ID: 1124423305

View in Genome Browser
Species Human (GRCh38)
Location 15:29540915-29540937
Sequence TATCCTAGATGATGTCCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124423303_1124423305 -5 Left 1124423303 15:29540897-29540919 CCTATAGCCTTGAGTATTTATCC 0: 1
1: 0
2: 1
3: 15
4: 146
Right 1124423305 15:29540915-29540937 TATCCTAGATGATGTCCTAGTGG 0: 1
1: 0
2: 1
3: 15
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124423305 Original CRISPR TATCCTAGATGATGTCCTAG TGG Intronic
901517823 1:9761157-9761179 CATTTTAGATGATCTCCTAGGGG - Intronic
904767964 1:32864753-32864775 TGTCCTTGATGATGTCATACTGG + Exonic
905884389 1:41484057-41484079 TCACCCAGATGATGTCCAAGTGG + Exonic
907849453 1:58240389-58240411 CATCATGGATCATGTCCTAGTGG + Intronic
908818649 1:68059179-68059201 TATTCTATTTGATGTCCTTGAGG - Intergenic
909049591 1:70752502-70752524 TATCCTATTTGATGACCTTGAGG + Intergenic
911310616 1:96288523-96288545 TATCCTATATGATGACCTTGAGG + Intergenic
914708909 1:150195048-150195070 TAGTTAAGATGATGTCCTAGTGG - Intergenic
917524568 1:175775474-175775496 TATCCTATTTGATGACCTTGAGG - Intergenic
920787190 1:209052308-209052330 TATCCTATTTGATGACCTTGAGG - Intergenic
921462346 1:215444421-215444443 TATCCTATTTGATGACCTTGAGG + Intergenic
922356075 1:224777242-224777264 TATCCTAAATGTTTTCCTAAGGG + Intergenic
923201226 1:231713659-231713681 TCTGCTTCATGATGTCCTAGAGG - Intronic
1063821040 10:9836137-9836159 TCTCCTAGATAATGTCTTTGTGG - Intergenic
1073421258 10:103425421-103425443 CATTCTAGATGATGTTCCAGAGG + Exonic
1075500202 10:122965848-122965870 TATCCTATTTGATGACCTTGAGG - Intronic
1076929745 10:133523388-133523410 TACCCTTGATGATGTCCCAAAGG - Intronic
1079396010 11:20064300-20064322 TCTCCTAAATTATATCCTAGGGG - Intronic
1079826202 11:25198029-25198051 GATCCTTGATGATCTACTAGTGG - Intergenic
1081083354 11:38769637-38769659 TATCCTAGTTGATGACCTTGGGG - Intergenic
1083949009 11:65943585-65943607 TATCCTGGAAGATGCCATAGAGG - Intergenic
1086919303 11:92567935-92567957 AATGCTAGATGATGAGCTAGTGG + Intronic
1087309820 11:96528288-96528310 TATCCTATTTGATGACCTTGAGG - Intergenic
1087374542 11:97325556-97325578 TATCCTATTTGATGACCTTGCGG + Intergenic
1087619990 11:100529499-100529521 TATCCTATTTGATGACCTTGAGG - Intergenic
1087851815 11:103039730-103039752 TATGCTAGATGATGAGTTAGTGG + Intergenic
1089926327 11:122262230-122262252 AATGCTAGATGATGACTTAGTGG - Intergenic
1092008838 12:5092189-5092211 TACACTAGATGACGTCCAAGTGG + Intergenic
1094221371 12:27997252-27997274 TAGCCCAGATAATGTCCAAGAGG + Intergenic
1095334074 12:41006101-41006123 TATCCTATTTGATGACCTTGAGG + Intronic
1095347316 12:41166550-41166572 AATGCTAGATGATGAGCTAGTGG + Intergenic
1095638738 12:44462249-44462271 TATCCTAAATGCAGACCTAGGGG + Intergenic
1096796095 12:54078436-54078458 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1098138762 12:67430335-67430357 TATCCAAGAAGACTTCCTAGAGG + Intergenic
1099394643 12:82122046-82122068 TATCCTATTTGATGACCTTGGGG - Intergenic
