAGTTTCAGAAGCATCAAGG - Intronic
1062962172 10:1580743-1580765 AGGGAGGAACAGAAGGAGCATGG - Intronic
1063223482 10:3992746-3992768 AGGCAGGTGCAGAGGCAGCCTGG + Intergenic
1064420773 10:15188915-15188937 AGCCAGTAGCTTAGGCAGCATGG + Intergenic
1065173843 10:23057898-23057920 AGGAAACAGCAGAAGCAGGAAGG - Intergenic
1065375799 10:25040130-25040152 AAGCAGAAGCAGAAGCTACAAGG + Intronic
1066041159 10:31549030-31549052 AGGCTGTACAAGAAGCAGCGTGG - Intergenic
1066224090 10:33365491-33365513 CGTCAGTAGCAGAAGCAGAGAGG + Intergenic
1067346070 10:45440041-45440063 AGGCAGTAGAAGAGGGAGCAGGG + Intronic
1067668388 10:48298407-48298429 AGGCAGTAGGGCATGCAGCATGG - Intergenic
1068147317 10:53088355-53088377 AGGCACAAGCACCAGCAGCAAGG + Intergenic
1068378283 10:56213197-56213219 AGGCAGCAGCAGCAGGGGCATGG + Intergenic
1068755580 10:60648853-60648875 GAGCAGGAGCAGAAGCAGCTTGG - Intronic
1068772905 10:60841812-60841834 GGACAGTAGCTGAAGCAGCCAGG + Intergenic
1069040156 10:63687444-63687466 AGGAAACAGCAGAAGCAGGAAGG - Intergenic
1069840687 10:71337540-71337562 AAGCAGCAGCAGAGGCAGCTGGG - Intronic
1069906316 10:71734629-71734651 AGGCAGAGGCAGCAGCAGGAGGG - Intronic
1070648601 10:78219059-78219081 AGGCAGAAACAAAGGCAGCAAGG - Intergenic
1071013306 10:80964403-80964425 AGAAAATAGCAGAAGCAGGAAGG - Intergenic
1071397456 10:85237969-85237991 GAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1071611722 10:87038202-87038224 CGGCAGTGGCAGCAGCAGCATGG + Intergenic
1072047590 10:91672226-91672248 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1072423665 10:95310862-95310884 GGGCAATAGCAGAAGCAGGGAGG + Intergenic
1072755652 10:98019154-98019176 AGGCAGGAGGAGGAGCAGGAAGG + Intronic
1073076341 10:100827583-100827605 AGGCAGCGGCAGCAGCGGCAGGG - Exonic
1073103553 10:101019523-101019545 AGGCAGAAGCAGAAGCAGAAGGG - Intronic
1073560243 10:104490063-104490085 AGGCAGAAGAGGAAGCACCAGGG - Intergenic
1075426725 10:122347518-122347540 AGGCCAGAGCAGAAGCTGCAAGG - Intergenic
1075441692 10:122484899-122484921 AGGCAGTGGCAGAGCCAGCCTGG + Intronic
1075486884 10:122829650-122829672 AAGCAGCTGCAGCAGCAGCAGGG - Intergenic
1076105985 10:127824117-127824139 AAGCAGAGGGAGAAGCAGCATGG + Intergenic
1076258281 10:129045785-129045807 AGGCTGGAGGAGAACCAGCATGG + Intergenic
1076758402 10:132587362-132587384 TGGCAGCAGCAGAAGCAGGCTGG - Intronic
1077370016 11:2177448-2177470 GGGCAGCAGCAGTAGCAGAAGGG - Intergenic
1077918740 11:6627402-6627424 AGCCTGTAGCTGCAGCAGCAGGG + Exonic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1078148452 11:8738605-8738627 AAGAAGTAGCAGTAGCAGCAGGG - Intronic
1078629978 11:12993489-12993511 AGACAGTACCAGAAGTTGCATGG - Intergenic
1078671460 11:13369456-13369478 AGGCTTTAACAGATGCAGCATGG - Intronic
1079075060 11:17379996-17380018 AGTCAGTGGCAGAAGCAGTCTGG - Intergenic
1079244236 11:18741310-18741332 AGGGAGTCCCAGGAGCAGCACGG + Intronic
1079257984 11:18849021-18849043 TGGCTGGTGCAGAAGCAGCAAGG - Intergenic
1079834966 11:25323020-25323042 GGGCTGGAGCAGAAGCAGCTGGG - Intergenic
1081652334 11:44832722-44832744 AGGCAGGAGCAGGTGCAGCAAGG - Intronic
1082828524 11:57598296-57598318 AGCCAGCAGCAGCAGCAGGAGGG - Exonic
1083773808 11:64883411-64883433 AGGCAGGGCCAGAAGCTGCAGGG - Intronic
1085130538 11:74034207-74034229 AGCCAGGAGTAGAAGCAACAAGG - Exonic
1085731443 11:79002319-79002341 TGTCAGTAGCTGTAGCAGCATGG - Intronic
1085802202 11:79601043-79601065 ATGCAGAGGCAGCAGCAGCAGGG - Intergenic
1086000235 11:81974734-81974756 AGACAATAGCAGAAGCAGGAAGG + Intergenic
1086080714 11:82900367-82900389 AGACAGAAGCAGGAGCAGGAGGG + Exonic
1086486915 11:87315120-87315142 AAGCAGTAGCAGCAGTAGTAGGG - Intronic
1086862602 11:91942920-91942942 AGGCAGTAGCTGAACCAGCCAGG + Intergenic
1086926287 11:92644056-92644078 AGGCAGCAGCAGAGGCACCCAGG - Intronic
1087515569 11:99154963-99154985 AGACAGTAGCAGAATCAGGCTGG + Intronic
1087539186 11:99493059-99493081 AGGTAGCAGTAGAAGCAGGAAGG - Intronic
1089294349 11:117458959-117458981 AGGCAGCAGGGGTAGCAGCAGGG - Intronic
1089407659 11:118211829-118211851 TGGGATTAGCAGATGCAGCATGG - Intronic
1089592839 11:119555713-119555735 AGGCAGGCACAGAACCAGCAGGG - Intergenic
1090672764 11:128961027-128961049 TGGCAGGAGTAGAAGCAACATGG - Intergenic
1091111353 11:132971930-132971952 CGGCAGCAGCAGTAGCAGCAGGG - Intronic
1091287169 11:134413855-134413877 GGGCAGGTGCAGAAGCAGGATGG + Intergenic
1091793146 12:3282998-3283020 AGGCAGGAGCTGCAGCAGCCTGG - Intronic
1091882573 12:3991327-3991349 AGGCAGTAACACAAGGTGCAAGG + Intergenic
1091941475 12:4487510-4487532 AGATAGGAGCAGAAGCAGAATGG - Intergenic
1091981343 12:4866605-4866627 AGGCAGTAGCACAAGCATGGAGG - Intergenic
1092153091 12:6264566-6264588 TGGCAGCAGCAGCAGAAGCAGGG + Intergenic
1092778801 12:11966522-11966544 AGGAAGTTGGAGACGCAGCATGG - Intergenic
1093176542 12:15918864-15918886 AGGGACTAGCAAAAGCAGCCTGG + Intronic
1094808035 12:34109530-34109552 AGGCTGTACCAGGAGCTGCAGGG - Intergenic
1095435391 12:42181305-42181327 AAGCAGTAGGAGAAGTAGTAAGG - Intronic
1095633847 12:44408195-44408217 ATGTAGTAATAGAAGCAGCAAGG - Intergenic
1095879224 12:47114602-47114624 AAGCAGTAGCAGAAGTAGTGGGG - Intronic
1096053742 12:48633591-48633613 AGGCAGCTGCAGGAGCAGCAAGG - Intergenic
1096321545 12:50618344-50618366 AGGCTGCAGGAGTAGCAGCAGGG + Intronic
