ID: 1124425863

View in Genome Browser
Species Human (GRCh38)
Location 15:29562075-29562097
Sequence GAGGATAATCAGATGGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 273}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124425857_1124425863 6 Left 1124425857 15:29562046-29562068 CCAAGAATGCATGAGCCAAGTCT 0: 1
1: 0
2: 1
3: 20
4: 225
Right 1124425863 15:29562075-29562097 GAGGATAATCAGATGGATCCAGG 0: 1
1: 0
2: 0
3: 12
4: 273
1124425856_1124425863 10 Left 1124425856 15:29562042-29562064 CCTGCCAAGAATGCATGAGCCAA 0: 1
1: 0
2: 1
3: 18
4: 136
Right 1124425863 15:29562075-29562097 GAGGATAATCAGATGGATCCAGG 0: 1
1: 0
2: 0
3: 12
4: 273
1124425859_1124425863 -9 Left 1124425859 15:29562061-29562083 CCAAGTCTGCCCATGAGGATAAT 0: 1
1: 0
2: 1
3: 7
4: 144
Right 1124425863 15:29562075-29562097 GAGGATAATCAGATGGATCCAGG 0: 1
1: 0
2: 0
3: 12
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124425863 Original CRISPR GAGGATAATCAGATGGATCC AGG Intronic
901209595 1:7517241-7517263 AAGGATAATTAGAAGGATCCTGG - Intronic
903985427 1:27224140-27224162 GAGGAGAATCACTTGAATCCAGG - Intergenic
904240762 1:29143554-29143576 CAGGATAATCATTTGAATCCGGG - Intergenic
905185592 1:36194104-36194126 CAGGATAATCACTTGAATCCGGG + Intergenic
905639886 1:39581794-39581816 GAGGAGAATCATGTGAATCCGGG + Intergenic
905816419 1:40954421-40954443 CAGGAGAATCACATGAATCCCGG + Intergenic
906544967 1:46614171-46614193 GAGTATAGTCAGATGCACCCAGG + Intronic
906984809 1:50671897-50671919 CAGGAGGATCAGATGAATCCAGG - Intronic
908239463 1:62176661-62176683 CAGGAGAATCAGTTGAATCCAGG + Intergenic
910082484 1:83357501-83357523 GAGGAAAATCAGATGGTTGTAGG + Intergenic
912399200 1:109374496-109374518 GAGGAGAATCACTTGAATCCAGG + Intronic
913474050 1:119219644-119219666 GAGGATGATCAGAATGGTCCTGG + Intergenic
914870436 1:151469336-151469358 GAGGAGAATCACTTGAATCCGGG + Intergenic
915293530 1:154902865-154902887 GAGGAGAATCACTTGAATCCAGG + Intergenic
918123928 1:181565798-181565820 ATGGATAATTAGCTGGATCCTGG + Intronic
919176774 1:194028804-194028826 CAGGATAATCACTTGAATCCGGG - Intergenic
919901907 1:202050135-202050157 CAGGAGAATCACATGAATCCGGG + Intergenic
920342740 1:205285611-205285633 GAGGAGCATCAGTTGGGTCCAGG + Intergenic
922951416 1:229560790-229560812 GAGCATAATCGGTTGAATCCAGG + Intergenic
1063675546 10:8138287-8138309 GAGGAGAATCACTTGAATCCGGG - Intergenic
1064271906 10:13872889-13872911 AAGGATAGTTAGATGGAGCCTGG + Intronic
1064352669 10:14590894-14590916 CAGGAGAATCACATGAATCCAGG + Intronic
1067118118 10:43451336-43451358 CAGGAGAATCACTTGGATCCAGG - Intronic
1069278859 10:66627989-66628011 GAAGATAAAGATATGGATCCTGG - Intronic
1070634813 10:78116785-78116807 GGGGAAAACAAGATGGATCCTGG - Intergenic
1071160566 10:82740730-82740752 GAGGAGAATCACTTGAATCCAGG + Intronic
1072139449 10:92576675-92576697 CAGGAGAATCACATGAATCCGGG - Intergenic
1073408506 10:103319896-103319918 CAGGAGAATCACATGAATCCAGG - Intronic
1078238290 11:9506237-9506259 CAGGATAATCACTTGAATCCAGG + Intronic