1100254483 12:92869158-92869180 TTTTCTAAATGATGTCCAAGGGG + Intronic
1103854444 12:123956287-123956309 TTTCCTAGATCATTTCCTAGAGG + Intronic
1104225380 12:126827703-126827725 TTTACTAGATGAGGTCCTTGAGG - Intergenic
1108031558 13:46236167-46236189 TATACTTGATGATGTTCCAGAGG - Intronic
1108775713 13:53762406-53762428 TATCCTATTTGATGACCTTGGGG - Intergenic
1108885202 13:55171925-55171947 AATCCTAGAAGTTGTCCTTGTGG - Intergenic
1109255772 13:60079627-60079649 TATCACAGATGATGTCTTATGGG + Intronic
1110988870 13:82011449-82011471 TATGTTAGATGATCTCCTATGGG + Intergenic
1110989483 13:82020785-82020807 TATCCTAGGTTATTTTCTAGAGG - Intergenic
1112799294 13:103092830-103092852 TCCACTAGATGATGTCCCAGTGG + Intergenic
1114759878 14:25301946-25301968 TATCCTATTTGATGCCCTTGGGG - Intergenic
1116965460 14:51010323-51010345 CATCCTAGACTATGTCCTATGGG + Intronic
1120603623 14:86543769-86543791 AATCCTAGAAGAAGTCCTTGGGG - Intergenic
1120723717 14:87915771-87915793 TATCCTATTTGATGACCTTGAGG + Intronic
1124009503 15:25826175-25826197 TTTGCTTGATGATGTCCTACGGG - Intronic
1124423305 15:29540915-29540937 TATCCTAGATGATGTCCTAGTGG + Intronic
1126111680 15:45178865-45178887 TAGCCTAGGAGATGGCCTAGAGG - Intronic
1128523938 15:68395927-68395949 AACCCTAGATGCTGTACTAGTGG + Intronic
1129931308 15:79413026-79413048 TATCCTATTTGATGACCTTGAGG - Intronic
1130731996 15:86505413-86505435 TATGCTTGATGGTGTCCCAGTGG + Intronic
1135623278 16:23974421-23974443 TATCCTAGAGGAAGTTCTCGAGG - Intronic
1138809578 16:60133020-60133042 TATCTAAGATGATGTGCTAGAGG + Intergenic
1139385188 16:66563668-66563690 TATAATAGATGATGTCCTTACGG + Intronic
1140148145 16:72332678-72332700 TATCCTCTTTGATGTCCTTGGGG + Intergenic
1141071174 16:80955632-80955654 TATCCTATCTGATGACCTTGAGG - Intergenic
1147117920 17:38316148-38316170 TATACTTGATGATGTCCCACAGG + Intronic
1149127744 17:53255396-53255418 TATCTTATTTGATGTCCTTGGGG - Intergenic
1150440924 17:65190731-65190753 TCTCCTAGATGATGTCCTATGGG - Intronic
1153657800 18:7300620-7300642 TACACTTGATGATGTCCTATAGG + Intergenic
1154019313 18:10648555-10648577 TATCCTAGTTGATGACCTTAAGG - Intergenic
1154184903 18:12174678-12174700 TATCCTAGTTGATGACCTTAAGG + Intergenic
1155343533 18:24836733-24836755 AATGCTAGATGATGAGCTAGTGG + Intergenic
1159179318 18:64881042-64881064 TATGCTAGATGATGAGTTAGTGG + Intergenic
1159202193 18:65201878-65201900 TTTCCTAGAAGATGCCCTAAGGG + Intergenic
1159419952 18:68205402-68205424 TATGCTAGATGATGAGTTAGTGG + Intergenic
1162839020 19:13341902-13341924 TGTGCCAGATGTTGTCCTAGGGG - Intronic
1163711649 19:18850712-18850734 TGTCCCAGTTGATGTCCTTGAGG - Exonic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
926631516 2:15140700-15140722 TATGCTAGATGGGGTCCTTGGGG + Intergenic
928490650 2:31779105-31779127 TATCCTATTTGATGACCTTGGGG - Intergenic
928788373 2:34918750-34918772 CAGCCTAGATCATGTTCTAGAGG - Intergenic
930495213 2:52132923-52132945 TATCCTAGAGAATGTCCTTTAGG + Intergenic
930611674 2:53551558-53551580 TATACTTGATGTTGTCCTACAGG - Intronic