1096493122 12:52023696-52023718 GGGCAGGAGGAGGAGCAGCAGGG - Intronic
1097474268 12:60034235-60034257 AGGCTGGAGCTGAAGCAGCCAGG + Intergenic
1097626434 12:62007107-62007129 TGGCTGGAGCAGAAGGAGCATGG - Intronic
1098327374 12:69316549-69316571 TGGCTGTAGCTGAAGCAGCTGGG + Intergenic
1098872321 12:75830542-75830564 CTACAGTAACAGAAGCAGCATGG + Intergenic
1099775453 12:87122168-87122190 AGGTAGTTGCTGAAGCAGGAAGG + Intergenic
1100280393 12:93112863-93112885 GGGCAGCAGCAGAAGGACCAAGG - Intergenic
1100415543 12:94369884-94369906 AAGCAGCAGCAGCAGCAGCAAGG + Intronic
1101572047 12:105962646-105962668 AAGAAGTAGTAGAAGCAGTAAGG + Intergenic
1101727824 12:107402783-107402805 AGGAGGTAGCAGAAGGGGCAAGG - Intronic
1101795413 12:107968506-107968528 AGCCAGTATCAGCAGCAGGATGG - Intergenic
1102701514 12:114843436-114843458 AGCCAGAAGCAGAAGGAGCGAGG - Intergenic
1102965031 12:117119133-117119155 AGCCAGCAGCAGCAGCAGCTTGG - Intergenic
1103128769 12:118448377-118448399 TGGAAGTGGCAGGAGCAGCAGGG + Intergenic
1103721946 12:122979901-122979923 TGGAAGTGGCAGAAGCAGAATGG - Exonic
1104846841 12:131851204-131851226 TGGCGGCAGCAGCAGCAGCATGG - Exonic
1105306440 13:19172383-19172405 CAGCAGTGGCAGCAGCAGCAGGG - Intergenic
1106112979 13:26793064-26793086 AGGAAACAGCAGAAGCAGGAGGG + Intergenic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107826439 13:44332727-44332749 AGGCAGCAGCAGCAGCAGGGAGG - Intergenic
1108008067 13:45972832-45972854 GGGCAGAAGCTGAAGCAGCAAGG - Intronic
1108676671 13:52743092-52743114 AGGCAGTAGAAAAAGCAGTAAGG + Intergenic
1109693064 13:65918581-65918603 AGGAATTAGCAGAGCCAGCAAGG - Intergenic
1110646946 13:77897610-77897632 AGGGAGTAACAGAAAGAGCAAGG - Exonic
1110761326 13:79233723-79233745 AGGCAGTTGCAGGACCAGGAAGG - Intergenic
1111296942 13:86291337-86291359 AGGCAGTACAGGAAGCATCAAGG - Intergenic
1112037371 13:95509111-95509133 AGGCAGTAACAGAAGCAGTTGGG + Intronic
1113254336 13:108490742-108490764 AGGCAGTAGCAAACGCTACAAGG + Intergenic
1113447339 13:110379540-110379562 TGGCTGCAGCAGAAGCTGCAAGG + Intronic
1115134347 14:30091014-30091036 TGGCAGTAGCAGGAGCAGTCAGG + Intronic
1116441785 14:44962438-44962460 GGGCGGCAGCAGAAGCAGCGCGG - Exonic
1116484730 14:45433975-45433997 CGGCAGCAGCAGCAGCAGCAGGG + Intergenic
1116548993 14:46210197-46210219 AGGCAGTAGAAAATGAAGCAGGG + Intergenic
1116709846 14:48354156-48354178 AGGCAGCAGCTGTGGCAGCAAGG - Intergenic
1117033700 14:51704629-51704651 AGGGAGGAGCAGAAACAGAAGGG + Intronic
1117972037 14:61261296-61261318 AGGGAATAGTTGAAGCAGCATGG + Intronic
1118062878 14:62160174-62160196 AGGCAGGAGCAGAACCAGGGAGG - Intergenic
1118398138 14:65355020-65355042 AGGCAGTAGGAGAAGCTGCCAGG - Intergenic
1118859650 14:69652702-69652724 AGGCAACAGCAGCAGCAGCTAGG - Intronic
1119133171 14:72193292-72193314 AGGCAGAAGTAAAACCAGCAGGG - Intronic
1119187087 14:72650688-72650710 AGGCAGATGGAGAGGCAGCATGG - Intronic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1119829263 14:77686494-77686516 AGGCACTAGCAGAAGGATGATGG + Intronic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121714954 14:96067213-96067235 AGGCAGTCGCGCCAGCAGCAAGG + Intronic
1122084126 14:99287711-99287733 AGGCAGTAGCAGCAGACGCAGGG + Intergenic
1122198135 14:100105058-100105080 AGGCAGTAGATGGAGCAGCAAGG - Intronic
1122473200 14:101986260-101986282 GGGCAGAAGCTGAAGCAGGATGG + Exonic
1122608774 14:102966746-102966768 AAGCGGCTGCAGAAGCAGCAGGG - Intronic
1123774531 15:23565832-23565854 AGGCAGGTGCTGAGGCAGCAAGG + Exonic
1124417878 15:29489192-29489214 AGGCAGTAGCAGAAGCAGCATGG + Intronic
1124585691 15:31004397-31004419 AGGTAGCCACAGAAGCAGCAGGG - Intronic
1125333722 15:38606883-38606905 AGGAAGCCGCAGAAGCAGAAAGG - Intergenic
1125376779 15:39038711-39038733 AGGCAGTAGGGGAAGCAGGGAGG - Intergenic
1125545076 15:40497501-40497523 TGGCAGAGGCAGGAGCAGCAAGG - Intergenic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1126384768 15:48082940-48082962 AGGCCATAGCAGGACCAGCATGG + Intergenic
1126878861 15:53072947-53072969 AAGCAGAGGCAGAAACAGCATGG + Intergenic
1127069153 15:55271211-55271233 AGGCAGAAGCTTAAGGAGCAGGG - Intronic
1127215501 15:56819395-56819417 AAGCAGCAGCAGGAGCAACAGGG - Intronic
1127543528 15:59967149-59967171 AGGCTGAAACAGAAACAGCAGGG - Intergenic
1128417427 15:67459474-67459496 AGAAAGAGGCAGAAGCAGCAGGG + Intronic
1129005545 15:72370116-72370138 AGGAAGTAGCAGCAACAGCTTGG + Intronic
1129333779 15:74840646-74840668 AGGCAAGAGGAGAGGCAGCAGGG + Intronic
1129360622 15:75021703-75021725 AGGAAGTAGAAGAAGCAGGCTGG + Intergenic
1129919913 15:79311278-79311300 GAGCAGCAGCAGAAGCAGCACGG - Exonic
1131254242 15:90851353-90851375 ACTCAGCAGCAGACGCAGCAGGG - Intergenic
1131254450 15:90852812-90852834 ACTCAGCAGCAGACGCAGCAGGG + Intergenic
1131435621 15:92419246-92419268 AGGCAGGCTCAGAAGAAGCAGGG + Intronic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1132391590 15:101442761-101442783 AAGCAGTAGCAGCCCCAGCAAGG - Intronic
1132664138 16:1073957-1073979 AGCCTGGAGCAGCAGCAGCAGGG - Intergenic
1133129212 16:3665842-3665864 TGGCAGCAGCAGCAGCAGCCAGG + Intronic
1133303317 16:4795951-4795973 CAGCAGCAGCAGGAGCAGCACGG - Exonic
1133344062 16:5058530-5058552 AGGCAGTAGCCTGAGCAGCCGGG + Exonic
1134091547 16:11394110-11394132 GGGCTGTAGCAGAAACACCAGGG - Intronic