1080539234 11:33250656-33250678 CAGGAGAATCACTTGGATCCAGG + Intergenic
1081546922 11:44078180-44078202 AATCATAATCAGATGGATCAGGG - Intronic
1082832815 11:57631812-57631834 CAGGAGAATCACTTGGATCCAGG + Intergenic
1083760673 11:64815387-64815409 CAGGAGAATCACATGAATCCGGG - Intergenic
1085749629 11:79150086-79150108 GAGGCGAGTCAGAGGGATCCTGG - Intronic
1086429923 11:86726748-86726770 GTGGATAGTCAGATGGAATCAGG + Intergenic
1086606942 11:88707085-88707107 GTGGATGATCAGATTGATCCTGG + Intronic
1089684942 11:120140785-120140807 GAGGATAGAAAGATGGATGCTGG + Intronic
1090292655 11:125558990-125559012 CAGGTTAATCACATGAATCCAGG + Intergenic
1090767174 11:129886048-129886070 GAAGATAAACAGATGGATTTTGG - Intronic
1091421903 12:349111-349133 CAGGATAATCACTTGAATCCAGG - Intronic
1094306823 12:29029504-29029526 CAGGAGAATCACATGGACCCAGG - Intergenic
1095267958 12:40181936-40181958 GAGGATAAGCAGGTGGATTCTGG - Intergenic
1095956074 12:47807030-47807052 GAGGAGAATCACTTGAATCCAGG - Intronic
1098317253 12:69205866-69205888 CAGGATAATCACTTGGACCCAGG - Intergenic
1099237007 12:80093965-80093987 TACAAAAATCAGATGGATCCTGG + Intergenic
1099614167 12:84913207-84913229 GAGAATATTCAGATGGTGCCAGG - Intronic
1099619942 12:84990297-84990319 CAGGACAATCAGTTGAATCCAGG + Intergenic
1100969754 12:100055582-100055604 CAGGATAATCAGTTGAACCCAGG + Intronic
1101068125 12:101044580-101044602 GAGAGTAATTAGATAGATCCAGG - Intronic
1101317901 12:103646078-103646100 CAGGAGAATCACTTGGATCCAGG + Intronic
1101380420 12:104209496-104209518 GAGGAGAATCACTTGAATCCAGG - Intergenic
1101818780 12:108166902-108166924 CAGGAGAATCACTTGGATCCGGG - Intronic
1102374024 12:112406768-112406790 GAGGATGATCAGAATGGTCCCGG + Exonic
1102996083 12:117351580-117351602 GAGGAATATCAGAAGGAACCTGG + Intronic
1103326956 12:120128101-120128123 TAAGGGAATCAGATGGATCCAGG + Intronic
1103638730 12:122331105-122331127 CAGGAGAATCAGTTGGACCCGGG - Intronic
1106060734 13:26288850-26288872 CAGGAGAATCAGATGAACCCAGG - Intronic
1106893750 13:34275304-34275326 CAGGATAATCGCTTGGATCCGGG + Intergenic
1107596472 13:41968050-41968072 GAGGATAAATACATGGATCAAGG - Intergenic
1108645783 13:52426228-52426250 GAGAATAATTAGATGTATGCAGG - Intronic
1108669288 13:52667435-52667457 CAGGAGAATCACTTGGATCCAGG - Intronic
1108833956 13:54516990-54517012 CAGGAGAATCAGATGAACCCAGG - Intergenic
1109033289 13:57221491-57221513 GAGGAGAATCACTTGAATCCAGG + Intergenic
1109453235 13:62546409-62546431 GAAGATAATAAGATAGATGCTGG + Intergenic
1110567489 13:76970747-76970769 CAGGAGAATCAGTTGGAACCGGG + Intergenic
1111593537 13:90381213-90381235 TGGGAAAATCAGATGGACCCGGG - Intergenic
1111802177 13:92994504-92994526 GAGGCCAATCAGTTGAATCCTGG + Intergenic
1114391299 14:22311318-22311340 GAGGATAAACAAATTGCTCCAGG - Intergenic
1115748575 14:36464087-36464109 AAGGCTAATTAGATGGATCATGG + Intergenic
1117362385 14:54989750-54989772 GAGGAGAATCACTTGAATCCAGG - Intronic
1119414766 14:74462389-74462411 CAGGATAATCACCTGAATCCGGG + Intergenic
