ID: 1124432218

View in Genome Browser
Species Human (GRCh38)
Location 15:29617568-29617590
Sequence TGCGATATTAAGAAACATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124432217_1124432218 21 Left 1124432217 15:29617524-29617546 CCTGTGACATTAGCTGCTGCAAC No data
Right 1124432218 15:29617568-29617590 TGCGATATTAAGAAACATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124432218 Original CRISPR TGCGATATTAAGAAACATGA TGG Intergenic
No off target data available for this crispr