1135105580 16:19646329-19646351 AGGCACAGACAGAAGCAGCAAGG + Intronic
1136363443 16:29796835-29796857 TGGTGGTAGCAGAAGAAGCAGGG - Intronic
1136394824 16:29987172-29987194 AAGCAGCAGCAGCAGCAGGAGGG - Exonic
1136541414 16:30929502-30929524 AGGCAGTTCCAAAAGCAGTAGGG - Intronic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1139099189 16:63744640-63744662 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139902716 16:70340953-70340975 AGGAAAGAGCAGAAGCTGCAAGG + Intronic
1140146923 16:72320099-72320121 AGCCTGGAGCAGAAGCAGCTGGG + Intergenic
1140376158 16:74446932-74446954 AGGCAGCAGCAGAAGGCTCAGGG + Intergenic
1140851162 16:78935932-78935954 AAGCAGCAGCAGCAGCAGCTAGG + Intronic
1141128311 16:81416953-81416975 CGGCAGCAGCAGCAGCAGCTAGG + Intergenic
1141775729 16:86121638-86121660 AGGCAGGAGGAGGAGCAACAAGG - Intergenic
1142338963 16:89508422-89508444 ACGGAGCAGCAGCAGCAGCACGG - Exonic
1142907185 17:3051847-3051869 AGGCAGTAACAGAAGCATAAAGG - Intergenic
1142927383 17:3252409-3252431 AGGCAGTAACAGAAGCATAAAGG + Intergenic
1143130729 17:4675321-4675343 GGGCAGCAGCAGCAGCCGCAGGG + Exonic
1143870279 17:9953310-9953332 AAGGAGTGGCAGAAGCAGCAGGG - Intronic
1144360503 17:14487309-14487331 TGGCTGGGGCAGAAGCAGCAGGG + Intergenic
1144449391 17:15363669-15363691 AGGCAGGAACAGGAGCAGCAGGG - Intergenic
1146232956 17:31130381-31130403 TGCCAGTAGCAGTGGCAGCAAGG + Intronic
1146299612 17:31677946-31677968 AGTCAGAAGCTGAAGGAGCAGGG + Intergenic
1146533113 17:33627489-33627511 TGGCAGGAGCAGCAGCAGGAGGG - Intronic
1147964788 17:44188715-44188737 CAACAGTAGCAGCAGCAGCAAGG + Intronic
1148133608 17:45277384-45277406 TGGCAGTAACAGAACCAGCTTGG + Intronic
1149604216 17:57913578-57913600 AGGGAGGAGCAGAGGCTGCAGGG + Intronic
1149634695 17:58157222-58157244 CGGCAGCAGCAGTAGCCGCAGGG - Intergenic
1150484123 17:65532421-65532443 AAGCAGCAGCAGCAGCAGCCAGG + Intronic
1150881106 17:69029383-69029405 AGGCACTGGCAGAAGCACCCAGG + Intronic
1150914485 17:69422784-69422806 AGTCAGTGGCAGAGGCAGGATGG + Intronic
1151038743 17:70832878-70832900 ATGCAGAAGCAGCAGTAGCAGGG + Intergenic
1151590333 17:75039490-75039512 AGGAACTTGCAGAAGCAGCCGGG - Intronic
1152148039 17:78581011-78581033 AGGCAGAAGCTGAAGAAGGATGG - Intergenic
1152481998 17:80560550-80560572 AGCCAGTAGCTGAAACAGAATGG + Intronic
1152651377 17:81495056-81495078 GAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155865799 18:30963426-30963448 AGGAACCAGCAGAAGCAGGAAGG - Intergenic
1156666814 18:39418594-39418616 AAGAAGCAGCAGCAGCAGCAAGG + Intergenic
1156855064 18:41772293-41772315 ATGCAGCAGCAGTAGCAGCTGGG + Intergenic
1157320449 18:46630138-46630160 AGGCACTGGCAGAAGCAGAGAGG - Intronic
1157532371 18:48432228-48432250 AGGCAAAAGCAGAAGCTGCAAGG + Intergenic
1157610073 18:48950528-48950550 AGGCGACAGCAGCAGCAGCAGGG + Exonic
1157740963 18:50092431-50092453 ACGCAGCAGCAGCAGCAGGATGG - Intronic
1159263373 18:66046196-66046218 GGGCAGTAGCAAGAGCAGGAAGG + Intergenic
1159275850 18:66220494-66220516 AGAAAATAGCAGAAGCAGGAAGG - Intergenic
1159354223 18:67316330-67316352 AGGCAGTAAGAGGAGCAGAAAGG - Intergenic
1159420042 18:68206168-68206190 TGGCAGGAGCAGAAACACCATGG - Intergenic
1159744220 18:72211211-72211233 AGGCAAGAGGAGAAGCAGGAAGG + Intergenic
1159770449 18:72542029-72542051 GGGCAGTAGCAGCAACAGCAGGG + Exonic
1159797019 18:72856216-72856238 AGGCAGTAATAGCAGCAGAAAGG - Intronic
1160175405 18:76590214-76590236 AGGCAGAAGCAGGAGCAAAAGGG - Intergenic
1160653648 19:247775-247797 AGGCAGTAGCAGGAAAACCAAGG - Intergenic
1160779829 19:872787-872809 GGGCAGCAGCAGCAGAAGCAAGG + Intronic
1161490505 19:4558401-4558423 TAGCAGCAGCAGAAGCAGCAGGG + Exonic
1161517985 19:4707355-4707377 AGGGAATGGCAGAAGCAGGATGG + Intronic
1161522732 19:4734428-4734450 AGCCAGTAGAAGAACCAGCCTGG + Intergenic
1163121372 19:15220189-15220211 AGGCACTAGCAGAAGATGTAGGG + Intergenic
1163261197 19:16191058-16191080 AGTCTGTAGCAGAAGATGCAAGG - Exonic
1165827389 19:38713046-38713068 AGGCAGCAGGAGCAGCACCACGG - Intronic
1165830174 19:38726784-38726806 AGACATTGGCAGAGGCAGCAGGG + Intronic
1166123987 19:40702843-40702865 AGGCAGGAGCAGGAGCTGCGTGG - Intronic
1166175416 19:41065290-41065312 AGGAAGGAGCAGCAGCAACATGG + Intergenic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1167090319 19:47339616-47339638 AGGCAATAGCAGAGTCATCAGGG - Intronic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1167429482 19:49446388-49446410 AGGCACCGGCAGAAGCGGCATGG + Exonic
1167769899 19:51508582-51508604 TGGGGGTAGCAGAAGGAGCAGGG - Intergenic
1168712892 19:58511911-58511933 GAGCAGCAGCAGCAGCAGCAAGG + Exonic
925072596 2:982968-982990 AGGATGAAGCAGAAGCTGCAGGG + Intronic
925120873 2:1417036-1417058 TGGAAGTCTCAGAAGCAGCAAGG + Intronic
925733714 2:6942483-6942505 TAGCAGTAGCAGCAGCAGCAGGG + Intronic
926686007 2:15698073-15698095 AGGCAGAGGCAGAGGCAGAATGG + Intronic
927513271 2:23657853-23657875 TGGCAGGAGCAGGAGCAGGAAGG + Intronic
928342729 2:30459255-30459277 AGGGAGAAGCAGAAGCTCCAAGG + Intronic
928593218 2:32838110-32838132 GGGCAGCAGCAGAACCAGCCTGG + Intergenic
928653592 2:33426637-33426659 ATGCAGTATCAGAAGCAGCAAGG + Intergenic
929265941 2:39919825-39919847 AGACAGCAGCAGCAGCAGCAAGG + Intergenic