1120647315 14:87089460-87089482 GAGAATAAAAAGATGGATTCTGG - Intergenic
1121099624 14:91241592-91241614 GAGGATAGTAAGATGGAGACAGG - Intronic
1121362056 14:93270600-93270622 CAGGATAATCACTTGAATCCAGG + Intronic
1124417750 15:29487783-29487805 CAGGATAATTAGTTGAATCCAGG - Intronic
1124425863 15:29562075-29562097 GAGGATAATCAGATGGATCCAGG + Intronic
1124705765 15:31962912-31962934 CAGGATAATCACTTGAATCCAGG - Intergenic
1126151942 15:45531117-45531139 CAGGATAATCACTTGAATCCGGG + Intergenic
1128274613 15:66342454-66342476 GAGGAGAATCACATGAATCTGGG - Intronic
1132487582 16:203056-203078 CAGGATAATCAGTTGAACCCAGG + Intronic
1133039346 16:3052031-3052053 CAGGAGAATCAGTTGAATCCTGG + Intronic
1133930154 16:10225608-10225630 CAGGATAATCACTTGGACCCAGG + Intergenic
1134835246 16:17355800-17355822 CAGGAGAATCACATGGACCCAGG - Intronic
1138269607 16:55685739-55685761 GAAGATATTCAGATGTATGCTGG + Intronic
1139567698 16:67789560-67789582 CAGGATAATCACTTGAATCCAGG - Intronic
1139836826 16:69845751-69845773 AAGAATAATCAGATGAAGCCTGG + Intronic
1140135484 16:72201906-72201928 GAGGAAAATGAGAAGGATCTGGG - Intergenic
1140779782 16:78284179-78284201 GAGGAAAATCAGATGGGAACGGG - Intronic
1142477356 17:197044-197066 GAGGAGAATCACTTGAATCCAGG - Intergenic
1143276707 17:5716945-5716967 CAGGAGAATCACTTGGATCCGGG - Intergenic
1143297402 17:5881886-5881908 GAGGTCAATGAGATGCATCCTGG + Intronic
1143946402 17:10596431-10596453 CAGGAGAATCACTTGGATCCGGG + Intergenic
1149672011 17:58422786-58422808 CAGGATAATCAGTTGAACCCAGG - Intronic
1150432346 17:65128467-65128489 TAGGAGAATCACTTGGATCCAGG - Intergenic
1150915207 17:69429787-69429809 CAGGATAATCTGATGGATGATGG - Intronic
1151258309 17:72896958-72896980 CAGGAGAATCACATGAATCCAGG + Intronic
1151609956 17:75166380-75166402 GAGGAGAATCAGTTGAACCCGGG + Intronic
1151831230 17:76552769-76552791 CAGGAGAATCACATGAATCCAGG + Intronic
1153570109 18:6462552-6462574 GAGGATGATCAGAATGGTCCCGG + Intergenic
1153693120 18:7613578-7613600 CAGGAGAATCAGTTGAATCCAGG + Intronic
1156663207 18:39373217-39373239 GAGGAGAATCACTTGAATCCAGG + Intergenic
1158136843 18:54216994-54217016 CAGGATAATCACTTGAATCCAGG + Intronic
1158323452 18:56289054-56289076 AAGGATAAACAGATGGGTCAAGG + Intergenic
1158547611 18:58409532-58409554 CAGGAGCATGAGATGGATCCAGG + Intergenic
1162678284 19:12317575-12317597 CAGGATAATCACTTGAATCCGGG - Exonic
1163120538 19:15214718-15214740 CAGGAGAATCACTTGGATCCGGG - Intergenic
1163338496 19:16688898-16688920 CAGGAGAATCACATGAATCCAGG + Exonic
1165107598 19:33481926-33481948 CAGGAGAATCACATGGACCCAGG + Intronic
1165287238 19:34852377-34852399 CAGGAGAATCACTTGGATCCAGG - Intergenic
1165965253 19:39572305-39572327 GTGGAAGATCAGATGGTTCCAGG + Intergenic
1166452971 19:42917454-42917476 CAGGATAATCACATGAACCCAGG - Intronic
1166649954 19:44565338-44565360 CAGGAGAATCAGTTGAATCCGGG + Intergenic
1166878529 19:45913097-45913119 GAGGATAATCACTTGAATCCGGG + Intergenic
1167045612 19:47047115-47047137 GAGGAGAATCACTTGAATCCAGG + Intronic
