ID: 1124423272

View in Genome Browser
Species Human (GRCh38)
Location 15:29540471-29540493
Sequence GAGTTTCACTGAGCCCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124423272_1124423276 4 Left 1124423272 15:29540471-29540493 CCCACCAGGGCTCAGTGAAACTC 0: 1
1: 0
2: 1
3: 9
4: 160
Right 1124423276 15:29540498-29540520 TAGGCATCACACAAGAGAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 165
1124423272_1124423277 12 Left 1124423272 15:29540471-29540493 CCCACCAGGGCTCAGTGAAACTC 0: 1
1: 0
2: 1
3: 9
4: 160
Right 1124423277 15:29540506-29540528 ACACAAGAGAGAAGGAAAACTGG 0: 1
1: 0
2: 4
3: 63
4: 819

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124423272 Original CRISPR GAGTTTCACTGAGCCCTGGT GGG (reversed) Intronic
901756183 1:11442978-11443000 GAGTTTGGCTGAGCCCTGAGTGG + Intergenic
904488632 1:30844387-30844409 GAGGTTGACTGAGCACTGGGGGG - Intergenic
905659049 1:39706705-39706727 CAGTTTCATAGAGCCATGGTAGG + Intronic
908608826 1:65832678-65832700 ATGTATCACTGAGTCCTGGTAGG + Intronic
918396337 1:184116917-184116939 GAGTTTCCCTGATACCTGCTTGG - Intergenic
920120037 1:203649702-203649724 GAGGATCACTGAGCCCAGGAAGG + Intronic
920146218 1:203863345-203863367 GAGTCTCACTGTGCCCAGGCTGG + Intronic
920304938 1:205012682-205012704 GAGTGTCAGTGAGCCCAGGGCGG + Intronic
920620616 1:207542583-207542605 GAGTCTGACTGAGGCCTAGTAGG + Intronic
920622398 1:207561140-207561162 GAGTCTGACTGAGGCCTAGTAGG + Intronic
921113335 1:212061175-212061197 GAGGATCACTGAGCCCTGAGCGG + Intronic
922981660 1:229832042-229832064 GATTTTGACTGAGCCATGCTTGG + Intergenic
923303983 1:232671342-232671364 GATTTTCCCATAGCCCTGGTGGG - Intergenic
1064310073 10:14204337-14204359 GAGAATCACTGAGCCCAGGGAGG + Intronic
1066207911 10:33208013-33208035 GAGGATCACTGAGCCCAGGGAGG - Intronic
1069637848 10:69936534-69936556 GATTTTCTGTGAGCCCTGGCTGG + Intronic
1073255446 10:102147963-102147985 GTATTTCAGTGAGACCTGGTAGG + Intronic
1073647205 10:105317615-105317637 GAGTTTCACTGAGCACATGTTGG - Intergenic
1073831711 10:107391873-107391895 GAGTTCTACTGAGACATGGTAGG - Intergenic
1075704058 10:124488378-124488400 GAGTGCCACGGAGCCCTGGGAGG - Intronic
1077073421 11:688509-688531 GCGTGTCACTGAGCCCAGCTGGG + Intronic
1080507618 11:32932403-32932425 AAGTTCCACTGAGACCTGGGAGG - Exonic
1080645669 11:34186031-34186053 GAAATGCTCTGAGCCCTGGTGGG + Intronic
1081112128 11:39149284-39149306 GAGGTTCCCTGGGCCCTGGGTGG - Intergenic
1081319349 11:41671720-41671742 GACTTTCTGTGAGCCCTTGTGGG + Intergenic
1083254659 11:61488746-61488768 GACTTTAACTGAGCCCTGACTGG + Intronic
1083350551 11:62025504-62025526 CAGTTTCAGTGAGCTCTGGACGG + Intergenic
1088592320 11:111414422-111414444 GGGATTCCCTGAGCCCTGATAGG - Intronic
1089205089 11:116754133-116754155 GAGGATCACTGAGCCCAGGGAGG - Intronic
1089621775 11:119726783-119726805 GAGCTTCCCAGAGCTCTGGTTGG - Intronic
1089786861 11:120913775-120913797 GAGCTTCCCAGAGGCCTGGTGGG + Intronic
1091973344 12:4806597-4806619 GGGTTTCACTGTGCCCAGGGAGG - Intronic
1093148516 12:15595241-15595263 GAGTTTCAATGCACCTTGGTTGG + Intronic
1099814419 12:87626480-87626502 GAGTCTCACTTATCCCGGGTTGG - Intergenic
1101693332 12:107101449-107101471 GCGTTTCCCTGAGCTCAGGTGGG - Intergenic