929587915 2:43127602-43127624 AGGCAGAAGGGGCAGCAGCAGGG + Intergenic
929590563 2:43143064-43143086 AGGCAGCAGCAGCAGCAGGAGGG - Intergenic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
929626928 2:43418952-43418974 AGGCAGTGGAAGAAGCGGCCAGG + Intronic
930510254 2:52335492-52335514 AAGAAGGAGCAGAAGCAGGAAGG - Intergenic
930697912 2:54430639-54430661 AGGAAGTAACAGCAGTAGCAGGG + Intergenic
930741257 2:54835041-54835063 AGGCAGAGGGAGAAGCAGCGAGG - Intronic
930874013 2:56193346-56193368 AGGCAGCGGCGGAGGCAGCAGGG + Exonic
931483678 2:62669056-62669078 AGGCAGAAGCAGAAGAAAGACGG - Intergenic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
932193425 2:69761570-69761592 GTGGAGTAGCAGAAGCATCACGG - Intronic
932408753 2:71532448-71532470 AGGAAGAGGAAGAAGCAGCATGG + Intronic
932658659 2:73632764-73632786 AAGCAGTAGCAGCAGCAACCAGG + Intergenic
932665263 2:73692711-73692733 AAGCAGTAGCAGCAGCAACCAGG + Intergenic
932740879 2:74290301-74290323 AGGCAGCAGCGGAAGCAGGCTGG - Intronic
933336321 2:80964195-80964217 TAGCAGCAGCAGCAGCAGCATGG + Intergenic
934131187 2:88950645-88950667 AGGCAGGAGCAGAAGATGAATGG - Intergenic
934140833 2:89045905-89045927 AGGCATCAGGAGAAGCAGCTGGG + Intergenic
934222791 2:90100801-90100823 AGGCATCAGGAGAAGCAGCTGGG - Intergenic
934228399 2:90154637-90154659 AGGCATAAGGAGAAGCAGCTGGG - Intergenic
934655473 2:96114972-96114994 AGGCTGTAGCTGAAGAAGAAGGG + Exonic
935207103 2:100905681-100905703 AAGCAGTGGCAGAGGCAGAAAGG - Intronic
935600233 2:104915005-104915027 AGGCAGCAGCAGACACAGCTGGG + Intergenic
936906006 2:117536398-117536420 AAGCAGGAGCAGCAGCAGCAAGG + Intergenic
937338729 2:121077486-121077508 CGGCAGGGGCAGAAGCAGCTGGG - Intergenic
938091061 2:128435097-128435119 AGGAAGCAGCAGAAGCAGGAAGG + Intergenic
938141784 2:128800363-128800385 AGGCAACAGCAGAAGCAGCCAGG + Intergenic
938820614 2:134954736-134954758 AAGCAGTGGCAGCAACAGCAGGG - Exonic
940097408 2:149993294-149993316 AGGAAATAGCAGAAGCAGGAAGG - Intergenic
940123377 2:150294000-150294022 AGTCACTGGCAGAAGAAGCAGGG - Intergenic
940274785 2:151927947-151927969 AGGCAGCAGCAGAAACTGAAAGG + Intronic
940982949 2:160023842-160023864 AGGGAGTAGCAGAAACAACACGG + Intronic
941445195 2:165591617-165591639 AGGCTGGAGCTGAAGCAGCTGGG - Intronic
941639278 2:167969961-167969983 TGGCTGGAGCAGGAGCAGCAAGG - Intronic
941950827 2:171154677-171154699 ATGAAGTAGTAGAAGCAGTATGG - Intronic
942095996 2:172537156-172537178 AGGCAGAGGCAGAGGCAGAAAGG - Intergenic
942700944 2:178709795-178709817 AGACAGTAGAAGAAACAGAAGGG - Exonic
943396714 2:187346839-187346861 AATCAGCAGCAGCAGCAGCAGGG + Intronic
943538546 2:189182946-189182968 AGGTACTAGCAGAAGAAGAAAGG - Intergenic
943668149 2:190632262-190632284 AGGCAGGGCCAGATGCAGCAAGG - Intergenic
943701563 2:190993600-190993622 GGGCAGCAGCTGTAGCAGCAAGG - Intronic
943720991 2:191203322-191203344 AGGCAGGAGCATACACAGCATGG + Intergenic
943803445 2:192091293-192091315 ACACAGTAGCAGAAACATCAGGG + Intronic
944545502 2:200795338-200795360 AGGCAGGAGCAGAAGGGTCATGG + Intergenic
944938720 2:204598424-204598446 AGCCAGTAGGAGAAACAGCTGGG - Intronic
945206266 2:207335424-207335446 AGACAGTAGAGGAAGGAGCATGG - Intergenic
946203570 2:218086820-218086842 AGACTGTAGCAGAAGGACCAAGG + Intronic
946860684 2:223997772-223997794 AGGCAGATGCAAAAGCAGGAAGG + Intronic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
947314024 2:228835578-228835600 AGACAGCAGCAGCAGCAGCAAGG - Intergenic
948006851 2:234616801-234616823 CGGCAGTAGCAGCAGAAGCGAGG + Intergenic
948049301 2:234967531-234967553 AGGCTGCTGCAGAAGCTGCAGGG - Intronic
948386123 2:237582107-237582129 AGGCAGGAGCAGAGGCAGAACGG - Intronic
948499129 2:238378905-238378927 AGGCAAGAGCAGAAGCAACCTGG - Intronic
948664489 2:239526590-239526612 AGGCAGGAAGAGAAGCAGCTCGG + Intergenic
948843986 2:240674525-240674547 TGGCAGCAGAAGCAGCAGCAGGG - Intergenic
948849826 2:240700110-240700132 TGGCAGCAGAAGCAGCAGCAGGG + Intergenic
1169411151 20:5371519-5371541 AGCCAGGAGCAGAGCCAGCAGGG - Intergenic
1170624523 20:18021221-18021243 AGGCAGCAGCAGCAGCAGTAGGG - Intronic
1170750366 20:19139689-19139711 AGGCTGGAGCTGAAGCAGCTGGG + Intergenic
1171237965 20:23543368-23543390 AGTAAGGGGCAGAAGCAGCACGG - Intergenic
1172979146 20:38927799-38927821 TGGCAGTAGAAAAAGCGGCAGGG - Intronic
1173350732 20:42243024-42243046 AGGCAGAGGCAGAGGCAGAAAGG + Intronic
1173565329 20:44034466-44034488 ATGGAGTACCAGGAGCAGCATGG + Intronic
1173901437 20:46592600-46592622 AGGCAGTACTAGTAGCAGCGGGG + Intronic
1174387839 20:50197807-50197829 TGGCTGGAGCAGAGGCAGCAAGG + Intergenic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1175461430 20:59154557-59154579 AGTCATTAAGAGAAGCAGCAAGG - Intergenic
1175575641 20:60058574-60058596 ACGCAGCGGCAGCAGCAGCAAGG - Intronic
1175983669 20:62753789-62753811 TGGCAGCAGCAGAACCAGCCAGG - Intronic
1176521153 21:7825560-7825582 AGGCAGAAGCAGAAACGGCCAGG - Exonic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1177571384 21:22891370-22891392 GGTCAGTAGGAGAAGCAACAAGG + Intergenic
1177965271 21:27719530-27719552 AGGCGGGAGCTGAAGCAGCAGGG - Intergenic
1178135264 21:29619774-29619796 AAGCAGCAACAGAAGCAGCATGG + Intronic
1178655173 21:34455572-34455594 AGGCAGAAGCAGAAACGGCCAGG - Intergenic
1179593424 21:42426748-42426770 AGCCAGCAGCAGATGCAGCGGGG + Exonic