1167212798 19:48143938-48143960 GATTGTAACCAGATGGATCCAGG + Exonic
1168202483 19:54826405-54826427 CAGGAGAATCACTTGGATCCAGG - Intronic
1168205059 19:54844246-54844268 CAGGAGAATCACTTGGATCCAGG - Intronic
925422760 2:3725632-3725654 GAGGATGGCCAGGTGGATCCCGG + Intronic
925633286 2:5916646-5916668 GAGGAAAATCAGAGAGATCAAGG + Intergenic
926315555 2:11707237-11707259 GGGGATGATCAGATGGACCAAGG + Intronic
926577680 2:14600348-14600370 CTGGATTAACAGATGGATCCTGG + Intergenic
926723849 2:15982548-15982570 GAGGACAGGCAGAAGGATCCAGG + Intergenic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
927275228 2:21256885-21256907 CAGGAGAATCTGATGGCTCCAGG + Intergenic
933014837 2:77112144-77112166 GAGGTTAGTCAGAAGGCTCCTGG - Intronic
935382470 2:102466480-102466502 GACAATAATCATATGGGTCCAGG - Intergenic
935969690 2:108518682-108518704 GAGGATAATCACTTGAACCCAGG - Intergenic
939148877 2:138449536-138449558 CAGGAGAATCACATGAATCCAGG - Intergenic
939701463 2:145397647-145397669 AAGGATCATCAGATTGATCCAGG + Intergenic
940289221 2:152061917-152061939 GAGGAGAATCACATGAACCCAGG + Intronic
941110614 2:161416101-161416123 TAGGATAATCACCTGGCTCCTGG - Exonic
941217152 2:162726510-162726532 GAGGAGAATCACTTGAATCCGGG - Intronic
943366347 2:186970950-186970972 CAGGAGAATCAGTTGGACCCGGG + Intergenic
943543780 2:189249787-189249809 TAGGAGAATCAGTTGAATCCAGG - Intergenic
943594895 2:189844549-189844571 CAGGATAATCACTTGAATCCAGG + Intronic
943851334 2:192726796-192726818 GAAGATAATCGCATTGATCCAGG + Intergenic
944725007 2:202462311-202462333 CAGGAGAATCAGTTGAATCCGGG - Intronic
944933018 2:204539852-204539874 GAGGAGAATCACTTGAATCCAGG - Intergenic
945459465 2:210088635-210088657 GAGGATGATCAGAGTGCTCCTGG - Intronic
946106327 2:217373116-217373138 GAGGACTTTCAGATGAATCCTGG - Intronic
947970204 2:234317054-234317076 GAGGAGAATCACTTGGACCCGGG + Intergenic
948450881 2:238070585-238070607 CAGGAGAATCACTTGGATCCTGG + Intronic
1168991133 20:2096555-2096577 GAGGAGAATCATTTGAATCCAGG + Intergenic
1169374544 20:5055903-5055925 CAGGATAATCAGTTGGATCTGGG + Intergenic
1170176530 20:13476024-13476046 GAGGAGAATCACTTGAATCCAGG + Intronic
1172142810 20:32735408-32735430 GAGGATAATCACTTGTACCCAGG - Intronic
1173141710 20:40490532-40490554 CAGGAGAATCACTTGGATCCAGG + Intergenic
1173627893 20:44487187-44487209 GAGGAGAATCACTTGAATCCGGG + Intronic
1174611973 20:51805155-51805177 GAGGAGAATCACTTGAATCCAGG + Intergenic
1174860090 20:54083093-54083115 CAGGAGAATCAGTTGAATCCGGG + Intergenic
1176337991 21:5616670-5616692 GAGTAAAATCAGTTGGATGCTGG - Intergenic
1176339399 21:5679743-5679765 GAGTAAAATCAGTTGGATGCTGG - Intergenic
1176471653 21:7111896-7111918 GAGTAAAATCAGTTGGATGCTGG - Intergenic
1176495214 21:7493674-7493696 GAGTAAAATCAGTTGGATGCTGG - Intergenic
1176505428 21:7644713-7644735 GAGTAAAATCAGTTGGATGCTGG + Intergenic
1178005140 21:28210365-28210387 GAGGAGAACCAGATGGATGATGG - Intergenic
1178548607 21:33515545-33515567 CAGGAGAATCAGTTGAATCCAGG + Intronic
