ID: 1124438694

View in Genome Browser
Species Human (GRCh38)
Location 15:29671754-29671776
Sequence AGCCCACAAGGACCCCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124438694_1124438700 22 Left 1124438694 15:29671754-29671776 CCTCTCTGGGGTCCTTGTGGGCT No data
Right 1124438700 15:29671799-29671821 AGCGATTCTCCCAGCTTCAGAGG No data
1124438694_1124438701 30 Left 1124438694 15:29671754-29671776 CCTCTCTGGGGTCCTTGTGGGCT No data
Right 1124438701 15:29671807-29671829 TCCCAGCTTCAGAGGCTGAGAGG No data
1124438694_1124438697 -8 Left 1124438694 15:29671754-29671776 CCTCTCTGGGGTCCTTGTGGGCT No data
Right 1124438697 15:29671769-29671791 TGTGGGCTTTCTGTTTGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124438694 Original CRISPR AGCCCACAAGGACCCCAGAG AGG (reversed) Intergenic
No off target data available for this crispr