1180008456 21:45034152-45034174 TGGCATCAGCAGAACCAGCATGG - Intergenic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1181775967 22:25160482-25160504 AGGCAGATAGAGAAGCAGCAAGG - Intronic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1182441458 22:30366717-30366739 AGGCTGCAGGAGAATCAGCAAGG - Intronic
1182944679 22:34310778-34310800 TGGCAGAAGCAGCAGCTGCAGGG - Intergenic
1183462127 22:37957903-37957925 GGGCAGTGGCAGAAGCAGAGAGG - Intronic
1183706362 22:39477114-39477136 AACCAGTAGCAGAAGCTCCAGGG + Intronic
1183951968 22:41357393-41357415 TGGCGGTGGCAGCAGCAGCAGGG - Exonic
1184343409 22:43898528-43898550 AGGCTGTAGCAGAGGCGTCATGG + Intergenic
1184372980 22:44094447-44094469 AGGCAGAGGCAGAAGGAGCAGGG + Intronic
1184378984 22:44133208-44133230 AGGCAGAAGCAGAGGCATGAGGG + Intronic
1184555472 22:45230371-45230393 AGAAAATAGCAGAAGCAGGAAGG + Intronic
1184974360 22:48050733-48050755 AGGCCATATCAGAAGCTGCATGG + Intergenic
949416831 3:3824045-3824067 AGGTAGTTTGAGAAGCAGCACGG - Intronic
949743507 3:7263412-7263434 CAGCAGTGGCAGCAGCAGCATGG + Intronic
950488205 3:13285254-13285276 AGGCAGTAGGAGTGGGAGCAGGG + Intergenic
951755910 3:26090964-26090986 AGGCAGTAGTAAAAACACCATGG + Intergenic
952184356 3:30952872-30952894 AGAAAATAGCAGAAGCAGGAAGG - Intergenic
952647717 3:35681777-35681799 AGGCAATAGCAGAGGAAGGAGGG + Exonic
953342722 3:42149310-42149332 AGGGAGTAGGAGGAGCAGAAAGG - Intronic
953833500 3:46323285-46323307 AGGCAGTGGCAGAGGAAGAAAGG - Intergenic
955241920 3:57185932-57185954 GGGCAGGAGAAGAAGGAGCAAGG - Intergenic
955518812 3:59754560-59754582 TGGCAGTAGCAGAAGTGGGAAGG - Intronic
955518988 3:59756054-59756076 TGACAGTAGTAGCAGCAGCAGGG - Intronic
955802503 3:62700787-62700809 AGTTAGTAGTAGAAGCAGCATGG + Intronic
955927993 3:64026545-64026567 AGGAAGTGGTAGAAGCAGGAAGG - Intergenic
955988662 3:64601761-64601783 AGGCAGTATCAGTATCATCAAGG + Intronic
956371874 3:68571571-68571593 TGGCAGTGGCAGTGGCAGCATGG - Intergenic
956780276 3:72597942-72597964 CAGCAGTAGCAGCAGCAGCAGGG + Intergenic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
958422214 3:93941767-93941789 TGGCAGTAGCAGCTGCCGCACGG - Intronic
959157495 3:102684644-102684666 AGAAAGCAGCAGAAGCAGAAAGG + Intergenic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
960596093 3:119409532-119409554 AGGCAGTACCTGAAGCACCGGGG + Exonic
960687417 3:120307920-120307942 GAGCAGGAGCAGCAGCAGCAAGG + Intergenic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
961141131 3:124557475-124557497 AGGCATTAGCAGCAGGTGCAGGG + Intronic
961296534 3:125889380-125889402 AGACTGGAGGAGAAGCAGCATGG + Intergenic
961517399 3:127446512-127446534 AGGCTGCAGAAGAAGCAGGATGG + Intergenic
961531620 3:127543724-127543746 GGGCAGGAGCAGAAGCAGCAAGG + Intergenic
962212741 3:133492313-133492335 TGGCAGCAGCTGCAGCAGCATGG - Intergenic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
964053820 3:152427109-152427131 AGGCAGTAACAACAGCAGGATGG - Intronic
964256184 3:154776981-154777003 AGGCAGGAGAAGAATCTGCAGGG - Intergenic
964548932 3:157865485-157865507 AGGCAGCTGGAGAAGCAGCAGGG - Intergenic
965050600 3:163642271-163642293 AGGCAGTAACCAAAACAGCATGG + Intergenic
965090440 3:164155593-164155615 TGGCAAAAGCAGAAGCAGCAGGG + Intergenic
965360825 3:167735610-167735632 GGGCAGCTGCAGAAACAGCAGGG + Intronic
965493772 3:169372680-169372702 AGACAACAGCAGAAGCAGCTTGG - Intronic
965667937 3:171115876-171115898 GGGCATTAGCAGAAGCAGCTGGG + Intronic
966094701 3:176186142-176186164 AGGAAGTAGGAGTAGCAGCAGGG - Intergenic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
966517070 3:180829928-180829950 AGGCAGTAACAGCAACAGCTCGG - Intronic
966880518 3:184347407-184347429 AAGCATTAGGAGAAGCAGCATGG + Intronic
967182280 3:186916449-186916471 GGGCAGTAGCAGAGACAGAATGG + Intergenic
967804642 3:193704637-193704659 AGCCAGGAGCAGATACAGCAGGG - Intergenic
967882487 3:194311731-194311753 AGGTAGAAGAAGAAGCACCAGGG + Intergenic
967936990 3:194736816-194736838 AGACAGCAGTAGAAGAAGCATGG - Intergenic
968064095 3:195748605-195748627 ACGCAGTAGGTTAAGCAGCAGGG - Intronic
968463693 4:738987-739009 AGGGAGCAGCAGGTGCAGCAAGG - Intronic
968965624 4:3767795-3767817 AGGCTGTAGCTGAAGAAGAAGGG - Exonic
968999749 4:3970621-3970643 AGGCTGGAGGAGAAGGAGCATGG - Intergenic
969134475 4:5019401-5019423 CGCCAGGAGCAGCAGCAGCACGG + Exonic
969201475 4:5609831-5609853 AGGCAGTGGCAGACCCAGCACGG - Intronic
970103846 4:12557463-12557485 AGGCAATAGCAGAAGCACAAGGG + Intergenic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
970958449 4:21843426-21843448 AGACTATAGCAGAAGCAGGAAGG + Intronic
971342448 4:25782948-25782970 TGGGAGAAGCAGAAGCAGAAGGG + Intronic
971418303 4:26453473-26453495 GGGCAGGAGCAGGGGCAGCAGGG + Intergenic
972164080 4:36260992-36261014 AGGCAGGCGGAGAAGCAGGATGG - Intergenic
972270043 4:37502306-37502328 CAGCAGTGGCAGAGGCAGCATGG + Intronic
973158400 4:46986996-46987018 AGGCAAGGGCAGATGCAGCAAGG - Intronic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
973326055 4:48863259-48863281 AGGCATTAGCAGAAGCCCAAAGG - Intergenic
973823559 4:54684098-54684120 ACTCAGTAGCAGAGGCAGGAAGG + Intronic
974685927 4:65229229-65229251 AGGAAGAAACAGAAACAGCAGGG - Intergenic
975585063 4:75940887-75940909 GGCCAGCAGCAGCAGCAGCAGGG + Exonic