1180888327 22:19264879-19264901 GAGGACAATCACTTGAATCCGGG - Intronic
1182537474 22:31015742-31015764 CAGGAGAATCACATGAATCCGGG + Intergenic
1182558477 22:31141538-31141560 GAAGAGACTCAGATGGAGCCTGG - Intergenic
1184322342 22:43752208-43752230 CAGGAGAATCACTTGGATCCAGG - Intronic
1184505899 22:44902010-44902032 GAGGATGATCAGAAGGTCCCAGG - Intronic
950027662 3:9831889-9831911 GAGGAGAATCACTTGAATCCGGG - Intronic
950702598 3:14760700-14760722 CAGGATAATCACTTGAATCCGGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
952313781 3:32214209-32214231 CAGGATAATCACTTGAATCCGGG + Intergenic
952390365 3:32874453-32874475 GAGGAGAATCACTTGAATCCGGG - Intronic
953003362 3:38954893-38954915 CAGGAGAATCAGTTGAATCCAGG + Intergenic
954340928 3:49953310-49953332 GAGGAGAATCACTTGAATCCGGG - Intronic
956837261 3:73105720-73105742 CAGGAGAATCACATGAATCCGGG - Intergenic
957056679 3:75448659-75448681 GAGGAGAATCACTTGAATCCAGG - Intergenic
958063965 3:88519305-88519327 GAGGAGAATCACTTGGAACCAGG - Intergenic
958128788 3:89390878-89390900 CAGGAGAATCAGATGAACCCGGG - Intronic
958644648 3:96854270-96854292 CAGGATAATCACTTGAATCCAGG - Intronic
960169968 3:114448452-114448474 GAGGGCAAACAGATGGATCAAGG + Intronic
961486532 3:127221250-127221272 GAGGATTCTCAGCTGGACCCTGG - Intergenic
964112265 3:153099919-153099941 CAGGATAATCACTTGAATCCGGG - Intergenic
965151792 3:164987170-164987192 GATGATAATCAGATGGCACAGGG - Exonic
967912133 3:194551295-194551317 CAGGAGAATCACTTGGATCCAGG - Intergenic
967949128 3:194827112-194827134 CAGGAGAATCAGTTGAATCCAGG - Intergenic
971601734 4:28600487-28600509 GAGCATAATCATATGAAACCAGG + Intergenic
971977303 4:33707259-33707281 GAGGAGAATCACTTGGATCCAGG + Intergenic
973731807 4:53829960-53829982 GAGGAGAATCACTTGAATCCAGG - Intronic
973974410 4:56247751-56247773 CAGGAGAATCACATGAATCCAGG + Intronic
974709677 4:65573898-65573920 GAGGATGATCAGAATGGTCCCGG - Intronic
975241878 4:72068729-72068751 GGGGATTAGCAGATGGATTCAGG + Intronic
975401339 4:73943294-73943316 GTGAATAATTAGATGGATCAGGG - Intergenic
977320355 4:95506806-95506828 AAAGAAAATCAGATGTATCCTGG - Intronic
978074642 4:104513447-104513469 TAGAAAACTCAGATGGATCCTGG + Intergenic
980403153 4:132320162-132320184 GGGGATGAACAGATGGATCTGGG + Intergenic
980727538 4:136784514-136784536 GAGGACATCCAGATGGATCTGGG - Intergenic
980941345 4:139278132-139278154 CAGGAGAATCACTTGGATCCGGG + Intronic
981436002 4:144722759-144722781 CAGGATAATCACTTGAATCCAGG + Intronic
983129579 4:164000002-164000024 GGTGATAATCAGATTGATCATGG + Intronic
984105567 4:175541271-175541293 GAGGAAAAGTAGATGGATGCTGG - Intergenic
985416178 4:189737913-189737935 CAGGAAAATCAGAAGGATGCTGG + Intergenic
987356705 5:17069677-17069699 GAGGAAAATAAGATGGATTCAGG + Intronic
989341666 5:40382648-40382670 GAGGATAAACAGATGCCTGCAGG + Intergenic
989995299 5:50822160-50822182 GACTATAATAAGATGGCTCCAGG - Intronic
990026230 5:51193923-51193945 CAGGAGAATCAGTTGAATCCGGG - Intergenic