931488998 2:62724659-62724681 TATCCTATTTGATGGCCTAGAGG + Intronic
931557388 2:63519698-63519720 TATCCTCCTTGATGTCCTTGGGG - Intronic
931879226 2:66549540-66549562 TATCCTGGATGATATTATAGGGG + Intronic
933477030 2:82803815-82803837 TATCCTATTTGATGACCTTGAGG - Intergenic
934099875 2:88642198-88642220 TATCCTATTTGATGACCTTGAGG - Intergenic
935101759 2:100002569-100002591 TATCCTAGATGTTTTCGTAGTGG - Intronic
935449375 2:103190952-103190974 TATCCTATTTGATGGCCTTGAGG - Intergenic
935713601 2:105919976-105919998 TAACACAGATGATGTCCAAGAGG + Intergenic
936828793 2:116614570-116614592 TATGCTTGATGATATCCCAGTGG - Intergenic
936847569 2:116854782-116854804 TATCCTATTTGATGGCCTTGAGG - Intergenic
936868763 2:117108698-117108720 TATCCTATTTGATGGCCTTGAGG + Intergenic
937558869 2:123195180-123195202 TATCCTGGAGGATGGCCTAATGG - Intergenic
943144482 2:184024668-184024690 TATCAGAGATGATGTCTAAGAGG - Intergenic
943386527 2:187208971-187208993 TATCCTATTTGATGACCTTGAGG - Intergenic
943857278 2:192813556-192813578 TATTCTATATGATGTTGTAGTGG - Intergenic
945088402 2:206156711-206156733 TATCATAGATGATGTACAACAGG + Intronic
945366384 2:208959675-208959697 TATCCTATTTGATGACCTTGAGG - Intergenic
948088837 2:235273647-235273669 TATCCTAGATGAGATCCCAGAGG + Intergenic
1171577033 20:26341043-26341065 AATGCTAGATGATGACTTAGTGG - Intergenic
1171847599 20:30286474-30286496 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1177036680 21:16052866-16052888 TATGCTAGATGATGAGTTAGTGG - Intergenic
1177325624 21:19584653-19584675 TATTCTATATGATGCTCTAGTGG - Intergenic
1177778318 21:25594779-25594801 CATCCTAGAGGATGTCCAAATGG - Intronic
1178345304 21:31821017-31821039 CATCCTAGATGAAATCCTGGAGG + Intergenic
1179283951 21:39960048-39960070 TATCCTAGTTAATTCCCTAGTGG + Intergenic
1180124540 21:45780518-45780540 TATGCTGGCTGATGTCCTTGTGG + Intronic
949293270 3:2490373-2490395 TATCCAAGATAATTTCTTAGGGG + Intronic
953104372 3:39861300-39861322 TATCCTCTTTGATGTCCTTGGGG - Intronic
954480621 3:50796777-50796799 TATCCTAGTTGATGACCTTGAGG + Intronic
956621476 3:71225395-71225417 TATCCTAGATGATGTGATTTGGG - Intronic
957723350 3:84032406-84032428 TATCCTATTTGATGACCTGGAGG - Intergenic
958459026 3:94370918-94370940 TATCCTATTTGATGACCTTGAGG + Intergenic
958464760 3:94443515-94443537 TATCCTATTTGATGACCTTGAGG - Intergenic
960098745 3:113715353-113715375 TTCCCCAGATGATGTACTAGGGG - Intergenic
962655601 3:137541704-137541726 TATTCTATTTGATGTCCTTGGGG + Intergenic
965106774 3:164366245-164366267 TATTCTAAAAGATGTTCTAGTGG - Intergenic
965349561 3:167596764-167596786 AATGCTAGATGATGAGCTAGTGG + Intronic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
968842099 4:3015017-3015039 TATGCTAGTTGAGGGCCTAGCGG - Intronic
977696623 4:99972545-99972567 TATCCTATTTGATGACCTTGGGG - Intergenic
979415550 4:120434153-120434175 AATGCTAGATGATGTGTTAGTGG - Intergenic
980148068 4:129014493-129014515 TATCCTATTTGATGACCTTGAGG + Intronic
980583870 4:134788420-134788442 TATCCTATTTGATGACCTTGGGG + Intergenic