1102318026 12:111905523-111905545 GAGTTTCCCCGGGCCCTGGGTGG - Intergenic
1104766763 12:131335032-131335054 GTGTTTCACAGAGCACTGATTGG - Intergenic
1104772964 12:131375771-131375793 GTGTTTCAAGGAGCCCTGGGGGG + Intergenic
1105562333 13:21505723-21505745 GAGTTCCACAGTTCCCTGGTAGG - Intronic
1111034961 13:82659983-82660005 GAGTTTCCTTGACCCCTTGTGGG - Intergenic
1112459074 13:99587180-99587202 GAATTTCACTGAGATCTGCTAGG + Intergenic
1113756168 13:112812522-112812544 GAGGTTCACTGAGCCCAGGCTGG - Intronic
1114064169 14:19046367-19046389 GAGAATCACTGAGCCCAGGGAGG + Intergenic
1114098090 14:19353629-19353651 GAGAATCACTGAGCCCAGGGAGG - Intergenic
1117288243 14:54307967-54307989 GAGTTTTTCTGAGAACTGGTGGG - Intergenic
1120526094 14:85578842-85578864 GAGTCTCATTGAGACCTGGATGG + Intronic
1121910715 14:97789942-97789964 AAGTTTTTCAGAGCCCTGGTAGG - Intergenic
1124423272 15:29540471-29540493 GAGTTTCACTGAGCCCTGGTGGG - Intronic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1127255005 15:57282542-57282564 TAGTTTCACTAAGCCCAGGATGG - Exonic
1202957278 15_KI270727v1_random:89141-89163 GAGAATCACTGAGCCCAGGGAGG - Intergenic
1132716586 16:1293130-1293152 GAGTCTCACTGTGCCCAGGCTGG + Intergenic
1133038939 16:3049706-3049728 CAGCTTCCCTGGGCCCTGGTGGG - Intronic
1133620781 16:7524284-7524306 GCATTTTACTGAGCTCTGGTTGG - Intronic
1142912144 17:3103268-3103290 GAGTCTCACTCTGCCCAGGTTGG + Intergenic
1143593891 17:7902734-7902756 GAGATACACTGGTCCCTGGTGGG + Intronic
1146627318 17:34444445-34444467 GATTGTCACTGAGCCGGGGTGGG - Intergenic
1149213959 17:54332550-54332572 GAGTTTTACAGAGCGCTGATTGG - Intergenic
1150247672 17:63688597-63688619 GAGTTCCACAGAGCCTGGGTGGG + Intronic
1151765923 17:76133024-76133046 GAGAGTCACTGGGCCCTGGGTGG + Intergenic
1151789306 17:76294007-76294029 AAGTGTTTCTGAGCCCTGGTTGG + Exonic
1154449983 18:14467366-14467388 GAGAATCACTGAGCCCAGGGAGG - Intergenic
1159047552 18:63383739-63383761 GAGTTAAACGGGGCCCTGGTAGG + Intergenic
1159116486 18:64119216-64119238 GATTTTCAGTGAGCACTGATTGG + Intergenic
1162464595 19:10832254-10832276 AAGTTTAACTGAGCCCCAGTTGG - Intronic
1163536896 19:17882075-17882097 GAGTTTCAGGGAGACCTGGGTGG + Intronic
1164096523 19:22015056-22015078 GAGTCTCACTCAGCCCAGGCTGG + Intergenic
1168700546 19:58436753-58436775 GAGATTCACCAATCCCTGGTCGG - Intronic
925584390 2:5449059-5449081 CAGATTCACTGAACACTGGTGGG - Intergenic
925800585 2:7595767-7595789 ATGTTTCACTGAGCCTTTGTTGG - Intergenic
926201874 2:10806276-10806298 GAGGATCACTGAGCCCAGGGAGG + Intronic
926801482 2:16664538-16664560 GGCTTTCACTGATCTCTGGTTGG - Intronic
927867387 2:26598819-26598841 GAGTTTCTAGGGGCCCTGGTGGG + Intronic
927989311 2:27436208-27436230 GAGTTTCACTCAGCAAAGGTGGG + Intronic
929532443 2:42761564-42761586 GAGCTGCCCTGAGCCCAGGTGGG + Intergenic
932713150 2:74082464-74082486 GGGTGTCACTGAGCCCTGGTGGG + Intronic
933051572 2:77609368-77609390 GAGTGTCACGGAGCCATGGCAGG + Intergenic
935047619 2:99496604-99496626 GAGAATCACTGAACCCTGGGAGG - Intergenic
935208573 2:100919446-100919468 AAGTTTGACTGAGCCTTGCTTGG + Intronic
936242468 2:110799864-110799886 GAGTTTTACAGAGCACTGATTGG - Intronic