976436109 4:85019998-85020020 AGGCAGTAGCAGATGGAACCAGG + Intergenic
976492323 4:85685896-85685918 TGGCAGTAGCTGAAGTAACAGGG + Intronic
976690024 4:87858972-87858994 GGGCAGAGGCAGAAGCCGCAAGG + Intergenic
977855553 4:101886318-101886340 TGGCTGAAGCAGAAACAGCAAGG + Intronic
977969542 4:103197982-103198004 AGGGAGGAGCAGATGCCGCAAGG + Intronic
978596250 4:110380109-110380131 TGGCAGTGGCAGTGGCAGCATGG - Intronic
978833384 4:113116678-113116700 CGGCAGTAACAGCAGTAGCACGG + Intronic
979678065 4:123431163-123431185 AAGAAGCAGCAGCAGCAGCAGGG - Intergenic
979975472 4:127190732-127190754 CTGCAGTAGCAGCAGCAGCTGGG + Intergenic
980792032 4:137632457-137632479 TGCCAGCAGCAGCAGCAGCATGG - Intergenic
981093103 4:140753428-140753450 AGGCAGTGGCAGAAGCTGGGAGG + Intronic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
981625307 4:146748005-146748027 AGGCAGATGCAGAAGCAGCAAGG - Intronic
982016235 4:151156434-151156456 ATGTAGTAGCAAAAACAGCATGG + Intronic
982914143 4:161184003-161184025 AGGCAGTATGGAAAGCAGCATGG - Intergenic
983861433 4:172711917-172711939 GGGCAGGAGCAAGAGCAGCAAGG + Intronic
984158867 4:176226772-176226794 AGGAAATAGCAGAAGGAGCTGGG - Intronic
984660316 4:182367223-182367245 AGGAAGTAGTGGAAGCAACAAGG + Intronic
984951851 4:185013906-185013928 AGGCAGTGGACGTAGCAGCAGGG - Intergenic
985622929 5:965003-965025 AGGCACAGGCAGAACCAGCACGG + Intergenic
985651429 5:1109535-1109557 AGGCTCCACCAGAAGCAGCAGGG + Intronic
985726499 5:1518705-1518727 AGGCAGGAGCAGAACCCACATGG + Intronic
986004287 5:3655011-3655033 AGACAGGAGCAGAAGCAGGGAGG - Intergenic
986211761 5:5680048-5680070 AGGCAGCATCAGAAGCATGAAGG - Intergenic
986323395 5:6652276-6652298 GGGCTGTAGCAGAATGAGCAGGG + Intronic
986561408 5:9063761-9063783 AGGCAGCAGCAGCAGCAGGTGGG + Intronic
987067622 5:14304766-14304788 GGGCAGTAGGGGAAGCAGAATGG + Intronic
987264572 5:16239307-16239329 TTGCAGTAACAGCAGCAGCAAGG - Intergenic
987939849 5:24519902-24519924 TTCCAGTAGCAGAAGCAGCAAGG - Intronic
989238509 5:39176908-39176930 AGGCAGGAGCAAAAACAGAAAGG + Intronic
989710177 5:44388612-44388634 AAGCAGCAGCAGCAGCAGCCGGG + Exonic
991210238 5:64096125-64096147 AGACAGTAGAAGAAGGAGGAGGG - Intergenic
991513401 5:67405931-67405953 AGTAAGTGGCAGAACCAGCACGG - Intergenic
992062873 5:73073949-73073971 AATCAGTAGCAGTAGCAGTAAGG + Intronic
992158619 5:73979462-73979484 AGTCAGAAGGAGAAGCAGAAAGG + Intergenic
992260462 5:74965557-74965579 AGGCAGCATCAGAACCAACAGGG - Intergenic
992896463 5:81249522-81249544 AGGCAGTAGCAGACCCAACAGGG + Intronic
993178451 5:84518560-84518582 CAGCAGTGGCAGAGGCAGCATGG + Intergenic
993967198 5:94372563-94372585 AGGCTGGAGCTGAAGCAGCTGGG + Intronic
993971209 5:94422134-94422156 AGAAAATAGCAGAAGCAGGAAGG + Intronic
995000103 5:107117208-107117230 GGGCTGTAGCTGAAACAGCATGG + Intergenic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
996605259 5:125313703-125313725 AGGCAGGAGCTGGAGCAGCTGGG + Intergenic
997430300 5:133833701-133833723 AGGAAGAGGCAGAAGCAGAAAGG + Intergenic
998141531 5:139702277-139702299 TGGCTGGAGCAGAAGGAGCAGGG - Intergenic
998493449 5:142566621-142566643 ATTCAGCAGCAGCAGCAGCAGGG - Intergenic
998754428 5:145360343-145360365 AGGCAAAAGCATAAGCAGTAAGG + Intergenic
998774950 5:145588781-145588803 AGGCAGCACCAGCAGCAGCCAGG + Intronic
998820606 5:146054357-146054379 CAGCAGTAGCAGCAGCAGCAAGG - Intronic
999354687 5:150915100-150915122 AGGCAGAAGGGAAAGCAGCAAGG - Intergenic
999545711 5:152626262-152626284 GGGCAGTAGGAGAGGAAGCAAGG - Intergenic
999805559 5:155077862-155077884 GGGCAGGAGGAGAAGAAGCAAGG + Intergenic
1000166740 5:158657163-158657185 AGGCAGAAGTAGAAGCAGTAGGG - Intergenic
1000422294 5:161052617-161052639 AGGAAGTAGTAGAATCAGGATGG - Intergenic
1000525856 5:162356616-162356638 AGCCAGTATGAGAAACAGCATGG - Intergenic
1002191126 5:177478197-177478219 AGGCAGTGGCAGAATCATGAGGG + Intergenic
1002202262 5:177536533-177536555 GGGCAGTGGCAGCAGCAACAGGG + Exonic
1002440277 5:179260838-179260860 AAGCAGTAGCGGGAACAGCAGGG - Intronic
1002660460 5:180788026-180788048 ATGCAGCAGCAGCAGCAGCCAGG + Intergenic
1003870388 6:10398307-10398329 CAGCAGTAGCAGCAGCAGGAAGG + Exonic
1003996258 6:11543025-11543047 AGGAAGTAGCTGAAGTAGCATGG - Intronic
1004425734 6:15505754-15505776 AGGCAGTGGCGGCTGCAGCACGG - Intronic
1004529100 6:16437029-16437051 AGGCAGTGGGAGAAGCAGGTTGG + Intronic
1005009375 6:21321560-21321582 AGAAAGTAGCAGAATCAGGAAGG + Intergenic
1005414089 6:25582995-25583017 AGGAAATAGCAAAAGCAGGAAGG + Intronic
1005414289 6:25584830-25584852 AGGAAATAGCAAAAGCAGGAAGG - Intronic
1005519186 6:26583853-26583875 AGTCAGGGGCAGAAGCAGGAAGG - Intergenic
1005829227 6:29657237-29657259 AGGAAGGAGCAGAGGCAGCTGGG - Exonic
1006137823 6:31906652-31906674 AGTCAGTTGCTCAAGCAGCAAGG - Intronic
1006408992 6:33861383-33861405 AGACAGTGGCAGAAGCAGCATGG - Intergenic
1007156998 6:39754690-39754712 AGGAGGTAGCTGAAGCTGCAAGG - Intergenic
1007534729 6:42576424-42576446 GGGCAGCAGCAGCAGCAGAATGG - Intronic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1008044764 6:46840466-46840488 AGTCAGTAGCAGTAGCAGCATGG - Intergenic
1008383662 6:50862172-50862194 CAGCAGTAGCAGCAGAAGCAAGG + Intergenic
1010184324 6:73125400-73125422 TGGCAGAGGCAGAACCAGCAAGG + Intronic