981280869 4:142956527-142956549 TATCCTTTATGTTGTCCTATAGG - Intergenic
981537425 4:145814473-145814495 TATCCTACATTGTGTCCCAGAGG + Intronic
985075521 4:186210178-186210200 TACCCTAGATTATGTCTTAGTGG - Intronic
986754481 5:10823136-10823158 TATCCTATTTGATGACCTTGAGG + Intergenic
986903827 5:12468783-12468805 TATCCTATTTGATGACCTTGGGG - Intergenic
988327868 5:29794714-29794736 AATGCTAGATGACGTCTTAGTGG - Intergenic
990122998 5:52479162-52479184 GATCATAGATGAAATCCTAGGGG + Intergenic
990530933 5:56672884-56672906 TCTCCTAGTTGATTTCCTTGAGG - Intergenic
990781821 5:59372985-59373007 TATCCTATTTGATGACCTTGAGG - Intronic
992370665 5:76140646-76140668 TATCCAAGCTGATGACATAGAGG + Intronic
993311574 5:86338724-86338746 TATCCTATTTGATGACCTTGAGG - Intergenic
993687616 5:90959571-90959593 TAACCTAGATGATGTAGTATTGG + Intronic
994642966 5:102433443-102433465 TATCCTATTTGATGACCTTGAGG + Intronic
995922086 5:117326740-117326762 TCTCATTGATGATGTCCCAGTGG + Intergenic
996468974 5:123837160-123837182 TATCTTAGTTGATGTCATTGGGG - Intergenic
997261584 5:132469485-132469507 TATCCCAGATGGTTTCCCAGTGG - Intronic
1001591931 5:172871554-172871576 TCACCTAGATTATCTCCTAGTGG - Intronic
1003354784 6:5357536-5357558 TATCCTATATGCTCTCCTCGGGG - Intronic
1005147960 6:22713695-22713717 TATCCTAAATCATGTATTAGAGG - Intergenic
1009329941 6:62405836-62405858 TAGCTTATATGATGTCCTTGTGG - Intergenic
1012339644 6:98104349-98104371 TATCCTATTTGATGTCCTCGAGG + Intergenic
1012668965 6:102015965-102015987 TATCCTATTTGATGACCTTGGGG - Intronic
1013738037 6:113249598-113249620 TATCCTATTTGATGACCTTGAGG - Intergenic
1014929942 6:127323817-127323839 TTTCCTAGAAGATGTGGTAGAGG + Intronic
1017281049 6:152626399-152626421 TTTCATAGATGATGTCATTGAGG + Intronic
1020415614 7:7942290-7942312 TATCCTAGTTTATATCCTAGTGG - Intronic
1021185394 7:17558422-17558444 TGTAATAGATGATGTCATAGGGG - Intergenic
1021351056 7:19595170-19595192 TATCCTATCTGATGACCTTGAGG + Intergenic
1021699920 7:23308155-23308177 TACCCTAGATGATGCCCTCCTGG + Intronic
1022265041 7:28745417-28745439 GATGCTAGATGATGACCTAGAGG + Intronic
1025009236 7:55382603-55382625 GATCCTAGATGAAATCTTAGGGG + Intronic
1027506000 7:79017396-79017418 TATCCTATTTGATGTCCTTGGGG - Intronic
1028336793 7:89667854-89667876 TATCCTATTTGATGACCTTGAGG - Intergenic
1031114862 7:117656446-117656468 TTTCCTATATAATGTCCTAATGG - Intronic
1031702828 7:124945772-124945794 TATCCTATTTGATGACCTTGAGG - Intergenic
1031759502 7:125694098-125694120 TTTCCTAGATTATCTTCTAGAGG - Intergenic
1033814228 7:145052930-145052952 GATCCAAGAAGATGTCATAGTGG - Intergenic
1038536399 8:28356296-28356318 TATGCTAAATGGTCTCCTAGTGG - Intronic
1040547264 8:48408358-48408380 TTTCCTAGATCATTTCCTTGGGG - Intergenic
1041989093 8:63964301-63964323 TATTCTAAATGATACCCTAGTGG + Intergenic
1043738460 8:83776057-83776079 TATCCTCTTTGATGTCCTGGGGG - Intergenic
1044360200 8:91274214-91274236 TATCCTAGTTTATGTTCTAGTGG - Intronic
1044641356 8:94385218-94385240 TATCTTTGAAGATGTCATAGGGG - Intronic