937226991 2:120375763-120375785 AGGGTTCACTAAGCCCTGGTGGG - Intergenic
938481433 2:131665358-131665380 GAGAATCACTGAGCCCAGGGAGG + Intergenic
939842313 2:147204372-147204394 ATGTGTCACTGAGCCCTGGTAGG + Intergenic
942231273 2:173862835-173862857 GAGTTTCAATGAGGCCTGTGTGG + Intergenic
944707844 2:202309093-202309115 GAGTCTCACTGTGCCCAGGCTGG - Intergenic
946758969 2:222974400-222974422 GAGTTTTACTGAGCACTTATTGG + Intergenic
947165719 2:227259843-227259865 GAGCTCCTCTGGGCCCTGGTGGG - Exonic
947893246 2:233644691-233644713 GAGAATCCCTGAGCCCTGGTGGG - Intronic
1169151215 20:3291087-3291109 GAGTAAGACTTAGCCCTGGTCGG - Intronic
1170435254 20:16319949-16319971 GTGTTTCATTTAGCCCTGGTCGG - Intronic
1171174190 20:23038938-23038960 GAGGTGCACTGAGCACTTGTCGG + Intergenic
1171321621 20:24249104-24249126 GAGTTCAACTGAGCCCACGTGGG + Intergenic
1175841144 20:62028230-62028252 GAGTTTCCAGAAGCCCTGGTAGG - Intronic
1176421749 21:6521658-6521680 GAGGATCACTGAGCCCAGGGAGG + Intergenic
1176446194 21:6822977-6822999 GAGAATCACTGAGCCCAGGGAGG + Intergenic
1176824362 21:13688010-13688032 GAGAATCACTGAGCCCAGGGAGG + Intergenic
1179697239 21:43129974-43129996 GAGGATCACTGAGCCCAGGGAGG + Intergenic
1180482661 22:15769001-15769023 GAGAATCACTGAGCCCAGGGAGG + Intergenic
1181275825 22:21686981-21687003 GAGCTGCACTGCGACCTGGTGGG + Exonic
1185142488 22:49110698-49110720 AGGTATCACAGAGCCCTGGTTGG - Intergenic
950703815 3:14767940-14767962 GCGTTTCACAGAGCCCTTGACGG - Intronic
952776503 3:37051764-37051786 GAGGTTCCATGAGCCCAGGTGGG + Intergenic
952964228 3:38611105-38611127 GAGTGCCTCTGAGCCCTGGGTGG - Intronic
953155013 3:40361798-40361820 TAATTTCACTGGGCCCCGGTAGG + Intergenic
953232573 3:41077783-41077805 GAGCTTTACTGAGCCCTGTCAGG - Intergenic
953952866 3:47205787-47205809 GAGGATCACTGAGCCCAGGGAGG + Intergenic
955090905 3:55749595-55749617 GTGTTTCACAGAGCACTGATTGG - Intronic
959755175 3:109888720-109888742 GAGCTGCACTGAGACCTGGTGGG - Intergenic
960778107 3:121284835-121284857 GAGCTTGTCTGAGCCCTTGTGGG - Intronic
960851051 3:122054947-122054969 GAGTTTCACTGAGCTGGGGTGGG - Intergenic
966534679 3:181018171-181018193 TTTCTTCACTGAGCCCTGGTAGG + Intergenic
967946905 3:194811276-194811298 GTGTGTCACTGAGCCCAGGACGG + Intergenic
969152281 4:5179867-5179889 GAGTCACATTGAGCCCTGGCGGG + Intronic
969457516 4:7308531-7308553 CTGTTACACTGAGCACTGGTGGG + Intronic
972133642 4:35864904-35864926 GTGTTTCACAGAGCTCTGATTGG + Intergenic
977812521 4:101373825-101373847 GAGTTTCCCCAAGCCCTGGATGG + Intergenic
979063119 4:116092966-116092988 GAGATTCAGTGACCTCTGGTTGG + Intergenic
979158581 4:117429599-117429621 GAGTTGCCCTGAGCCCAGGCGGG + Intergenic
983325839 4:166255880-166255902 GAGATTCACTGAGCCATCTTTGG - Intergenic
983687119 4:170423575-170423597 AAATTTCCCTGAGCCCTGGGAGG - Intergenic
985258878 4:188096500-188096522 GAGTTTCACTTTGCCCAGGCTGG - Intronic
989256757 5:39374357-39374379 GAGTTACACTGAGCCCTCCCAGG + Intronic
990414162 5:55570286-55570308 GAATTTCACTGAGCTGTGGAAGG + Intergenic
991968029 5:72110437-72110459 GATTTTCACTTAGCGCTGGAAGG - Intronic
994233954 5:97339940-97339962 GAGTTCCCCTGGGCCCTGGGTGG - Intergenic
996950013 5:129114602-129114624 GTATTTCACTGAGCCCTGAAAGG - Intergenic