990410024 5:55533288-55533310 CAGGATAATCACTTGGACCCAGG + Intronic
990519231 5:56561981-56562003 GAGCATACCCAGATGAATCCAGG + Intronic
990533537 5:56697507-56697529 GAGGAGAATCACTTGAATCCAGG + Intergenic
994398381 5:99247858-99247880 GAGGAAAATCAGAATGCTCCGGG - Intergenic
994561339 5:101377003-101377025 CAGGATAATCACTTGAATCCAGG + Intergenic
994664897 5:102694671-102694693 CAGGATTATCAGATGGCTCCTGG - Intergenic
996177869 5:120381192-120381214 GTGGTTACTCTGATGGATCCTGG - Intergenic
998845590 5:146306582-146306604 CAGGAGAATCAGTTGAATCCGGG - Intronic
999002032 5:147934639-147934661 CAGGATAATCACTTGAATCCTGG - Intergenic
999247246 5:150161714-150161736 TAGGATAATCAGTGGCATCCGGG + Intergenic
999648966 5:153746949-153746971 GAGTGGAATCAGATGGATCTGGG + Intronic
999804637 5:155070359-155070381 GAGGATATTGTCATGGATCCAGG - Intergenic
1002298510 5:178244695-178244717 GAGGTTCAACACATGGATCCAGG - Intronic
1004364810 6:15002961-15002983 CAGGAGAATCAGTTGAATCCGGG - Intergenic
1004977768 6:20987349-20987371 GAGGACAATCACTTGAATCCAGG - Intronic
1007642967 6:43357602-43357624 GACTATAATCAGATCGATGCAGG + Exonic
1008280914 6:49595032-49595054 CAGGAGAATCACATGAATCCAGG - Intergenic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1009192468 6:60645955-60645977 GAAGATCCTTAGATGGATCCAGG - Intergenic
1009606504 6:65876194-65876216 AAGGAAAATCAGATCGATTCTGG - Intergenic
1010214578 6:73390084-73390106 GAGGAGAATCACTTGAATCCGGG + Intronic
1010886445 6:81248527-81248549 CAGGATAATCATCTGGACCCGGG + Intergenic
1011900697 6:92292226-92292248 GAGGAGCATTAGAAGGATCCAGG - Intergenic
1012180509 6:96146795-96146817 GAGCATATTCAGCTGGCTCCTGG - Intronic
1012430203 6:99155913-99155935 CAGGAGAATCAGTTGAATCCAGG + Intergenic
1015123374 6:129725414-129725436 AAGGATAAACAGATGAATCCAGG - Intergenic
1015210560 6:130693230-130693252 CAGGAGAATCACATGAATCCAGG + Intergenic
1018257539 6:161936876-161936898 CAGGATAATCAGTTGCACCCGGG - Intronic
1018322983 6:162633340-162633362 CAGGAGAATCAGTTGAATCCAGG + Intronic
1021435461 7:20609179-20609201 GAGGAGAATCACTTGAATCCAGG - Intergenic
1023343154 7:39243788-39243810 GAGACAAATCAGATGGATTCTGG - Intronic
1024506126 7:50163265-50163287 CAGGAGAATCACATGAATCCAGG + Intergenic
1024786948 7:52918737-52918759 CAGGAGAATCACATGAATCCGGG - Intergenic
1027299321 7:76813714-76813736 GAGGAAAATCAGATGGTTGTAGG + Intergenic
1029193704 7:98789616-98789638 CAGGAGAATCACTTGGATCCAGG - Intergenic
1029208873 7:98888442-98888464 CAGGAGAATCACTTGGATCCTGG + Intronic
1029244434 7:99188768-99188790 GAGGAGAATCACTTGAATCCAGG - Intronic
1029463826 7:100712590-100712612 CAGGAGAATCAGTTGAATCCAGG - Intergenic
1030229821 7:107196117-107196139 GAATATACTCAGATGTATCCAGG + Exonic
1032516707 7:132511711-132511733 TATGATAATGAGATGGTTCCTGG + Intronic
1032585682 7:133144411-133144433 CAGGAGAATCAGTTGAATCCAGG - Intergenic
1032594044 7:133221525-133221547 CAGGATAATCAGCTGAACCCAGG + Intergenic
1033020811 7:137722423-137722445 GAGGATGATCAGAATGGTCCCGG - Intronic