1044774355 8:95672562-95672584 TTTCCTAGATGATCTCCTTAGGG - Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1046764567 8:118055933-118055955 TTTGCTATATGATGTCATAGTGG - Intronic
1047541610 8:125772225-125772247 TATACTTGATGGTGTCCCAGAGG + Intergenic
1048977485 8:139681040-139681062 CATGCTAGATGCTGTGCTAGAGG - Intronic
1049128248 8:140811369-140811391 TATCCTATTTGATGACCTTGAGG - Intronic
1049311016 8:141933919-141933941 TTTTCCAGATGATGTCCTGGAGG + Intergenic
1049311145 8:141934592-141934614 TGTCCTAGATGCTGTCCTTGTGG - Intergenic
1049506928 8:143007766-143007788 TATCCTATTTGATGACCTTGAGG + Intergenic
1049704156 8:144032105-144032127 TATGCTTGATGGTGTCCCAGAGG + Intronic
1050493032 9:6209604-6209626 CATGCTTGATGATGTCCTACAGG + Intergenic
1051899504 9:22024123-22024145 TATCCTATTTGATGACCTTGAGG + Intronic
1052033372 9:23653516-23653538 TATCCTAGGTTATCTTCTAGGGG + Intergenic
1053785702 9:41651112-41651134 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1054159330 9:61663067-61663089 TCTCCTAGCTGGTTTCCTAGAGG - Intergenic
1054203169 9:62104413-62104435 TATCCTATTTGATGACCTTGGGG - Intergenic
1054449275 9:65394123-65394145 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1054479104 9:65594072-65594094 TCTCCTAGCTGGTTTCCTAGAGG - Intergenic
1054635194 9:67483952-67483974 TATCCTATTTGATGACCTTGGGG + Intergenic
1056907303 9:90664975-90664997 TATCCTATTTGATGACCTTGAGG + Intergenic
1058390671 9:104491638-104491660 TATCCAAGATGATGTCCATCAGG - Intergenic
1059474362 9:114532489-114532511 TATCCTAGATGCTATGCTAAGGG + Intergenic
1062386410 9:136313389-136313411 TATCCCAGATGAGGCCCTCGTGG + Intergenic
1185615996 X:1422446-1422468 TCTCCTAGGTTATATCCTAGGGG + Intronic
1186685913 X:11923731-11923753 TATCCTATTTGATGACCTTGAGG - Intergenic
1187233861 X:17448151-17448173 TATACTAGAAGATGTTTTAGTGG + Intronic
1188852812 X:35151747-35151769 TATCCCATCTGATGTCCTTGAGG - Intergenic
1190472882 X:50800498-50800520 AATCAAAGATGATGCCCTAGAGG + Intronic
1191075106 X:56444725-56444747 TATCCTATTTGATGACCTTGAGG + Intergenic
1192717766 X:73661932-73661954 TATGCTAGATGATGAGTTAGTGG + Intronic
1193250910 X:79289544-79289566 TATCCTATTTGATGACCTTGAGG - Intergenic
1193449385 X:81647034-81647056 TATCCTATTTGATGACCTTGAGG + Intergenic
1193635271 X:83943120-83943142 TGTCCTATTTGATGTCCTTGGGG + Intergenic
1194663990 X:96656640-96656662 TATCCTATGTGATGACCTTGTGG - Intergenic
1194874775 X:99173391-99173413 TATCCTATTTGATGACCTTGGGG - Intergenic
1195270290 X:103221663-103221685 TATCCTATTTGATGACCTTGCGG - Intergenic
1195346513 X:103955108-103955130 TATCCTATTTGATGACCTTGGGG - Intronic
1195548530 X:106139618-106139640 TATCCTATTTGATGACCTTGAGG - Intergenic
1197474298 X:126901433-126901455 TATCCTATTTGATGACCTTGGGG - Intergenic
1200802948 Y:7402798-7402820 GATCTTAGATGATGTCATTGTGG + Intergenic
1200962829 Y:9010788-9010810 TATGCTAGATGATGAGTTAGTGG + Intergenic
1201627604 Y:16031947-16031969 AATGCTAGATGATGAACTAGTGG + Intergenic