997611899 5:135221249-135221271 GAGTTTCATTCAGGCCTGGGAGG + Intronic
1000159788 5:158586445-158586467 AAGTTTCCCTAGGCCCTGGTGGG + Intergenic
1000267879 5:159655629-159655651 GAGTTTTACTGAGTGCGGGTGGG + Intergenic
1003222192 6:4170933-4170955 GACGTTTACTGAGCTCTGGTTGG - Intergenic
1005612465 6:27539621-27539643 GAGGATCACTGAGCCCGGGGAGG - Intergenic
1011613982 6:89181259-89181281 CAGTTTCACTAAAACCTGGTGGG + Intronic
1012145214 6:95671564-95671586 GAGTTTTCCTGAGCACAGGTGGG - Intergenic
1015437809 6:133209712-133209734 GTGTTTTACAGAGCGCTGGTTGG + Intergenic
1015663875 6:135604788-135604810 GAGTTTCACTCAGGCCCGCTGGG - Intergenic
1018026349 6:159809372-159809394 GAGTTTCACTTAAGCCTGGGAGG - Intronic
1020088681 7:5325071-5325093 GAGGCTCACCGTGCCCTGGTTGG - Intronic
1021071671 7:16249127-16249149 CAGCCTCACTGAGCTCTGGTGGG - Intronic
1024262026 7:47580534-47580556 GAGGTGCACTGGGTCCTGGTGGG - Intronic
1024273402 7:47659132-47659154 TGGTTTCACTGACCCCTGGAAGG + Exonic
1025205631 7:56992043-56992065 GAGGCTCACCGTGCCCTGGTGGG + Intergenic
1025666309 7:63584895-63584917 GAGGCTCACCGTGCCCTGGTGGG - Intergenic
1029581141 7:101437294-101437316 CACTTTCACTGAGCTCTGGGAGG + Intronic
1030408248 7:109142739-109142761 GAGTTCCCCTGGGCCCTGGGTGG + Intergenic
1030560473 7:111078818-111078840 GAGAATCACTGAAACCTGGTAGG - Intronic
1031936397 7:127739596-127739618 GAGTTACACTCTCCCCTGGTGGG - Intronic
1033833550 7:145282382-145282404 GACTTTCCCTGGGCCCTGGATGG + Intergenic
1035564536 8:632697-632719 GTGTGTCTCTGAGCACTGGTGGG - Intronic
1038765762 8:30426300-30426322 GAGTTTCACTGAAGTGTGGTTGG + Intronic
1044004612 8:86926105-86926127 GAGTTTTACAGAGCGCTGATTGG + Intronic
1048323010 8:133416243-133416265 GAGCTTGACTCAGCACTGGTGGG - Intergenic
1053254496 9:36604489-36604511 GGGTTTGACTCAACCCTGGTGGG + Intronic
1060762999 9:126271797-126271819 GAGTGCCAGTGAGCACTGGTGGG + Intergenic
1061943932 9:133897997-133898019 GAGTGTCCCTAAGCCCTGCTGGG - Intronic
1062358951 9:136178417-136178439 GTGTGTGACTGAGCCCCGGTGGG - Intergenic
1203522997 Un_GL000213v1:61548-61570 GAGAATCACTGAGCCCAGGGAGG - Intergenic
1186109353 X:6239463-6239485 GAGTTTCACTAAGGCCCGGCAGG - Intergenic
1186633032 X:11371015-11371037 GGGTTGCACTGAGCACTGATAGG + Intronic
1187788999 X:22927311-22927333 GAGCTTCACTGAGCCCAGTTTGG + Intergenic
1187985343 X:24804285-24804307 GAGTAGCACTGAGTCCTGCTTGG + Intronic
1188507952 X:30903778-30903800 GAATTTCCCTCAGCCCTTGTAGG + Intronic
1188919324 X:35952388-35952410 AAGTTTGACTGATCCCTGGAAGG - Intronic
1189919430 X:45888985-45889007 GAGGATCACTGAGCCCAGGGAGG - Intergenic
1190090139 X:47430245-47430267 GAGTTCCCCTGAGATCTGGTTGG + Intergenic
1190969568 X:55335407-55335429 GAGCTTCACAAAGACCTGGTTGG + Intergenic
1194164544 X:90498739-90498761 GACTTTCCCTGTGCCCTGGGAGG + Intergenic
1196510520 X:116505893-116505915 GAGTTTCACTCATTCCTGCTGGG + Intergenic
1198093556 X:133355805-133355827 GAGTTCCCATGAGACCTGGTTGG + Intronic
1198220497 X:134596684-134596706 GAGGATCACTGAGCCCAGGGAGG - Intronic
1201076331 Y:10192388-10192410 GAGTTTAAATGAGCCCAGGCTGG - Intergenic
1202148750 Y:21825983-21826005 GAGTTTGACTGAGACCAGCTGGG + Intergenic