1010906804 6:81501284-81501306 AGGCTGAAGCTGAAGCAGCTGGG - Intronic
1011421332 6:87176540-87176562 AGAAAGTAGCAGAAGCAGGAAGG - Intronic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1012414524 6:98998742-98998764 ATGCAGTAGCAGCAGCAACCAGG - Intergenic
1012668918 6:102015653-102015675 AAGCAGTAGCAGCAGCAGCACGG - Intronic
1013180413 6:107712555-107712577 AGGATGGAGCAGAGGCAGCAGGG + Intronic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013407091 6:109852957-109852979 AGAAAATAGCAGAAGCAGGAAGG + Intergenic
1014222768 6:118815108-118815130 AGGCAGTAATAAAAGCGGCAAGG - Exonic
1014994528 6:128125376-128125398 TGGCAGGAGCAGGAGCAGGATGG - Intronic
1015167324 6:130212637-130212659 AGTCAGTAGTAGAACCAGGAAGG + Intronic
1015580214 6:134715876-134715898 ATGCAGGAGAAAAAGCAGCAGGG - Intergenic
1017037684 6:150281107-150281129 AGGAAGCAAGAGAAGCAGCAAGG - Intergenic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1018276004 6:162132376-162132398 AGGCCATACCAGAGGCAGCAAGG + Intronic
1019190429 6:170247644-170247666 GGGCAGCAGCAGAGGCAGGAGGG + Intergenic
1019221473 6:170476643-170476665 AGACTGTAGAAGAGGCAGCATGG + Intergenic
1019224717 6:170500407-170500429 AGGGAGTTTCAGAAACAGCAGGG - Intergenic
1019318947 7:406144-406166 AGGAAGAAGCAGATCCAGCAAGG + Intergenic
1019666252 7:2253603-2253625 AGGCAGCAGCAGAACCCACAGGG + Exonic
1021067721 7:16197577-16197599 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021067882 7:16198794-16198816 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021946129 7:25729410-25729432 AGGCAGTAGTCTAAGCACCAAGG - Intergenic
1022481798 7:30748977-30748999 AGGCAGGAAGAGAAGTAGCAAGG + Intronic
1022538214 7:31111369-31111391 TGGCAGCAGCAGTAGCAGTAAGG - Exonic
1023319854 7:38983363-38983385 AGGCAGGAACAAAAGCAGAAAGG - Intronic
1023452424 7:40302167-40302189 AGGCATTATCAGTAGCAGGATGG - Intronic
1023607445 7:41943219-41943241 ACGCGGTGGCAGCAGCAGCATGG + Intergenic
1023733030 7:43210153-43210175 AGGCAGTGGGACAAGCTGCAGGG - Intronic
1023795728 7:43790301-43790323 AACCAGGAGCAGAAGCAGGAGGG - Intronic
1025158339 7:56630548-56630570 AGGCTGTACCTGAAGCTGCAGGG - Intergenic
1025802433 7:64798932-64798954 AGGCTGTAACCAAAGCAGCATGG - Intronic
1025813153 7:64888204-64888226 GGGCAGCAGCAGCAGCAGCCAGG - Intronic
1026178299 7:68016867-68016889 AGGCAGTAACAGAAAGAGGAGGG + Intergenic
1027109293 7:75424142-75424164 AGGCAGTTGCAGCAGCAGGCAGG + Exonic
1027463683 7:78487150-78487172 AGGAAGTAGCTGCAGCAGGATGG + Intronic
1027479018 7:78671225-78671247 AGCCTGTGGGAGAAGCAGCAAGG - Intronic
1027628586 7:80574946-80574968 TGGCAGCTGCAGCAGCAGCAGGG + Intronic
1027953063 7:84843821-84843843 AGGGAGAAGCAGAAACAACATGG - Intergenic
1028138286 7:87245470-87245492 AGAAATTTGCAGAAGCAGCAAGG + Intergenic
1029403278 7:100358325-100358347 CGGCTGCAGCAGGAGCAGCAGGG - Exonic
1029405849 7:100373667-100373689 GGGCAGTAGGGGCAGCAGCAGGG - Exonic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1029733948 7:102455277-102455299 AGGCTGTGGCAGAAGCATCCTGG + Exonic
1030182099 7:106720936-106720958 AAGCAGCACCAGAAGAAGCAAGG + Intergenic
1030628476 7:111869883-111869905 AGGCATTACCAGAAACAGCAGGG - Intronic
1032252728 7:130271895-130271917 ATGGAGTAGCAGATGCAGGAAGG - Intronic
1032782995 7:135179126-135179148 AGGTTCTAGTAGAAGCAGCAGGG - Intergenic
1032865875 7:135923810-135923832 ATTCAGCAGCTGAAGCAGCAAGG - Intergenic
1033051622 7:138009481-138009503 AGGCTGTACAAGCAGCAGCATGG - Intronic
1034248708 7:149670980-149671002 AGAGAGTTGCAGAAGCAGCAAGG - Intergenic
1034549441 7:151810957-151810979 TGGCAGTAGCAGAACCACCATGG + Intronic
1034712194 7:153203515-153203537 GGGCAGAAGCAGAGGGAGCAAGG + Intergenic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1035513177 8:207570-207592 AGGCAGTAGCAGGAAAACCAAGG - Intergenic
1036085215 8:5606253-5606275 AGACACAAGCAGGAGCAGCATGG - Intergenic
1036185209 8:6616639-6616661 AGGCAGTGGCAGAAGCCAGAAGG - Intronic
1036587731 8:10140331-10140353 AGAAAGCAGCAGAAGCAGGAAGG - Intronic
1037187582 8:16082345-16082367 ATGCAGGAGCAAAAGCAGCACGG + Intergenic
1037252574 8:16913993-16914015 AGGAGGCAGCAGAATCAGCAAGG - Intergenic
1037761202 8:21742934-21742956 AAGCAGTAGCAGCCACAGCAGGG + Intronic
1038018859 8:23536429-23536451 TGGCAGGAACAGAGGCAGCAGGG - Intronic
1038251367 8:25908023-25908045 AGGCAGCAGCCCAAGCAGCGTGG - Intronic
1038798185 8:30727675-30727697 AGGCAGGAGCCGCAGCCGCAGGG - Exonic
1039834657 8:41246900-41246922 AGTGAGGTGCAGAAGCAGCAGGG - Intergenic
1040396980 8:47009640-47009662 AGCCACTAGCAGACGCACCATGG + Intergenic
1041554289 8:59135324-59135346 AGGCACCTGCAGAAGCAGCCAGG - Intergenic
1041678652 8:60563599-60563621 AGGGAGTAGCTGAAGCAGGGTGG - Intronic
1042573005 8:70187126-70187148 AGGCAGCAGGAGAAGCAGTGAGG + Intronic
1043480510 8:80647795-80647817 AGAAAGTTACAGAAGCAGCAGGG + Intronic
1043883878 8:85575708-85575730 AGGCAGGGGCAGATCCAGCAGGG + Intergenic
1044311335 8:90696209-90696231 AGGAAGAAGGGGAAGCAGCATGG + Intronic
1044386508 8:91595246-91595268 AGGGAGAAACAAAAGCAGCAGGG + Intergenic
1044729782 8:95220526-95220548 AGCCAGGAGCAGGAGGAGCAGGG - Intergenic
1044852401 8:96441919-96441941 AGGCTTAAGCAGGAGCAGCATGG + Intergenic
1045112003 8:98945134-98945156 GGGCAGGAGCAGAAACACCATGG - Intronic
1045248040 8:100460320-100460342 TGGCTGGAGCAGAAGCAGCTGGG - Intergenic