1033167900 7:139057263-139057285 CAGGAGAATCACATGAATCCAGG + Intronic
1033355399 7:140595097-140595119 CAGGAGAATCACATGAATCCAGG - Intronic
1035744962 8:1955251-1955273 GAGGATAGCCAGGTGCATCCTGG + Intronic
1035892421 8:3359311-3359333 CAGGATCATCACATGGCTCCAGG + Exonic
1037002085 8:13732185-13732207 CAGGATAATCAGTTGAATCGGGG + Intergenic
1039093689 8:33859766-33859788 GAGGATGATCAGAATGGTCCTGG + Intergenic
1039329529 8:36522002-36522024 GAGGAAAATCAGGTGGATGCAGG + Intergenic
1039661347 8:39470695-39470717 GAGGAGAAGCAGCTGGATACTGG + Intergenic
1041061852 8:54042287-54042309 CAGGAGAATCACATGAATCCTGG - Intergenic
1041074245 8:54154787-54154809 CAGGATAATCACTTGAATCCAGG - Intergenic
1048115486 8:131517197-131517219 GAGGGTAAGCAGAAGGATGCAGG - Intergenic
1048793882 8:138130505-138130527 GATGATCATCAGATTCATCCCGG + Exonic
1050531580 9:6594600-6594622 CAGGACAATCACATGAATCCGGG + Intronic
1052540453 9:29804801-29804823 GAGGAGAAGCAGATGGATGTGGG - Intergenic
1053024548 9:34719128-34719150 GAGGAAAATCACTTGAATCCAGG - Intergenic
1053118929 9:35530730-35530752 CAGGATAATCACATGAACCCAGG - Intronic
1057108292 9:92442303-92442325 CAGGAGAATCAGTTGAATCCGGG + Intronic
1057816458 9:98299499-98299521 GAGGAGATGCAGAAGGATCCTGG + Intronic
1058116248 9:101087083-101087105 CAGGAGAATCACCTGGATCCAGG + Intronic
1058984222 9:110196762-110196784 GAGGAGAATCAGTTGAACCCGGG - Intronic
1059364725 9:113777436-113777458 CAGGAGAATCACTTGGATCCAGG + Intergenic
1061629637 9:131863959-131863981 GAGGATAAGGAGCTGGATCCAGG - Intronic
1203367944 Un_KI270442v1:274732-274754 CAGGAGAATCACTTGGATCCGGG - Intergenic
1185634688 X:1543006-1543028 CAGGAGAATCACTTGGATCCGGG + Intergenic
1185801944 X:3019170-3019192 CAGGAGAATCACTTGGATCCAGG + Intronic
1187010917 X:15278398-15278420 CTGGACAATCAGATGGATTCTGG + Intergenic
1188908981 X:35822543-35822565 GAGTCCATTCAGATGGATCCAGG - Intergenic
1190367965 X:49715370-49715392 GAGGAGAATCACATGAACCCAGG - Intergenic
1190865085 X:54377611-54377633 CAGGATAATCAGTTGAATCTGGG + Intergenic
1191112145 X:56812318-56812340 TAAGAAAATTAGATGGATCCTGG + Intergenic
1193602693 X:83527195-83527217 CAGGAGAATCACATGAATCCGGG + Intergenic
1194280261 X:91943114-91943136 GAGGATAAACAGTTGGAACATGG + Intronic
1195343620 X:103927288-103927310 GAGGATATTCAGAGGCTTCCTGG - Intronic
1195693929 X:107652841-107652863 CAGGAAAATCACATGAATCCGGG - Intergenic
1196253850 X:113492817-113492839 GAGGATAATCACTTGAACCCGGG + Intergenic
1197787182 X:130210537-130210559 GGGGATAATCTGAATGATCCTGG + Intronic
1198252079 X:134889712-134889734 GAGGATAATCACATGGGACTGGG + Intronic
1200565304 Y:4757830-4757852 GAGGATAATCAGCCGTATCTGGG + Intergenic
1200597738 Y:5166608-5166630 GAGGATAAACAGTTGGAACATGG + Intronic
1201070745 Y:10145519-10145541 CAGGAGAATCACTTGGATCCAGG + Intergenic
1201465547 Y:14276333-14276355 CAGGATAATTACATGGAACCAGG + Intergenic
1201599264 Y:15710014-15710036 CAGGATAATCACCTGAATCCAGG + Intergenic
1202032328 Y:20590539-20590561 CAGGATAATCACTTGGACCCAGG + Intronic