1045398855 8:101790916-101790938 CAGCAGTAGCAGCAGCAGCAAGG + Intronic
1045824926 8:106386071-106386093 GGGCAGCAGCAGCAGCAGCAAGG + Intronic
1045844675 8:106619912-106619934 ATACAGAGGCAGAAGCAGCAAGG - Intronic
1047213080 8:122855391-122855413 AGGCAGTTGCAGAAAATGCAAGG - Intronic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048386225 8:133915113-133915135 AGGCAGAATCTGAAGGAGCAAGG - Intergenic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1048763994 8:137826679-137826701 GGGCAGTAGCAGCTGCTGCACGG + Intergenic
1049442987 8:142617630-142617652 AGGCAGGAGCAGAGGCGGCTGGG - Intergenic
1049675827 8:143888599-143888621 AGCCAGAAGCTGAAGGAGCAGGG + Intergenic
1051520929 9:17987189-17987211 TGGCAGTAGCAGATGCATCAGGG + Intergenic
1052292032 9:26852975-26852997 AGGCAGGAGCAGAGAGAGCAAGG + Intronic
1052689159 9:31793521-31793543 TAGCAGTAGCAGCAGCAGTAAGG + Intergenic
1052981901 9:34456375-34456397 AGGCAATAACAGAAGCACCAAGG + Intronic
1053121619 9:35551454-35551476 GGGCAGGATCAGAAACAGCAAGG + Intronic
1053511271 9:38689739-38689761 CGGCAGCAGCAGCAACAGCAGGG - Intergenic
1053652794 9:40186263-40186285 AGTCAGTAGCAGTAGCAGCATGG + Intergenic
1053903198 9:42815570-42815592 AGTCAGTAGCAGTAGCAGCATGG + Intergenic
1054531787 9:66189958-66189980 AGTCAGTAGCAGTAGCAGCATGG - Intergenic
1056253210 9:84771971-84771993 ATAGAGTAGCAGAAGGAGCAGGG + Intronic
1056305181 9:85283386-85283408 AGGCAGTGGGGGAAGCAACAAGG - Intergenic
1056572594 9:87828699-87828721 CAGCAGTGGCAGAGGCAGCATGG - Intergenic
1057577400 9:96254351-96254373 AGGGAGTGGCAGAAGCAACCAGG + Intronic
1058018294 9:100061922-100061944 AGGAAATAGCAGAAGCAAAAAGG + Intronic
1058492097 9:105514036-105514058 AGGCAGTTTCAGGAGCAACAAGG + Intronic
1058863894 9:109144126-109144148 AGGCAGCAGGAGAAACAGCAGGG - Intronic
1058941009 9:109812507-109812529 AGGAAGGGGCAGAAGAAGCAAGG + Intronic
1058957707 9:109964375-109964397 AGGCAGAGGCAGAGGCAGGAAGG + Intronic
1059277243 9:113107267-113107289 GGGCAGTGGCAGAAGACGCAGGG + Intergenic
1059279008 9:113117284-113117306 GGGCAGTGGCAGAAGACGCAGGG - Intergenic
1059863241 9:118487530-118487552 GGGCAATAGCAGCAGCTGCATGG + Intergenic
1060415657 9:123427964-123427986 TGGCCGTAGCAGAAGAGGCAAGG + Intronic
1061014211 9:127972608-127972630 AGCAAGTAGCAGAAGCAGGATGG + Intronic
1061988730 9:134145810-134145832 AAGCAGTAGCAGAAGCTCCAGGG - Intronic
1203758789 EBV:696-718 AGCCAGTAGCAGCAGCGTCATGG - Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186242735 X:7587470-7587492 AGCCAGGAGCTGAGGCAGCATGG - Intergenic
1186324052 X:8459309-8459331 AGACATTTGCAGAAGCAGCAAGG - Intergenic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1186519134 X:10189841-10189863 AGTCAGAACCAGAATCAGCAAGG + Intronic
1188662373 X:32775606-32775628 AGGCTGGAGCTGAAGCAGCTAGG + Intronic
1188707893 X:33357809-33357831 CAGCAGTGGCAGGAGCAGCAAGG - Intergenic
1189104316 X:38220748-38220770 CGGCAGCAGCAGCAGCAGCGCGG + Exonic
1189558046 X:42165715-42165737 CAGCAGTGGCAGCAGCAGCACGG + Intergenic
1189653694 X:43218257-43218279 AGAAAGTAGCAGGAGCAGGAAGG + Intergenic
1189731729 X:44028019-44028041 AGGAAGTAGTAAAAGGAGCATGG - Intergenic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1190578237 X:51863550-51863572 AGTCACTAGCAGAAACAGTATGG - Intronic
1190879731 X:54483729-54483751 AGGCAGGAGGAGAAGCAGACCGG - Intronic
1191128186 X:56980618-56980640 GGGCAGCAGCAGTAGCAGCGTGG + Intronic
1191972631 X:66833521-66833543 AGCCAGTAGCAAAACCAGCTAGG - Intergenic
1192034132 X:67545399-67545421 AGGCAGCAGCAGCAGCAGCAGGG + Exonic
1192190291 X:68987140-68987162 GGGCAGCAGCAGAGGCAGGATGG - Intergenic
1193193632 X:78603884-78603906 AGCCTGTAGCAGAAGCAGTTTGG + Intergenic
1194265177 X:91744228-91744250 TGGCAGCAGCAGCAGCTGCATGG - Intergenic
1195722724 X:107881966-107881988 AGACAGTAACCAAAGCAGCATGG + Intronic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1196314901 X:114211055-114211077 AGGCTGGAGCTGAAGCAGCTGGG + Intergenic
1196399464 X:115299335-115299357 AGCCAGTAGCAAAACCAGCCAGG + Intronic
1196473678 X:116058319-116058341 CTGCAGTGGCAGCAGCAGCATGG + Intergenic
1196715594 X:118807858-118807880 GCACAGTAGCAGCAGCAGCATGG - Intergenic
1197517089 X:127446329-127446351 ACACAGCAGCAGAAGCAACATGG + Intergenic
1197737353 X:129861596-129861618 GGGGAGTAGCAGGAGCTGCAGGG - Intergenic
1197916540 X:131541803-131541825 AGTGAGTAGCGGAAGCTGCAAGG + Intergenic
1197976443 X:132170915-132170937 AGTCAGGAGCAGAAGTAGCAGGG + Intergenic
1198261650 X:134970263-134970285 TGGTAGTAGCAGATGAAGCATGG - Intergenic
1198302765 X:135347510-135347532 AGGAAGTAGCTGAGGCAGCTGGG + Intronic
1199467242 X:148152515-148152537 TGGCAGCAGCAAAAGCAGGAAGG - Intergenic
1200582329 Y:4964674-4964696 TGGCAGCAGCAGCAGCTGCATGG - Intergenic
1200705035 Y:6435441-6435463 AGGCAGCATCAGAAGCTGCCAGG - Intergenic
1201029076 Y:9729267-9729289 AGGCAGCATCAGAAGCTGCCAGG + Intergenic
1201192684 Y:11460041-11460063 TGTTAGTAGCAGTAGCAGCACGG - Intergenic
1201300197 Y:12498569-12498591 AAGCAGCAGCAGGAGCGGCAGGG - Intergenic
1201943347 Y:19483210-19483232 AAGCAGCAGCACTAGCAGCAAGG - Intergenic
1202179228 Y:22125394-22125416 AGGCAGCCTCAGAAGCAGCCAGG - Intergenic
1202212133 Y:22461000-22461022 AGGCAGCCTCAGAAGCAGCCAGG + Intergenic